ID: 1086140233 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:83490606-83490628 |
| Sequence | ACCAGATTTCTCCACTATAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 210 | |||
| Summary | {0: 1, 1: 3, 2: 10, 3: 33, 4: 163} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1086140233_1086140235 | 25 | Left | 1086140233 | 11:83490606-83490628 | CCTTTATAGTGGAGAAATCTGGT | 0: 1 1: 3 2: 10 3: 33 4: 163 |
||
| Right | 1086140235 | 11:83490654-83490676 | AAATTAGCATCGCCAAATTGTGG | 0: 1 1: 0 2: 0 3: 8 4: 101 |
||||
| 1086140233_1086140236 | 26 | Left | 1086140233 | 11:83490606-83490628 | CCTTTATAGTGGAGAAATCTGGT | 0: 1 1: 3 2: 10 3: 33 4: 163 |
||
| Right | 1086140236 | 11:83490655-83490677 | AATTAGCATCGCCAAATTGTGGG | 0: 1 1: 0 2: 0 3: 3 4: 62 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1086140233 | Original CRISPR | ACCAGATTTCTCCACTATAA AGG (reversed) | Intronic | ||