ID: 1086140233

View in Genome Browser
Species Human (GRCh38)
Location 11:83490606-83490628
Sequence ACCAGATTTCTCCACTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 3, 2: 10, 3: 33, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086140233_1086140235 25 Left 1086140233 11:83490606-83490628 CCTTTATAGTGGAGAAATCTGGT 0: 1
1: 3
2: 10
3: 33
4: 163
Right 1086140235 11:83490654-83490676 AAATTAGCATCGCCAAATTGTGG 0: 1
1: 0
2: 0
3: 8
4: 101
1086140233_1086140236 26 Left 1086140233 11:83490606-83490628 CCTTTATAGTGGAGAAATCTGGT 0: 1
1: 3
2: 10
3: 33
4: 163
Right 1086140236 11:83490655-83490677 AATTAGCATCGCCAAATTGTGGG 0: 1
1: 0
2: 0
3: 3
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086140233 Original CRISPR ACCAGATTTCTCCACTATAA AGG (reversed) Intronic