ID: 1086140659

View in Genome Browser
Species Human (GRCh38)
Location 11:83495216-83495238
Sequence ACAGACACACACATCTACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1376
Summary {0: 1, 1: 0, 2: 4, 3: 118, 4: 1253}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086140659_1086140665 -9 Left 1086140659 11:83495216-83495238 CCGTGGTAGATGTGTGTGTCTGT 0: 1
1: 0
2: 4
3: 118
4: 1253
Right 1086140665 11:83495230-83495252 TGTGTCTGTTGGAGTGGGGGAGG 0: 1
1: 0
2: 24
3: 152
4: 1314
1086140659_1086140667 -2 Left 1086140659 11:83495216-83495238 CCGTGGTAGATGTGTGTGTCTGT 0: 1
1: 0
2: 4
3: 118
4: 1253
Right 1086140667 11:83495237-83495259 GTTGGAGTGGGGGAGGTATAGGG 0: 1
1: 0
2: 2
3: 19
4: 288
1086140659_1086140666 -3 Left 1086140659 11:83495216-83495238 CCGTGGTAGATGTGTGTGTCTGT 0: 1
1: 0
2: 4
3: 118
4: 1253
Right 1086140666 11:83495236-83495258 TGTTGGAGTGGGGGAGGTATAGG 0: 1
1: 0
2: 2
3: 31
4: 414
1086140659_1086140668 3 Left 1086140659 11:83495216-83495238 CCGTGGTAGATGTGTGTGTCTGT 0: 1
1: 0
2: 4
3: 118
4: 1253
Right 1086140668 11:83495242-83495264 AGTGGGGGAGGTATAGGGAGAGG 0: 1
1: 0
2: 3
3: 79
4: 2953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086140659 Original CRISPR ACAGACACACACATCTACCA CGG (reversed) Intronic
901024259 1:6270743-6270765 AGACACACACACATGCACCAGGG - Intronic
902149655 1:14432931-14432953 ACAGCCACACATATACACCATGG - Intergenic
902439677 1:16421369-16421391 ACAGCCACACACACCTTCCTTGG + Intronic
903253718 1:22076439-22076461 ACACACACACACAACAAGCAGGG + Intronic
904029566 1:27525804-27525826 ACAGACACACACAGCTCCTGGGG - Intergenic
904145048 1:28383585-28383607 ACACACACACACAAATACCTAGG - Intronic
905110246 1:35589611-35589633 AGGGCCACACACACCTACCAGGG - Intronic
905124812 1:35708770-35708792 ACACACATACACATGCACCATGG - Intergenic
907644152 1:56224744-56224766 ATTGACACACACATTTCCCATGG - Intergenic
907952290 1:59195462-59195484 ACACACACACACACGAACCATGG + Intergenic
908069706 1:60444967-60444989 ACACACACACACACACACCAGGG - Intergenic
908223175 1:62028987-62029009 ACATACATACACGTATACCAGGG + Intronic
908501716 1:64749718-64749740 CCAGACACACACATATACAATGG - Intronic
908578008 1:65482128-65482150 ACACACACACACACACACCAGGG + Intronic
908901923 1:68965288-68965310 ACATACACATACATATATCATGG - Intergenic
909092208 1:71240216-71240238 ACACACACACACATAAAACAGGG + Intergenic
909095498 1:71282603-71282625 ACAATCACACACATATAACATGG + Intergenic
909313633 1:74187366-74187388 ACACACACACACACACACCATGG + Intronic
909860563 1:80599910-80599932 ACACACACACACACACACCATGG + Intergenic
910589312 1:88912477-88912499 ACACACACACACACACACCATGG - Intergenic
910814592 1:91277498-91277520 ACACACACACACACCCACCAGGG - Intronic
911104714 1:94120763-94120785 ACAGAGAAACACATCTTCCTGGG + Intronic
911473254 1:98344490-98344512 ACACACACACACATCCCCAATGG + Intergenic
911562478 1:99423414-99423436 ACACACACACACACACACCATGG + Intergenic
911709981 1:101060587-101060609 ACAGACTAAGACATCTGCCATGG - Intergenic
911715663 1:101129863-101129885 ACACACACACACACACACCATGG - Intergenic
911865710 1:103019145-103019167 ACAGACAAAACAATCTACCAAGG + Intronic
911958708 1:104271295-104271317 ACACACACACACACACACCATGG + Intergenic
912075373 1:105868277-105868299 ACACACACACACACACACCAAGG + Intergenic
912081248 1:105939399-105939421 ACACACACACACACACACCATGG - Intergenic
912186283 1:107280026-107280048 ACACACACACACACCAACAAAGG - Intronic
912284478 1:108354478-108354500 ACACACACACACACACACCATGG + Intergenic
912343820 1:108945062-108945084 ACAGAAACACACATAAAACAAGG - Intronic
912855617 1:113166454-113166476 AATTACACACACATCTACCTGGG - Intergenic
913080358 1:115379281-115379303 ACACACACACACACACACCATGG - Intergenic
913157240 1:116111883-116111905 ACAGGCACACACATATACACAGG - Intronic
913157242 1:116111919-116111941 ACAGGCACACACATATACACAGG - Intronic
913204326 1:116522493-116522515 ACAGAGACACACATAAAACAAGG + Intronic
913293306 1:117295206-117295228 ACACACACACACATCCCCCAAGG + Intergenic
913384126 1:118241156-118241178 ACACACACAAACATATATCATGG + Intergenic
913483017 1:119307382-119307404 ACACACACACACACACACCACGG + Intergenic
913575249 1:120166413-120166435 ACACACACACACACACACCATGG + Intronic
913576270 1:120178277-120178299 ACACACACACACACACACCATGG - Intergenic
914443214 1:147725007-147725029 ACACACACACACATGCACAATGG - Intergenic
914557555 1:148782053-148782075 ACACACACACACACACACCATGG + Intergenic
914615279 1:149348177-149348199 ACACACACACACACACACCATGG - Intergenic
914973154 1:152329935-152329957 ACACACACACACCTCTGCCACGG - Intergenic
915054710 1:153115683-153115705 ACACACACACATACCCACCATGG + Intergenic
915117891 1:153611939-153611961 ACACACACACACACCGAGCAAGG + Intronic
915506878 1:156363132-156363154 ACAAACACACACATTAACCTAGG + Intronic
915855191 1:159376008-159376030 ACACACACACACACACACCATGG - Intergenic
916346204 1:163794188-163794210 ACACACACACACACACACCATGG - Intergenic
916390430 1:164324824-164324846 ACAGGCAACAACATCTACCATGG + Intergenic
916624996 1:166545947-166545969 ACACACACACACACACACCATGG - Intergenic
916855922 1:168749491-168749513 ACACACACACACACACACCATGG - Intergenic
917127766 1:171705166-171705188 ACAGAAACACATATAAACCAAGG - Intronic
917913087 1:179671945-179671967 ACACACACACACACACACCATGG - Intronic
917929760 1:179815139-179815161 ACACACACACACAGTAACCACGG + Exonic
918487248 1:185043008-185043030 ACAGCCCCACACATCTGCAAAGG - Intergenic
918529749 1:185505107-185505129 ACACACACACACACACACCATGG - Intergenic
918554903 1:185787132-185787154 ACACACACACACATACATCATGG - Intronic
918558645 1:185837001-185837023 ACACACACACACACACACCATGG - Intronic
918573966 1:186033078-186033100 ACACACACACACACACACCATGG + Intronic
918576163 1:186063027-186063049 ACACACACACACACATTCCATGG - Intronic
918670517 1:187209667-187209689 ACACACACACACATATAGGAAGG + Intergenic
918960029 1:191262698-191262720 ACATACACACACACCCACCATGG + Intergenic
919225058 1:194687103-194687125 ACACACACACACACACACCATGG + Intergenic
919378399 1:196822549-196822571 ACAAACACACACATTAACCTCGG + Intronic
919390603 1:196980057-196980079 ACAAACACACACATTAACCTCGG + Intronic
919527275 1:198669210-198669232 ACATACTCTCAAATCTACCACGG - Intronic
919813202 1:201421873-201421895 ACACACACACACACCTCACAGGG + Intronic
919815511 1:201435880-201435902 ACATGCACACACATGCACCAAGG - Intergenic
919856649 1:201710895-201710917 ACAGGCACACACATCTCCAAGGG - Intronic
920348316 1:205321224-205321246 ACGGACTGACACATCTGCCAGGG + Intronic
921242138 1:213195817-213195839 ACACACACACACACACACCATGG - Intronic
921265980 1:213420940-213420962 ACAGAGACAGACATCACCCAGGG - Intergenic
921448299 1:215272409-215272431 ACACACACACACACACACCATGG + Intergenic
921470849 1:215547465-215547487 ACACACACACACACCTCCTAAGG - Intergenic
921668834 1:217904442-217904464 ACAGAAACACACATAAAACAAGG + Intergenic
922660673 1:227427824-227427846 ACAGATAAACACATCCACAAAGG - Intergenic
923002088 1:230015080-230015102 ACAGACACACACATTAGCCTAGG - Intergenic
923199547 1:231698126-231698148 ACAGAAACACACATAGAACAAGG + Intronic
923382472 1:233435244-233435266 ACAGACTCTCACATCTGCCTGGG + Intergenic
923498485 1:234544995-234545017 ACACACACACACACACACCAGGG - Intergenic
923775564 1:236975215-236975237 ACACACACACAAATCTTGCAAGG + Intergenic
923850807 1:237792340-237792362 ACACACACACACAGGTACCTTGG - Intronic
924280844 1:242435616-242435638 ACAGAAACACACATAAAACAAGG + Intronic
924562565 1:245169324-245169346 ACACACACACACACACACCATGG - Intronic
1062794831 10:336821-336843 ACACACACACACAGCTGCCTAGG - Intronic
1062794840 10:336887-336909 ACACACACACACACCTGCCTAGG - Intronic
1062794848 10:336969-336991 ACACACACACACAGCTGCCTAGG - Intronic
1062794852 10:337002-337024 ACACACACACACAGCTGCCTAGG - Intronic
1062794864 10:337121-337143 ACACACACACACAGCTGCCTAGG - Intronic
1062794884 10:337259-337281 ACACACACACACATCAGCCTAGG - Intronic
1062794888 10:337292-337314 ACACACACACACAGCTGCCTAGG - Intronic
1062794900 10:337399-337421 ACACACACACACAGCTACGTAGG - Intronic
1062794917 10:337572-337594 ACACACACACACATCAGCCTAGG - Intronic
1062794934 10:337714-337736 ACACACACACACATCAGCCTAGG - Intronic
1062794950 10:337881-337903 ACACACACACACAGCTTCCTAGG - Intronic
1062853557 10:765730-765752 ACACACACACACACACACCATGG + Intergenic
1063106893 10:2999882-2999904 ACACACACACACATGCAGCATGG + Intergenic
1063170741 10:3507911-3507933 ACACACACACACACACACCATGG + Intergenic
1063729485 10:8679481-8679503 ACACACACACACATACACCATGG + Intergenic
1063735191 10:8745545-8745567 ACACACACACACATATCCTAAGG + Intergenic
1063754666 10:8994163-8994185 ACAGAAACACACATAAAACAAGG + Intergenic
1064389044 10:14925560-14925582 ACAGAAACACACATAAAACAAGG - Intronic
1065051509 10:21797294-21797316 AAAGACAGACACATAGACCAAGG - Intronic
1065631128 10:27682108-27682130 ACAAACACACACATTAACCTAGG - Intronic
1066023642 10:31328990-31329012 ACACACACACACACACACCAGGG - Intronic
1066143240 10:32528621-32528643 ACACACACATACATATACCATGG - Intronic
1066174828 10:32892339-32892361 ACACACACACACATATAGAAAGG - Intergenic
1066193913 10:33080238-33080260 ACACACACACACACACACCATGG - Intergenic
1066459699 10:35602395-35602417 ACAGACACACACATAAAATAAGG + Intergenic
1066630048 10:37450340-37450362 CCAGACACACACTTCCACTATGG - Intergenic
1067775515 10:49162293-49162315 ACATACACACACATATACACAGG + Intronic
1067846825 10:49730884-49730906 ACACACACACACACACACCATGG + Intergenic
1067975534 10:51021015-51021037 ACAGACACACACCCCTACATAGG - Intronic
1068140134 10:52995760-52995782 ACACACACACACGTCTATAAGGG + Intergenic
1068228068 10:54132845-54132867 ACACACACACACACACACCAAGG + Intronic
1068485036 10:57647055-57647077 ACACACACACACACACACCAGGG - Intergenic
1068557007 10:58469372-58469394 ACACACACACACAACTAGCCAGG - Intergenic
1068670813 10:59721370-59721392 ACACACACACACACACACCACGG - Intronic
1069113145 10:64471069-64471091 ACAGACAAACACCTATACCCTGG + Intergenic
1070477346 10:76842828-76842850 ACACACACACACACACACCAAGG - Intergenic
1070648978 10:78221453-78221475 ACACACACACACATGCCCCAAGG - Intergenic
1070823667 10:79378858-79378880 TCACACACACACATCTCACACGG - Intergenic
1071242293 10:83721142-83721164 ACAGACAGACGCATAGACCAAGG + Intergenic
1071451924 10:85802869-85802891 ACACACACACACACACACCAAGG + Intronic
1071811010 10:89180825-89180847 ACAGAAACACACATAAAACAAGG + Intergenic
1071867846 10:89756095-89756117 AAGGACACACACTTCAACCAAGG - Intronic
1072143676 10:92614054-92614076 ACACACACACACATATAGTAGGG + Intronic
1072225981 10:93369250-93369272 ACACACACACACACCAACCCAGG - Intronic
1072489877 10:95894577-95894599 ACACACACACACACCCACGAGGG + Intronic
1072548961 10:96462636-96462658 ACAGAAACACACATAAAACAAGG - Intronic
1072551858 10:96484613-96484635 ACACACACACACACACACCATGG + Intronic
1073270722 10:102261282-102261304 ACACACACACACATATACACTGG + Intronic
1074091323 10:110260406-110260428 ACACACACACACCTGTATCAAGG - Intronic
1074214194 10:111368308-111368330 ACACACACACACATATACAGAGG - Intergenic
1075132876 10:119755362-119755384 ACAGACACACACAGTTACAGAGG - Intronic
1075260624 10:120960696-120960718 ACAGAAACACACATAAAACACGG - Intergenic
1075351162 10:121726215-121726237 ACACACACACACACATAACAAGG - Intergenic
1075542467 10:123326680-123326702 ACAGAGACACGCATAAACCAAGG + Intergenic
1076182016 10:128416835-128416857 ACAGACACACACATTAGCCTAGG - Intergenic
1076211619 10:128651097-128651119 ACACACACACACATACGCCATGG + Intergenic
1076218534 10:128715208-128715230 ACACACACACACATATACATCGG - Intergenic
1076682042 10:132177983-132178005 ACAGACACACACACTACCCAGGG - Intronic
1077143615 11:1035453-1035475 AGAGACCCCCACATCTCCCACGG + Intronic
1077143648 11:1035573-1035595 AGAGACCCCCACATCTCCCACGG + Intronic
1077342623 11:2032838-2032860 CCCCACACACACATCCACCATGG + Intergenic
1077841710 11:5982653-5982675 ACAGAGACACCCATCCCCCAAGG - Intergenic
1077920004 11:6634532-6634554 ACAGAAACACACATCAAACAAGG - Intronic
1078294615 11:10055555-10055577 ACACACACACACACACACCATGG + Intronic
1078398615 11:11003290-11003312 ACAGACACACGCATGCATCATGG + Intergenic
1078703992 11:13720274-13720296 ACACACACACACAGCTAACACGG - Intronic
1079059243 11:17233556-17233578 ACACACACACACATACACCTAGG - Intronic
1079162849 11:18011156-18011178 ACACACACACACCCCTAACAAGG + Intronic
1079179948 11:18183151-18183173 ACACACACACACACACACCATGG + Intronic
1079195108 11:18319283-18319305 ACACACACACACATCTTATAAGG + Intronic
1079270286 11:18978197-18978219 ACACACACACACATATACCATGG - Intergenic
1079299469 11:19264907-19264929 ACAGAAACACACATAAAACAAGG + Intergenic
1079627099 11:22628992-22629014 ACACACACACACACATACCATGG - Intronic
1080402772 11:31952818-31952840 ACACACACACACACATACAATGG + Intronic
1080635901 11:34122803-34122825 ACACAGACACATATATACCAGGG + Intronic
1081790468 11:45779720-45779742 ACAAACACACACATACACCTGGG + Intergenic
1082126764 11:48441228-48441250 ACACACACACACACACACCATGG - Intergenic
1082560334 11:54612188-54612210 ACACACACACACACACACCATGG - Intergenic
1082674812 11:56083918-56083940 ACATACACACACATATATCTGGG + Intergenic
1082674856 11:56084585-56084607 ACACACACACACATCTCTCAAGG + Intergenic
1082868941 11:57925714-57925736 ACACACACACACACACACCATGG - Intergenic
1083063541 11:59899474-59899496 ACACACACACACATACACAAAGG + Intergenic
1083131378 11:60626201-60626223 ACACACACACACATACACAATGG + Intergenic
1083136559 11:60683769-60683791 ACACACACACACATATAAAAAGG + Intergenic
1083359703 11:62097693-62097715 ACACACACACACATCACCCTAGG - Intergenic
1083359732 11:62098162-62098184 ACACACACACACATCACCCTAGG + Intergenic
1083740729 11:64710247-64710269 ACAGACACACACACACACAATGG + Intronic
1084514725 11:69630509-69630531 TCAGACACACACGTCTCCCAAGG + Intergenic
1084578911 11:70010130-70010152 ACACACACACACACACACCATGG - Intergenic
1084948322 11:72650915-72650937 ACACACACACACATACACAAAGG + Intronic
1085599241 11:77840108-77840130 ACACACACACACAACACCCAGGG + Intronic
1086051098 11:82591396-82591418 ACACACACACACACACACCATGG - Intergenic
1086140659 11:83495216-83495238 ACAGACACACACATCTACCACGG - Intronic
1086315234 11:85584335-85584357 ACACACACACACACACACCATGG - Intronic
1086420588 11:86633773-86633795 ACAGACAGAAGCATCTACCATGG + Intronic
1086427367 11:86699145-86699167 ACAGACACACACATTTAAACTGG + Intergenic
1086748875 11:90465002-90465024 ATATACACACACACCTACTAAGG + Intergenic
1086950553 11:92886324-92886346 ACACACACACACACACACCAGGG - Intronic
1087429599 11:98035982-98036004 ACACACACACACACACACCATGG + Intergenic
1087681884 11:101227974-101227996 ACACACACACACACCCAACAGGG + Intergenic
1087722851 11:101686533-101686555 ACACGCACACACATCTCCCATGG - Intronic
1088187029 11:107181985-107182007 ACACACACACACACACACCATGG + Intergenic
1088390056 11:109304435-109304457 ACAGAAACACACATAAAACAAGG + Intergenic
1088464537 11:110120237-110120259 ACAGAAACACACATAAAACAAGG - Intronic
1088605209 11:111523408-111523430 ACAGAAACACACATAAAACAAGG + Intronic
1090466629 11:126940567-126940589 ACAGACACACACACACACCGTGG - Intronic
1091361220 11:134979824-134979846 ACAGACACACACATTAGCCAAGG + Intergenic
1202825609 11_KI270721v1_random:88027-88049 CCCCACACACACATCCACCATGG + Intergenic
1092613607 12:10196596-10196618 ACACACACACACAATTAGCAGGG - Intergenic
1092756211 12:11765921-11765943 ACAGACGCTCACACCCACCACGG - Intronic
1092785334 12:12021413-12021435 ACACACACACATATATACAATGG + Intergenic
1093119763 12:15254677-15254699 ACAGACACACACACACACAAAGG - Intronic
1093290663 12:17317214-17317236 ACACACACACACCTATATCATGG - Intergenic
1093471130 12:19503324-19503346 ACACACACACACACACACCAAGG - Intronic
1093504523 12:19849746-19849768 ACAGAAACACACATAAAACAAGG + Intergenic
1093630687 12:21405571-21405593 AAAAACAGACACATCGACCAAGG + Intronic
1093720211 12:22433102-22433124 ACACACACACACACACACCATGG - Intronic
1094122098 12:26985683-26985705 ACACACAAACATATCTGCCAAGG + Intronic
1094180164 12:27584098-27584120 ACAGAAACACACATAAAACAAGG - Intronic
1094248605 12:28332733-28332755 ACAGAAACACACATAAAACAAGG - Intronic
1095500578 12:42833748-42833770 ACACACACACATACATACCATGG - Intergenic
1095739409 12:45590729-45590751 ACACACACACACATACCCCATGG - Intergenic
1095777496 12:46025645-46025667 ACACACACACACACACACCAAGG - Intergenic
1095808986 12:46351709-46351731 ACACACACACACACACACCATGG - Intergenic
1095908598 12:47403231-47403253 CCAGACACACCCCTCTACCTAGG + Intergenic
1096344780 12:50836227-50836249 ACACACACACACACACACCATGG + Intergenic
1097370388 12:58771774-58771796 ACAGACACACACACACACCATGG + Intronic
1097448126 12:59700154-59700176 ACAGAAACACACATAAAACAAGG + Intronic
1097500887 12:60400725-60400747 ACAGACACACACACACACAATGG - Intergenic
1097505890 12:60469258-60469280 ACAGACACTGAGACCTACCAGGG - Intergenic
1097536893 12:60883537-60883559 ACACACACACACACACACCACGG - Intergenic
1097642542 12:62199567-62199589 ACATACACACACACACACCATGG - Intronic
1098020422 12:66149892-66149914 ACACACACACACTCCTACTAGGG + Intronic
1098221611 12:68275693-68275715 ACAGAAACACACATAAAACAAGG - Intronic
1098326267 12:69305987-69306009 ACACACACACACATTCTCCATGG - Intergenic
1098371465 12:69764876-69764898 ACACACACACACAAATACCTAGG - Intronic
1098561415 12:71877185-71877207 ACACACACACACACATAACATGG - Intronic
1099243169 12:80162653-80162675 ACAGAGACAGACATGTACCCAGG - Intergenic
1099248570 12:80223242-80223264 ACATACACACACACACACCATGG - Intronic
1099283633 12:80686773-80686795 ACACACACACCCCTATACCAAGG + Intergenic
1099370316 12:81820980-81821002 ACATACACACACATATATAATGG + Intergenic
1099552296 12:84062749-84062771 ACAGACACACACATACACCTGGG + Intergenic
1099765974 12:86984956-86984978 ACACACACACACACACACCATGG + Intergenic
1100234551 12:92647253-92647275 ACACACACACACACATACAATGG + Intergenic
1100484968 12:95016421-95016443 AGAAACTCACACATGTACCAGGG - Intergenic
1100519831 12:95363826-95363848 ACACACACACACATATATGAAGG + Intergenic
1100801127 12:98231775-98231797 ACAAACCCAAAAATCTACCAAGG + Intergenic
1101009600 12:100435801-100435823 ACACACACACACACACACCATGG - Intergenic
1101179914 12:102204785-102204807 ACACACACACACACCTTCTAAGG - Intergenic
1101445434 12:104733947-104733969 ACAGGCACACACTTTTGCCAGGG - Intronic
1101543874 12:105691193-105691215 ACACACACACACACACACCATGG - Intergenic
1101584121 12:106069596-106069618 ACAGAGACACACATAAAACAAGG + Intronic
1101817606 12:108157776-108157798 ACAAACCCAAATATCTACCAGGG - Intronic
1101905416 12:108821231-108821253 ACACACACACACAACTAGCTGGG + Intronic
1102075532 12:110056968-110056990 ACAGACAAATACATCCATCAAGG + Intronic
1102422036 12:112811159-112811181 ACAGAAACACACATAAAACAAGG - Intronic
1102459456 12:113091270-113091292 ACACACACTCACATATTCCAGGG - Intronic
1102459483 12:113091426-113091448 ACACAGACACACAGATACCAGGG - Intronic
1102566558 12:113801130-113801152 ACAAACACACACGTCCAACAGGG + Intergenic
1102587515 12:113933499-113933521 ACAGACACGCACAACTTCCCGGG + Intronic
1102695844 12:114798770-114798792 ACACACACACACACCTGCCCGGG - Intergenic
1102926421 12:116829535-116829557 ACGTACACCCACATCTACCAAGG - Intronic
1102946395 12:116992757-116992779 ACACACACACACACACACCATGG - Intronic
1103888125 12:124217902-124217924 ACAGACACAGACACCACCCAGGG + Intronic
1104045690 12:125160922-125160944 ATAGACTAACACATCTCCCAAGG + Intergenic
1104265111 12:127224744-127224766 ACAGACACACACACACACAATGG - Intergenic
1104424648 12:128665729-128665751 ACAGGCACACACATACACCCAGG + Intronic
1104490822 12:129191315-129191337 ACACACACACACTTCTACATAGG + Intronic
1104590738 12:130082981-130083003 TAACACACACACATATACCAAGG + Intergenic
1104833321 12:131769960-131769982 ACAGACACACACATATATCCAGG - Intronic
1105039490 12:132950656-132950678 ACAGACACACACAGATACACAGG + Intronic
1105580441 13:21690999-21691021 ACAGAAACACACATAAAACAAGG + Intronic
1105776534 13:23667047-23667069 AAAGACACACACATACACAAAGG - Intronic
1105807491 13:23964004-23964026 ACACACAAACAAATCTAACAAGG - Intergenic
1106433167 13:29701712-29701734 ACACACACACACACATACCATGG + Intergenic
1106555519 13:30805098-30805120 ACACACACACACACACACCAGGG + Intergenic
1106877672 13:34091820-34091842 ATAGACACTCACATCTAATAAGG - Intergenic
1106888536 13:34217001-34217023 ACACACACACACACACACCAAGG - Intergenic
1107186028 13:37521844-37521866 ACACACACACACATAGACCTAGG - Intergenic
1107208195 13:37821220-37821242 ACACACACACACAAATACCTAGG + Intronic
1107614556 13:42151474-42151496 ACACACACACACACACACCATGG - Intronic
1107687932 13:42922856-42922878 ACGTGCACACACATCTTCCATGG + Intronic
1108169518 13:47726897-47726919 ACAGACACACACATAAAATAAGG + Intergenic
1108537456 13:51399699-51399721 ACACACACACACACCCACAATGG - Intronic
1108747152 13:53407800-53407822 ACAGACACACACATTAGCCTAGG + Intergenic
1108835494 13:54541693-54541715 ACACACACACACCCCTACCAAGG - Intergenic
1108875923 13:55051092-55051114 ACACACACACACACACACCATGG + Intergenic
1108902373 13:55427807-55427829 ACACACACACACACACACCATGG + Intergenic
1108910354 13:55542609-55542631 ACAGACATACACATATATCCAGG - Intergenic
1109040170 13:57324081-57324103 ACACACACACACACACACCATGG - Intergenic
1109215927 13:59590092-59590114 ACACATACACACATTTACTAAGG + Intergenic
1109253410 13:60048599-60048621 AAAGAAACAAACATCTTCCAGGG - Intronic
1109253419 13:60048738-60048760 AAAGAAACAAACATCTTCCAGGG - Intronic
1109253428 13:60048877-60048899 AAAGAAACAAACATCTTCCAGGG - Intronic
1109357655 13:61251897-61251919 AGAGGTAAACACATCTACCAGGG - Intergenic
1109532754 13:63673095-63673117 ACAGAAACACACATATACATAGG - Intergenic
1109727078 13:66355686-66355708 ACAGAAACACACATAAAACAAGG + Intronic
1109831041 13:67789268-67789290 ACAGACACACACATTAGCCTAGG - Intergenic
1109871081 13:68334734-68334756 ACAGAAACACACATAAAACAAGG - Intergenic
1109939891 13:69348007-69348029 ACACACACACACACACACCATGG + Intergenic
1109954187 13:69544402-69544424 ACACACACACACACACACCATGG + Intergenic
1109976070 13:69833867-69833889 ACACACACACACATATGCCATGG + Intronic
1110054260 13:70944943-70944965 ACACACACACACATTTCTCAAGG + Intergenic
1110088800 13:71418187-71418209 ACACACACACACAAATACCTAGG - Intergenic
1110178420 13:72585589-72585611 ACAGTCAAACACATCTACCCAGG + Intergenic
1110516572 13:76419733-76419755 ACAGAAACACACACAAACCAGGG + Intergenic
1110746569 13:79060683-79060705 ACACACACACACATACACCATGG + Intergenic
1111038778 13:82715915-82715937 ACACACACACACATATATCCTGG - Intergenic
1111206303 13:85015720-85015742 ACAAACACACACGTTAACCAAGG - Intergenic
1111259517 13:85718247-85718269 ACACACACACACACACACCAAGG + Intergenic
1111423173 13:88044496-88044518 ACATATACACACATATACAAAGG + Intergenic
1111490403 13:88965718-88965740 ACACACACACACATACACAATGG - Intergenic
1111659987 13:91197359-91197381 ACACACACACACACATACAACGG - Intergenic
1111724820 13:91993583-91993605 ACAGACACACACATTCAACCTGG - Intronic
1111881797 13:93966352-93966374 ACATTCACACACATATACCTTGG - Intronic
1112004227 13:95240556-95240578 ACACACACACACATCTTCAGAGG + Intronic
1112121552 13:96417914-96417936 ACAGAAACACACATAAAACAAGG - Intronic
1112154392 13:96801503-96801525 ACACACACACACATATATAAAGG - Intronic
1112483360 13:99797547-99797569 ACACACACAAACAGCTAACATGG - Intronic
1112669704 13:101620863-101620885 AGAGACAGGCACATTTACCATGG - Intronic
1112773803 13:102822433-102822455 ACAAACACACACACACACCACGG - Intronic
1112862718 13:103852795-103852817 ACAGAGGCATACATGTACCATGG - Intergenic
1113024426 13:105924575-105924597 ACACACACACACATACACGAAGG + Intergenic
1113170955 13:107502738-107502760 ACAGAAAAACACAACTATCAGGG - Intronic
1113729220 13:112627546-112627568 ACACACACACACAACTTCCAGGG - Intergenic
1113756561 13:112815848-112815870 ACAGACAAACACCTGTAACAAGG - Intronic
1113758228 13:112828945-112828967 ACAGAAACAACCATCTGCCATGG + Intronic
1113818408 13:113192464-113192486 ACAGGCAGACACAGCTACCCAGG + Intronic
1113867661 13:113538291-113538313 ACACACACGCACATGTGCCACGG - Intronic
1113888334 13:113723205-113723227 ACAGGCACACACATGTACACAGG - Intronic
1113982169 13:114285284-114285306 GTAGACAGACACATCCACCAAGG - Intronic
1114181560 14:20372353-20372375 ACACACACACACATATTCCTGGG - Intronic
1114328728 14:21615216-21615238 ACACACACACACATACACCGTGG - Intergenic
1114370423 14:22081220-22081242 ACACACACACAGATGTACCTTGG + Intergenic
1114391498 14:22313327-22313349 ACACACACACACACATATCATGG + Intergenic
1115019829 14:28663180-28663202 ACAGAAACACACATCCAACAGGG - Intergenic
1115053576 14:29094659-29094681 ACACACACACACACACACCATGG - Intergenic
1116309271 14:43301226-43301248 ACACAAACACACATACACCACGG + Intergenic
1116317007 14:43410288-43410310 ACAGACACACACACATACCATGG - Intergenic
1116375257 14:44191177-44191199 ACACACACACATATATATCATGG - Intergenic
1116568014 14:46476715-46476737 ACACACAAACACATCTACCTTGG - Intergenic
1117022506 14:51585916-51585938 ACACACACACACACATGCCATGG - Intronic
1117151830 14:52897032-52897054 ACACACACACACACACACCATGG + Intronic
1117192742 14:53309147-53309169 ACACACACACACACACACCATGG - Intergenic
1117456307 14:55900470-55900492 ACAAACACACACATTAACCTAGG + Intergenic
1117486019 14:56197931-56197953 ACACACACACACACACACCAGGG + Intronic
1117855470 14:60026847-60026869 AAAGACAGACACATAGACCAAGG - Intronic
1118117724 14:62799731-62799753 ACACACACACACACATATCAGGG + Intronic
1118503598 14:66387113-66387135 ACACACACACACATTTAATAAGG + Intergenic
1118698247 14:68406880-68406902 ACAGACACACACATTAGCCTAGG + Intronic
1119374217 14:74175986-74176008 ACAAACACACACATTAACCTAGG + Intronic
1119411251 14:74432132-74432154 ACACACACACACACCTTCCAAGG - Intergenic
1120055768 14:79922380-79922402 ACACACACACACACACACCATGG - Intergenic
1120156307 14:81096919-81096941 ACACACACACACACACACCAGGG - Intronic
1120216514 14:81686413-81686435 ACACACACACACACAAACCATGG + Intergenic
1120236186 14:81893972-81893994 ACACACACACACACACACCATGG + Intergenic
1120342125 14:83235044-83235066 ACATACACACACATCTAGTTTGG + Intergenic
1120432533 14:84437381-84437403 ACACACACACACAAATACCCTGG + Intergenic
1120655252 14:87181454-87181476 ACACACACACACAGAGACCACGG + Intergenic
1120698267 14:87668763-87668785 ACACACACACACAGTTACAAAGG + Intergenic
1120761266 14:88287670-88287692 ACACACACACACACACACCATGG - Intronic
1120763218 14:88304863-88304885 ACAGAAACACACATACAACAAGG + Intronic
1121150963 14:91634666-91634688 ACATACACACACACACACCATGG + Intronic
1121218831 14:92269875-92269897 ACACACACACGTATCTCCCATGG + Intergenic
1121255876 14:92529932-92529954 ACAGAGACACACATAAAACAAGG + Intronic
1121937110 14:98030004-98030026 ACAGCTACTCACCTCTACCATGG + Intergenic
1122616068 14:103018900-103018922 AGAGACAGACACAGCTTCCAGGG + Intronic
1122659875 14:103288074-103288096 ACACACACACACATCCCCCAGGG + Intergenic
1123401499 15:19991207-19991229 ACAGACACACAGACACACCACGG + Intergenic
1123980130 15:25594588-25594610 ACAGAAACACACATAAAACAAGG + Intergenic
1123989041 15:25669671-25669693 ACACACACACACACACACCATGG - Intergenic
1124108467 15:26763622-26763644 ACACACACACACACACACCATGG + Intronic
1124364044 15:29059634-29059656 ACAGAAACACACATAAAACAAGG + Intronic
1124411217 15:29438861-29438883 ACAGAAACACACATGAAACAAGG + Intronic
1124927687 15:34087473-34087495 TCAGACACACAGATAGACCAAGG - Intronic
1125194565 15:37031412-37031434 ACACACACACACATATGCAAGGG - Intronic
1125228504 15:37424756-37424778 ACACACACACACACACACCATGG - Intergenic
1125980843 15:43999820-43999842 ATACACACACACATATACAATGG + Intronic
1126332860 15:47552546-47552568 ACACACACACACATATGGCAAGG + Intronic
1126430236 15:48575827-48575849 ACACACACACACACACACCATGG + Intronic
1126663014 15:51050785-51050807 ACAAACACACACATTAACCTAGG + Intergenic
1126935801 15:53706317-53706339 ACACACACGCACATATAACATGG - Intronic
1127036211 15:54920441-54920463 ACACACACACACACACACCATGG - Intergenic
1127101677 15:55572195-55572217 AAAAACACACACATTCACCATGG + Intronic
1128001999 15:64201697-64201719 ACACACACACACATGTCCAATGG - Intronic
1128348808 15:66875363-66875385 ACAGAAACACACATGAAACAAGG - Intergenic
1128529411 15:68433474-68433496 ACACACACACACACACACCAGGG - Intergenic
1128659680 15:69489585-69489607 ACAAGTACACACATCTACCATGG - Intergenic
1128723500 15:69970713-69970735 ACACACACACACACACACCAGGG + Intergenic
1128859757 15:71057988-71058010 ACAGAAACACACATATAACAGGG + Intergenic
1129178973 15:73859635-73859657 ACACACACACACATCATCCAAGG + Intergenic
1129901785 15:79157098-79157120 CCAGACCCACACAGCTAGCAAGG + Intergenic
1130101907 15:80900575-80900597 ACACACACACACCCCTACCTGGG - Intronic
1130113464 15:80986063-80986085 ACACACACACACATATACAATGG - Intronic
1130121684 15:81054797-81054819 ACACACACACACATACACCATGG + Intronic
1130346482 15:83051892-83051914 ACACACACACACATCTATCTGGG + Intronic
1130781660 15:87046263-87046285 ACACACACACACATTTTCCAAGG + Intergenic
1130878687 15:88036200-88036222 ACACACACACACGTATATCAAGG + Intronic
1131558456 15:93419159-93419181 ACACACACATACATATACCTAGG + Intergenic
1131668409 15:94594761-94594783 ACGGCCACACACATCCAGCAAGG - Intergenic
1132009144 15:98259058-98259080 CTAGACAACCACATCTACCAGGG + Intergenic
1132023024 15:98381122-98381144 ACACACACACACATTTACAGAGG - Intergenic
1133251255 16:4483156-4483178 ACACACACACACACACACCAGGG - Intronic
1133420310 16:5640839-5640861 ACACACACACACACACACCATGG + Intergenic
1133499253 16:6349955-6349977 AGAGACACGCACATTCACCATGG - Intronic
1133648843 16:7790425-7790447 ACACACACACACATTTACTGTGG - Intergenic
1133757765 16:8775572-8775594 ACACACACACACAGCCATCAGGG + Intronic
1133996513 16:10752538-10752560 CCAGACACACACAACTAGGAGGG - Intronic
1134313720 16:13099290-13099312 ACACACACACACATCTCTGATGG + Intronic
1134366896 16:13587475-13587497 ACACACACACACACATACCATGG + Intergenic
1134501002 16:14769218-14769240 ACACACACACACACATACAAAGG - Intronic
1134579581 16:15359832-15359854 ACACACACACACACATACAAAGG + Intergenic
1134715124 16:16354366-16354388 ACACACACACACACATACAAAGG - Intergenic
1134723002 16:16397727-16397749 ACACACACACACACATACAAAGG - Intergenic
1134895542 16:17883244-17883266 ACAGAAACACACATAAAACAAGG + Intergenic
1134913009 16:18045455-18045477 ACAGCCACACAGATCAACCTAGG - Intergenic
1134944426 16:18314144-18314166 ACACACACACACACATACAAAGG + Intergenic
1134951691 16:18354294-18354316 ACACACACACACACATACAAAGG + Intergenic
1135039108 16:19104267-19104289 ACACACACACACATGAAACAAGG - Intergenic
1135853053 16:25982048-25982070 ACAGACACACACATATGCACAGG + Intronic
1135904402 16:26497973-26497995 ACACACACACACAGCCCCCAAGG + Intergenic
1136020930 16:27439625-27439647 ACAGACACACACATTACTCACGG + Intronic
1136272209 16:29155059-29155081 ACACACACACACACACACCAGGG + Intergenic
1137979600 16:53058435-53058457 ACAGAAACACACATAAACAAAGG + Intronic
1138867118 16:60835248-60835270 ACACACACACACCCCTATCAAGG - Intergenic
1139003877 16:62547529-62547551 ACACACACACACACTCACCATGG - Intergenic
1139063212 16:63280964-63280986 ACACACACACACACACACCATGG + Intergenic
1139075213 16:63438012-63438034 ACACACACACACATATACATAGG + Intergenic
1139092713 16:63667804-63667826 ACAGGCATACACATATACTATGG + Intergenic
1139128430 16:64110370-64110392 ACACACACACACTTCTAACATGG - Intergenic
1139389940 16:66601076-66601098 ACACACACACACACAAACCATGG - Intergenic
1140434252 16:74932455-74932477 ACACACACACACAACTATCCTGG + Intronic
1140458635 16:75119847-75119869 ACACACACACACATACACAAAGG + Intergenic
1140567231 16:76058398-76058420 ACACACACACACACAAACCATGG - Intergenic
1141030366 16:80582425-80582447 ACACACACACACACACACCAAGG + Intergenic
1141346779 16:83253888-83253910 ACAGACACACAAATATACATAGG + Intronic
1141390752 16:83661356-83661378 ACATACACACCCAGCTACTAGGG + Intronic
1141459657 16:84170380-84170402 ACAGACACACACACCTCTCAGGG + Intronic
1141775498 16:86120247-86120269 ACAGAAACACACATCATACAGGG - Intergenic
1141897644 16:86968825-86968847 ACTGTCACAGACATCCACCAAGG + Intergenic
1142075786 16:88116975-88116997 ACACACACACACACACACCAGGG + Intronic
1203122300 16_KI270728v1_random:1549286-1549308 ACACTCACATACATCTACCCAGG + Intergenic
1142867840 17:2801590-2801612 ACACACACACACACATACCCTGG - Intronic
1143917718 17:10306211-10306233 ACACACACACACATCTATTTTGG - Intronic
1144069509 17:11655347-11655369 ACACACACACACACACACCATGG - Intronic
1144194727 17:12879738-12879760 ACACACACACACACTTACAAGGG + Intronic
1144277920 17:13693316-13693338 ACAGAAACACACATAAAACAAGG + Intergenic
1144510777 17:15874122-15874144 ACACACACACACACACACCATGG + Intergenic
1145956626 17:28859145-28859167 TCAGACACACACCTCTACCCAGG + Intronic
1146177869 17:30678209-30678231 ACAGAGACACACAGAGACCATGG - Intergenic
1146491802 17:33288748-33288770 ACACACACACACAACTAATATGG + Intronic
1146915328 17:36674701-36674723 ACACACACACACACACACCATGG + Intergenic
1147229483 17:39006913-39006935 ACACACACACACACACACCAGGG + Intergenic
1147940178 17:44041023-44041045 ACACACACACACTTCTAACTGGG + Intronic
1148291607 17:46456201-46456223 ACACACACACACATATCCCATGG - Intergenic
1149034792 17:52121686-52121708 ACACACACACACACACACCAGGG + Intronic
1149075444 17:52592618-52592640 ACACACACACACAAATAACATGG - Intergenic
1149896943 17:60435678-60435700 AGAGTCACACACATCTGCCCTGG - Intergenic
1150528906 17:65956418-65956440 ACACACACACACACACACCATGG + Intronic
1150766522 17:68006621-68006643 ACACACACACACACACACCACGG + Intergenic
1151023925 17:70655100-70655122 ACACACACACACACCTGCAAAGG - Intergenic
1151116574 17:71742388-71742410 ACACACACACACACACACCATGG + Intergenic
1151145167 17:72033816-72033838 ACAAACACACAAATCTATTAAGG - Intergenic
1151264001 17:72939613-72939635 ACAGACACACACAGGGACGAAGG + Intronic
1151760895 17:76102444-76102466 ACACACACACACAATTAGCAAGG + Intronic
1152002521 17:77655510-77655532 ACAGACCCCCACAGCCACCATGG - Intergenic
1152056242 17:78029825-78029847 ACACACACACACATAAGCCAAGG + Intronic
1152220979 17:79066250-79066272 ACACACACACACATATAGGATGG + Intergenic
1152900840 17:82940235-82940257 ACACACACACACTTCTAAAAGGG + Intronic
1152974367 18:199770-199792 ACAGAAACACACATAAAACAAGG + Intronic
1153038400 18:786858-786880 ACAGAAACACACATATAACAAGG + Intronic
1153038954 18:792556-792578 ACACACACACACATATACAGAGG - Intronic
1153254236 18:3154639-3154661 ACACACACACACATTTATAATGG + Intronic
1153337967 18:3944106-3944128 ACAGACACACACACGTCCTATGG - Intronic
1153350813 18:4079319-4079341 ACACACACACACACACACCATGG + Intronic
1153591294 18:6676218-6676240 ACACACACACACATTTAACCTGG + Intergenic
1153718293 18:7874130-7874152 ACATACAGACACATATACGAAGG - Intronic
1154018420 18:10640949-10640971 TCAGACACACACATCAGCCTAGG + Intergenic
1154148611 18:11887514-11887536 ACAGACACACACAGCAAGTAAGG + Intronic
1154494073 18:14943068-14943090 ACAGACACACACATTAGCCAAGG - Intergenic
1154943990 18:21142567-21142589 ACACACACACACAACTACCCGGG - Intergenic
1155051712 18:22153881-22153903 ACAGAAACACACATAAAACAAGG + Intergenic
1155060531 18:22224188-22224210 ACACACACACACATTTAAGAGGG - Intergenic
1155105652 18:22663193-22663215 ACACACACACACAAATACCTAGG + Intergenic
1155547341 18:26929113-26929135 ATAGACACAAACATACACCATGG - Intronic
1155639467 18:27996665-27996687 ACACACACACACGTGTCCCAAGG + Intronic
1156261007 18:35445022-35445044 ACACACACACACACACACCATGG - Intronic
1156693414 18:39736266-39736288 ACAAACACACACACACACCAGGG + Intergenic
1156790470 18:40966838-40966860 ACACACACACACACACACCATGG - Intergenic
1157013972 18:43687153-43687175 ACACACACACACACACACCATGG + Intergenic
1157065060 18:44339983-44340005 ACACACACACACACACACCATGG - Intergenic
1157193341 18:45599556-45599578 ACAGACACAATCATGTTCCATGG - Intronic
1157232158 18:45927620-45927642 ACACACACACACACGCACCAAGG + Intronic
1157238008 18:45982135-45982157 ACAGACACACACACATACAAAGG - Intergenic
1157303793 18:46501601-46501623 ACAGAAACACACATAAAACAAGG + Intronic
1157418956 18:47529334-47529356 ACACACACACACATATGCCAAGG - Intergenic
1157508016 18:48245106-48245128 ACACACACACACACACACCATGG + Intronic
1158003097 18:52642104-52642126 ACACATACACACATATACGATGG + Intronic
1158037279 18:53048482-53048504 ACACACACACACACAAACCATGG - Intronic
1158061779 18:53352798-53352820 ACACACATACACATATACAAAGG - Intronic
1158162532 18:54501782-54501804 ACAGAAACACACATAAAACAAGG + Intergenic
1158297688 18:56016699-56016721 ACAAACACACACATTAGCCAAGG + Intergenic
1158423821 18:57321473-57321495 ACAAACACACACATCAGCCTAGG + Intergenic
1158647749 18:59263029-59263051 ACACACACACACACACACCATGG - Intergenic
1158822129 18:61172444-61172466 ACACACACACACATATATCATGG + Intergenic
1158911878 18:62072061-62072083 ACACACACACACATTCACCTAGG - Intronic
1158968019 18:62640073-62640095 ACACACACACACACACACCATGG + Intergenic
1159147714 18:64476039-64476061 ACTGATATACACATGTACCAAGG + Intergenic
1159367979 18:67494475-67494497 ACAGAAACACTCATGAACCAAGG + Intergenic
1159589447 18:70317415-70317437 ACACACACACACACACACCATGG - Intronic
1159686533 18:71428127-71428149 ACACACACACACACACACCATGG - Intergenic
1159686546 18:71428350-71428372 ACACACACACACACACACCATGG - Intergenic
1159686560 18:71428554-71428576 ACACACACACACACACACCATGG - Intergenic
1159870281 18:73753576-73753598 ACAAACACACACATTAACCTAGG - Intergenic
1159874622 18:73796519-73796541 ACACACACACACATCTACCTTGG - Intergenic
1159887859 18:73926643-73926665 ACACACACACACACACACCAAGG - Intergenic
1160180289 18:76628743-76628765 ACACACACACACACACACCATGG - Intergenic
1160606520 18:80054837-80054859 ATACACACACACATATACCATGG + Intronic
1161669607 19:5598627-5598649 ACAGACACACACATGAATCCTGG - Intronic
1161702414 19:5802671-5802693 ACAGACACACACATACACCCCGG - Intergenic
1161911497 19:7197951-7197973 ACACACACACACTCCCACCATGG - Intronic
1161911503 19:7197976-7197998 ACACACACACACTCCCACCATGG - Intronic
1161923498 19:7283907-7283929 ACAGAAACACACATAAAACAAGG - Intronic
1161957177 19:7502707-7502729 TCAGACTCACACAGCTACTAAGG - Intronic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1162034603 19:7932281-7932303 ACAGACGCCCACTTCTCCCAAGG + Intronic
1162553718 19:11373557-11373579 ACACACACACACACACACCATGG - Intergenic
1162554241 19:11376687-11376709 AAAAACACACACACGTACCAGGG - Exonic
1162922380 19:13911019-13911041 ACAGAAACACACATAGAGCAAGG + Intronic
1162980628 19:14237039-14237061 ACAGAGACACACAGAGACCATGG + Intergenic
1163272147 19:16260796-16260818 ACATACACACACACACACCATGG + Intergenic
1163386149 19:17001730-17001752 ACAGGCAGACACTTCTTCCATGG - Intronic
1163642071 19:18467496-18467518 ACAAACACACATCTCTATCAGGG + Intronic
1163741185 19:19013961-19013983 ATAGACAGACACATCCACTATGG - Intronic
1164422877 19:28112586-28112608 ACACACACACACACACACCATGG + Intergenic
1164503151 19:28836088-28836110 ACACACACACACCACCACCAAGG - Intergenic
1164516359 19:28939706-28939728 ACACACACACACACACACCATGG + Intergenic
1165195675 19:34101091-34101113 ACAAACACACACATCAGCCTAGG - Intergenic
1165376178 19:35443995-35444017 ACACACACACAAAAATACCATGG + Intronic
1166302000 19:41916151-41916173 ACAGACCCACACACCAACCCAGG + Intronic
1166303377 19:41924192-41924214 ACAGACACACCTATCCACCTAGG - Intronic
1166455343 19:42935918-42935940 ACACACACACACATATAAAAGGG + Intronic
1166617657 19:44265393-44265415 ACACACACACACACACACCACGG + Intronic
1166841663 19:45701122-45701144 ACACACACACACAATTACCCAGG + Intronic
1167112463 19:47470371-47470393 ACACACACACACACACACCAGGG + Intronic
1167141776 19:47656402-47656424 ACAGAAACACACATAAGCCAAGG + Intronic
1167396630 19:49233743-49233765 CCCGACACACACATCTAAAAAGG + Intergenic
1167617472 19:50543331-50543353 ACACACACACACACACACCAGGG - Intronic
1167648389 19:50717737-50717759 GCAGCCACCCACATCTACCCGGG - Intronic
1167740320 19:51320644-51320666 GCAGACACACACATCTACACAGG - Intronic
1167860025 19:52275221-52275243 ACAAACACACACATCAGCCTAGG - Intronic
1168018347 19:53591416-53591438 ACAAACACACACAAATACCTAGG - Intergenic
1168178858 19:54645865-54645887 ACACACACACACACACACCATGG + Intronic
1168216971 19:54933540-54933562 ACACACACACACACCCAGCAGGG + Intronic
1168346183 19:55651250-55651272 GGAGACACACACATGAACCAAGG - Intronic
1168387064 19:55972786-55972808 ACACACACACACACACACCATGG - Intronic
1168568816 19:57447273-57447295 ACAGACACACACATTAGTCAAGG + Intronic
924976254 2:178555-178577 ACACACACACACACACACCATGG + Intergenic
924997920 2:380976-380998 ACACACACACACACCCTCCAAGG + Intergenic
925015856 2:523674-523696 ACAGACTCACACTTCTTCCCTGG - Intergenic
925029515 2:638647-638669 ACAAACACACACATTAACCTAGG + Intergenic
925441448 2:3890066-3890088 ATATACACACACATATACCATGG - Intergenic
925496683 2:4458111-4458133 AAAGACACACACATCTCTTAAGG - Intergenic
925681899 2:6431338-6431360 ACACACACACATATATATCATGG + Intergenic
925685356 2:6466326-6466348 CCAGACTCACACATTTACAAAGG + Intergenic
925706523 2:6689295-6689317 ACACACACACACACACACCATGG - Intergenic
926199633 2:10785051-10785073 ACACACACACACATTTACAATGG + Intronic
926247741 2:11133316-11133338 ACACACACACACTTGCACCATGG + Exonic
926458760 2:13101483-13101505 ACACACACACACACACACCAAGG - Intergenic
926705149 2:15831908-15831930 ACAGAAACACACCTCAAACAAGG - Intergenic
926802380 2:16670160-16670182 ACAGAAACACACATAAAGCAAGG - Intergenic
926877560 2:17499103-17499125 ACACACACACATATATACCCTGG - Intergenic
926966446 2:18418961-18418983 ACACACACACACACACACCAAGG - Intergenic
927080324 2:19621993-19622015 ACACACACACACACACACCATGG + Intergenic
927414168 2:22859277-22859299 ACACACACACACATCGAGCAAGG + Intergenic
927979564 2:27366085-27366107 ACACACACACACAGCTACTTAGG - Intronic
928280964 2:29945964-29945986 ACAGAAACACACATAAAACAAGG + Intergenic
928498179 2:31857270-31857292 ACACACACACACACATATCAGGG + Intergenic
928608810 2:32970993-32971015 ACACACACACACAAATACCTAGG - Intronic
928711100 2:34006342-34006364 ACACACACACACACACACCATGG - Intergenic
928958190 2:36893738-36893760 ACATACACACACATTCACCCTGG + Intronic
928981870 2:37144547-37144569 ACAAACACACACATCAGCCTAGG - Intronic
929237582 2:39622974-39622996 ACACACACACACACACACCAGGG + Intergenic
929370253 2:41214687-41214709 ACACACACACACACACACCATGG - Intergenic
929419551 2:41776952-41776974 AGAGAGACACACAAATACCATGG + Intergenic
929592279 2:43155071-43155093 ACACACACACACACATACAATGG + Intergenic
929713541 2:44288528-44288550 ACAGATACAGACACCTACCAGGG - Intronic
929896865 2:45968251-45968273 ACACACACACACACACACCATGG + Intronic
930164813 2:48194529-48194551 ACACACACACCCATCTCCCAAGG - Intergenic
930276930 2:49322535-49322557 ACAGACACACACATTAGCCTAGG - Intergenic
930316790 2:49806522-49806544 ACACACACACACACACACCATGG + Intergenic
930424039 2:51190930-51190952 CCAGACACATACACCCACCAAGG - Intergenic
930450000 2:51523713-51523735 ACACACACACACACATACAAAGG - Intergenic
930984165 2:57564582-57564604 ACACACACACACCCCTATCATGG - Intergenic
931235606 2:60410349-60410371 ACAGGGACAGATATCTACCAGGG + Intergenic
931348586 2:61469580-61469602 ACAGTCAAACACAAATACCATGG + Intronic
931473663 2:62565955-62565977 ACACACACACACATTCACAATGG + Intergenic
931627063 2:64266094-64266116 ACAGAAACACACATAAAACAAGG - Intergenic
931799569 2:65745690-65745712 ACAGAAACACACATAAAGCAAGG - Intergenic
931835170 2:66091589-66091611 ACACACACACACACACACCATGG + Intergenic
931861611 2:66360539-66360561 ACACACACACACATATACCATGG - Intergenic
932289714 2:70566605-70566627 ACAGACACACACAGCTATTTGGG - Intergenic
932408710 2:71531879-71531901 ACAGAAGCACACATAAACCAAGG + Intronic
932437017 2:71707872-71707894 ACACACACACACGTCTAGGATGG - Intergenic
932499973 2:72174658-72174680 ACACACACACACATCTGCAAGGG + Intergenic
933138934 2:78769639-78769661 ACAGTCACAGAAATCTATCATGG + Intergenic
933173196 2:79147131-79147153 ACACACACACATATATACCATGG - Intergenic
933433040 2:82209351-82209373 ACACACACACACACATACCGTGG - Intergenic
933490597 2:82981818-82981840 ACACACACACACATATATAAAGG + Intergenic
933490794 2:82983840-82983862 ACAGAGACAGACATATACAAAGG - Intergenic
933554688 2:83817421-83817443 ACACACACACACACACACCATGG - Intergenic
933817236 2:86077841-86077863 ACACACACACACACACACCATGG + Exonic
933988972 2:87619917-87619939 CCAGACACCCCCATCTCCCAAGG - Intergenic
934155234 2:89193151-89193173 ACACACACACACACACACCATGG + Intergenic
935080817 2:99792039-99792061 ACAGAAACACACATACAACAAGG + Intronic
935103437 2:100018001-100018023 ACACACACACATATCAACCAAGG - Intronic
935120677 2:100180869-100180891 CCAGACACACACATACTCCAAGG + Intergenic
935381842 2:102460701-102460723 ACACACACACACACACACCATGG + Intergenic
935694361 2:105758383-105758405 ACAAAAACAAACATCTACAATGG - Intronic
935873078 2:107472543-107472565 AGAGACACATATATCTAACAAGG - Intergenic
935942435 2:108254676-108254698 ACACACACACATATCTCACATGG - Intronic
935974152 2:108560676-108560698 ACACACACACACAGCTTCGATGG + Intronic
936149299 2:110004398-110004420 ACACACACACACAAATACCAAGG - Intergenic
936195381 2:110366971-110366993 ACACACACACACAAATACCAAGG + Intergenic
936304871 2:111330909-111330931 CCAGACACCCCCATCTCCCAAGG + Intergenic
936432879 2:112480359-112480381 ACACACACACACACGTTCCAAGG + Intergenic
936598321 2:113870898-113870920 ACAGAAACACACATAAAACAAGG + Intergenic
936633330 2:114228154-114228176 ACATGCACACACATACACCAAGG - Intergenic
936763922 2:115820790-115820812 ACACACACACACATACACCATGG - Intronic
936791033 2:116152218-116152240 ACAAACAAACACATAGACCAAGG - Intergenic
936865637 2:117073615-117073637 ACACACACACACATATACAAGGG + Intergenic
936960394 2:118067426-118067448 ACAAACACACACACCAACCTAGG - Intergenic
937099976 2:119261151-119261173 ACACACACACACACACACCAGGG + Intronic
937149772 2:119678557-119678579 ACACACACACACACCCACCCCGG - Intergenic
937149775 2:119678600-119678622 ACACACACACACACATACCCTGG - Intergenic
937173645 2:119903571-119903593 ACACACACACACACCTTTCAGGG + Intronic
937181675 2:120002154-120002176 ACACACACAAACAACAACCAAGG - Intergenic
937485322 2:122309219-122309241 ACAAACACACACAGGGACCATGG + Intergenic
937700261 2:124856071-124856093 ACACACACACACACACACCATGG - Intronic
937755983 2:125539354-125539376 ACAGATACAGAAATGTACCAAGG - Intergenic
937761990 2:125615850-125615872 ACACACACACATACATACCATGG + Intergenic
937916075 2:127099341-127099363 ACACACACACACATGCACCCTGG - Intronic
938551665 2:132387828-132387850 ACACACACACACATACACAATGG - Intergenic
938604259 2:132875923-132875945 ACACACACACACATACACCCTGG - Intronic
938700096 2:133869736-133869758 ACACACACACACACACACCATGG + Intergenic
938700912 2:133878446-133878468 ACAGACAGACACATGTGACAGGG + Intergenic
938850556 2:135255282-135255304 ACACACACACACAGCCCCCAGGG + Intronic
938930986 2:136086852-136086874 ACTGACACAAGAATCTACCAGGG - Intergenic
939004330 2:136767448-136767470 ACACACACACACACTTCCCAGGG - Intronic
939333499 2:140794507-140794529 ACACACACACACATATTTCAAGG + Intronic
939461932 2:142508074-142508096 ACAGACACACACACACACAAGGG + Intergenic
939633849 2:144557569-144557591 ACACACACACACACACACCATGG - Intergenic
939786359 2:146518153-146518175 ACAGACACACACATGCACAGAGG + Intergenic
939916265 2:148047553-148047575 ACAAACACAAACATTTATCAAGG - Intronic
939944221 2:148389182-148389204 ACACACACACACACACACCACGG - Intronic
939988301 2:148853935-148853957 ACACACACACACACACACCATGG - Intergenic
940064673 2:149613985-149614007 ACACACACACACACATACAAGGG - Intergenic
940069024 2:149664191-149664213 ACAGAAACACACATAAAACAAGG + Intergenic
940196682 2:151103077-151103099 ACACAGATACACATCTGCCATGG - Intergenic
940209454 2:151241597-151241619 ACAGAAACACACACCAAACAAGG - Intergenic
940427304 2:153545129-153545151 AGAGACACAGACATCTAACTGGG - Intergenic
940451400 2:153842746-153842768 ACACACACACACACCTACACTGG + Intergenic
940460030 2:153953081-153953103 ACACACACACACATACACCCAGG + Intronic
940519549 2:154726823-154726845 ACACACACACACATACACCATGG + Intronic
940549522 2:155135411-155135433 ACACACACACACACCTATCAGGG + Intergenic
940568363 2:155398185-155398207 ACACACACACACAACTCACATGG - Intergenic
940581202 2:155583658-155583680 ACACACACACACACACACCATGG - Intergenic
940593026 2:155753186-155753208 AAACACACACACATAAACCAAGG + Intergenic
941242182 2:163053107-163053129 ACACACACACACTTTTCCCAGGG + Intergenic
941738143 2:169003315-169003337 ACACACACACACACGCACCATGG - Intronic
942276509 2:174327406-174327428 ACAAACAGACACACTTACCAGGG - Intergenic
942872492 2:180752141-180752163 GCACATACACACATCTACCCTGG - Intergenic
942923121 2:181400825-181400847 ACACACACACACAACTAGCCAGG + Intergenic
942985534 2:182136400-182136422 ACAAACACACACACATACTAAGG + Intergenic
943040925 2:182803997-182804019 ACAGAAACACACATAAAACAAGG - Intergenic
943373278 2:187043750-187043772 ACACACACACACACCTTGCATGG - Intergenic
943679932 2:190757700-190757722 ACACACACACACACCCGCCAAGG + Intergenic
943818194 2:192282999-192283021 ACACACACACACACACACCATGG - Intergenic
943818198 2:192283185-192283207 ACACACACACACACACACCATGG + Intergenic
944072724 2:195691210-195691232 ATAGATACACATATATACCATGG - Intronic
944091921 2:195921377-195921399 ACACACACACACACACACCATGG + Intronic
944102541 2:196044231-196044253 ATACACACACACATACACCATGG + Intronic
944219520 2:197288680-197288702 ACATACACACACACACACCATGG + Intronic
944400757 2:199323497-199323519 ACACACACACACATATATAAAGG + Intronic
944437860 2:199710407-199710429 ACAGAAACACACATATAACAAGG + Intergenic
944823618 2:203457673-203457695 ACATACACACACCTGTGCCAAGG - Intronic
945207830 2:207351012-207351034 ACACACACACATATGTAGCATGG + Intergenic
945371823 2:209028017-209028039 ACAGAAACACACATAAAACAAGG - Intergenic
945510957 2:210702214-210702236 ACACACACACACATAAACAAAGG - Intergenic
945536074 2:211019456-211019478 ACACACACACACCCCCACCATGG - Intergenic
945740060 2:213648608-213648630 ACACACACACACATTTACTAAGG + Intronic
945815766 2:214603366-214603388 ACACACACACACACACACCAGGG + Intergenic
946013253 2:216583550-216583572 ACACACACACATATACACCAGGG - Intergenic
946665872 2:222049451-222049473 ACAGACACAAACATCAGACATGG + Intergenic
946769322 2:223072261-223072283 ACACACACACACACACACCATGG - Intronic
947067504 2:226245306-226245328 ACAGACACACACACACACAAAGG - Intergenic
947461526 2:230308021-230308043 ACACACACACACACACACCATGG + Intronic
947788598 2:232848145-232848167 AAAGACACACACATAAAACAAGG - Intronic
947942944 2:234074767-234074789 ACAGAAACACACATAAAGCAAGG - Intronic
948188324 2:236038812-236038834 ACACACACACACACATACAAAGG - Intronic
948202172 2:236137075-236137097 ACACACACACACCACTAGCAGGG + Intergenic
948289227 2:236812666-236812688 ACAGAAACACACATAAAACAGGG - Intergenic
1168749403 20:271478-271500 ACATACACACACATCAAAAATGG + Intronic
1169083323 20:2811116-2811138 ACACACACACACACACACCATGG - Intergenic
1169212069 20:3771834-3771856 ACACACACACACAGCCAACATGG + Intergenic
1169407448 20:5334318-5334340 ACACACACACACACACACCATGG - Intergenic
1169516648 20:6323303-6323325 ACAGAAACACACATAAAACAAGG - Intergenic
1169975943 20:11328147-11328169 ACACACACACACATTTACAGGGG - Intergenic
1169991445 20:11507932-11507954 ACACACACACACACTCACCATGG + Intergenic
1170309582 20:14977652-14977674 ACAGGCACACACTTGTACAACGG - Intronic
1170435764 20:16327085-16327107 ACACACACACACACACACCATGG + Intronic
1170489011 20:16852120-16852142 ATATACACACACATATACCATGG - Intergenic
1170535397 20:17335853-17335875 ACACACACACACACACACCATGG - Intronic
1170726425 20:18931493-18931515 ACACACACACACACACACCATGG - Intergenic
1171005190 20:21457826-21457848 ACACACACACACATCTTCTTGGG - Intergenic
1171775286 20:29361288-29361310 ACAAAAACACACAGCTAACATGG + Intergenic
1172012620 20:31854739-31854761 TCAGACACACACACCCAGCAAGG - Intronic
1172134214 20:32676149-32676171 ACACACACACACAGCCACCTGGG + Intergenic
1172612811 20:36264383-36264405 ACAGACACACAACTCTAGCTAGG + Intronic
1172648802 20:36488552-36488574 ACAGAGACACACATAAAACAAGG - Intronic
1172952400 20:38730480-38730502 ACACGCACACACACTTACCAAGG - Intergenic
1173111050 20:40191055-40191077 ACAGAAACACACATCTCCTGGGG + Intergenic
1173191358 20:40878700-40878722 ACACACACACACACACACCATGG + Intergenic
1173256346 20:41396368-41396390 ACAGGCACACACAGCCAGCAGGG + Intergenic
1173387993 20:42606268-42606290 ACACACACAGGCACCTACCAAGG + Intronic
1173692294 20:44971113-44971135 ACACACACACACATATTCCTTGG + Intronic
1173780091 20:45748705-45748727 ACAGACACACACCCCAACAAAGG - Intronic
1174135732 20:48377719-48377741 ACAGAAACACACATAAAACAAGG - Intergenic
1174599321 20:51711685-51711707 TCAGACACAGACATCAACAATGG + Intronic
1174622856 20:51889774-51889796 ACATACACACACATACACAAAGG + Intergenic
1174810104 20:53638204-53638226 ACACACACACACACCTGCCATGG - Intergenic
1174857052 20:54056239-54056261 ACACACACACACACACACCATGG + Intronic
1174881867 20:54288584-54288606 ACATACACACACACACACCATGG - Intergenic
1175310223 20:58006681-58006703 ACAGACACACACAGACTCCAGGG - Intergenic
1175436492 20:58954789-58954811 ACACACACACACGCATACCATGG + Intergenic
1175509402 20:59513351-59513373 ACACACACACACACTTACAAGGG - Intergenic
1175666480 20:60864458-60864480 ACACACACACACACAGACCAAGG + Intergenic
1176868217 21:14066660-14066682 ACATACACACAAATATACTATGG + Intergenic
1176974155 21:15299877-15299899 ACACACACACACATACACAATGG + Intergenic
1176978979 21:15357327-15357349 ACACACACACACACACACCATGG + Intergenic
1176988992 21:15471670-15471692 ACACACACACACACATTCCAAGG + Intergenic
1177274106 21:18884520-18884542 ACACACACACACACACACCATGG - Intergenic
1177376331 21:20274938-20274960 ACACACACACACATACACAATGG + Intergenic
1177399717 21:20587207-20587229 ACACACACACACATATATCCAGG + Intergenic
1177399799 21:20587997-20588019 ACACACACACACACATACCCAGG + Intergenic
1177399856 21:20588387-20588409 ACACACACACACACACACCAGGG + Intergenic
1177598841 21:23284127-23284149 ACACACACACATATATACCTTGG - Intergenic
1177708620 21:24741143-24741165 ACACACACACACACACACCATGG - Intergenic
1178072163 21:28980364-28980386 ACAGAAACACACATAAAACAAGG + Intronic
1178095810 21:29214089-29214111 ACAGACACACACATATACACAGG + Intronic
1178458231 21:32776020-32776042 ACAAACACACACATCAGCCTAGG + Intergenic
1179229920 21:39492439-39492461 ACACACACACACACACACCAAGG - Intronic
1179373624 21:40829346-40829368 ACAGACACAGAAATCAACTAGGG + Intronic
1179496710 21:41776475-41776497 ACAGACACACACCTGCACTAAGG + Intergenic
1179516511 21:41912060-41912082 ACAGACACACATATCATCCAGGG - Intronic
1179576863 21:42313351-42313373 ACACACACACACCTGTTCCAAGG - Intronic
1179931909 21:44576281-44576303 ACAGACACACGGATGTCCCAGGG + Intronic
1180080404 21:45484660-45484682 ACATACACACACATGTATCTAGG + Intronic
1180127365 21:45801459-45801481 ACAGACACACTCAGGTTCCATGG + Intronic
1181286164 22:21753972-21753994 ACAGACACACCCAGCCACCCAGG - Intergenic
1181899587 22:26142160-26142182 GCAGACACACACAGCTCACAAGG + Intergenic
1182044668 22:27264891-27264913 ACAGACACATCCACCTGCCATGG + Intergenic
1182302933 22:29348563-29348585 ACAGAAACACACATTTAAAAAGG + Intronic
1182993927 22:34795479-34795501 AGACACACACACACCCACCATGG + Intergenic
1183153974 22:36060119-36060141 ACACACACACACATATATGATGG + Intergenic
1183265861 22:36824578-36824600 ACGGACACACACCTCTGTCAAGG - Intergenic
1183561367 22:38576559-38576581 AGACACACAAACATTTACCATGG + Intergenic
1184259495 22:43306542-43306564 ACGAACACACACTCCTACCAAGG + Intronic
1184436460 22:44481270-44481292 ACAGACACTCTTATCTGCCAAGG + Intergenic
1184803749 22:46778494-46778516 ACAGACACACACATTAGCCTAGG + Intronic
1184812764 22:46847910-46847932 ACACACACACACACCCACTAGGG - Intronic
1185121173 22:48972334-48972356 ACACACACACACACACACCATGG + Intergenic
1185152983 22:49177039-49177061 ACAAACACACACATGCAGCAGGG + Intergenic
1185276590 22:49952575-49952597 ACACACACACACAGACACCACGG - Intergenic
949095314 3:78734-78756 ACAGACACAGAAATCCACCCAGG + Intergenic
949615283 3:5746982-5747004 ACCAACACACACATTTACCTAGG - Intergenic
949658794 3:6253425-6253447 ACACACACACACCTATACCATGG + Intergenic
950691431 3:14661368-14661390 ACAAAGACACACAGCTACCTTGG - Intronic
950769005 3:15295988-15296010 ACAGAAACACACATATAACAAGG + Intronic
951167918 3:19505087-19505109 ACACACACACACACACACCATGG + Intronic
951642289 3:24849533-24849555 ACAGAAACACACATAAAACAAGG - Intergenic
951959921 3:28306414-28306436 ACACACACACACAAATACCTAGG - Intronic
952624381 3:35386594-35386616 ACACACACACACATAAACCAAGG + Intergenic
952714415 3:36464807-36464829 ACACACACACACACACACCATGG - Intronic
953197463 3:40747702-40747724 ACACACACACACACACACCAGGG - Intergenic
953252547 3:41259957-41259979 ACAGACACACACTTCACACAGGG + Intronic
953835638 3:46340797-46340819 ACACACACACACACACACCATGG + Intergenic
954874659 3:53793902-53793924 ACAGACACACACAGCAAACTTGG + Intronic
955120128 3:56049809-56049831 ACACACACACACATATATGATGG - Intronic
955350142 3:58187633-58187655 ACACACACACCCCTCTGCCAGGG - Intergenic
955355554 3:58228697-58228719 ATAAACACACACATACACCATGG + Intergenic
955367960 3:58327616-58327638 ACTGACACACACATCTGGCCTGG - Intergenic
955450326 3:59059193-59059215 ACACACACACACACATACCATGG - Intergenic
955936377 3:64106751-64106773 ACAGACACACACACACCCCATGG - Intronic
956005141 3:64770676-64770698 ACACACACACACACACACCAGGG - Intergenic
956156097 3:66299039-66299061 ACATACACACACACAAACCAAGG - Intronic
956376943 3:68623324-68623346 ACACACACACACACGCACCATGG - Intergenic
956805562 3:72807291-72807313 ACAGAATTACACAACTACCAGGG - Intronic
956965739 3:74457911-74457933 ACCCACACCCACATCCACCAAGG + Intronic
957186932 3:76953811-76953833 ACACACACACACATTTAAAAAGG - Intronic
957428099 3:80065947-80065969 ACACACACACACACACACCACGG - Intergenic
957691236 3:83573105-83573127 ACACACACACACACACACCATGG + Intergenic
957711639 3:83867522-83867544 ACACACACACACACACACCAGGG + Intergenic
957713495 3:83894761-83894783 ACACACATACACCCCTACCAAGG + Intergenic
957940335 3:86995621-86995643 ACACACACATACATATACAAAGG + Intergenic
957968204 3:87348538-87348560 AAAGACACATTCATCTAACATGG + Intergenic
958587038 3:96100743-96100765 ACACACACACACACACACCATGG - Intergenic
958587398 3:96107245-96107267 ACAGACACACACATTAGCCTAGG + Intergenic
958689252 3:97441412-97441434 ACAGACAAACAAAACTACAATGG + Intronic
958850275 3:99316469-99316491 ACAGACACACACATTAAACAAGG + Intergenic
958979123 3:100699698-100699720 ACACACACACACACACACCATGG + Intergenic
959394642 3:105822153-105822175 GCACACACACACATATACAATGG + Intronic
959496196 3:107055082-107055104 ACATTCACACACAACTATCAAGG + Intergenic
959560852 3:107779025-107779047 ACACACACACACATATACATTGG + Intronic
959867559 3:111288555-111288577 ACACACACACACACACACCATGG - Intergenic
960338188 3:116444341-116444363 ACACACACACACACATATCAAGG - Intronic
960460313 3:117926159-117926181 ACACACACACACACACACCATGG + Intergenic
960468098 3:118023949-118023971 ACACACACACACACACACCATGG - Intergenic
960496047 3:118376415-118376437 ACAGACACACACACCTCACATGG - Intergenic
960560984 3:119084044-119084066 ACAGACACACACATTAGCCTAGG - Intronic
960590863 3:119364108-119364130 ACAGCCAGACCCTTCTACCAGGG + Intronic
960747733 3:120908406-120908428 ACAGACACACACAGGTGCGAGGG - Intronic
961212778 3:125138876-125138898 ACACACACACACACTTAGCAGGG + Intronic
961253840 3:125529115-125529137 ACAGACACAGCCACCTACAATGG + Exonic
961599352 3:128047190-128047212 ACACACACACACACTCACCATGG + Intergenic
961775818 3:129284433-129284455 ACAGAAACACACATAAAACAAGG + Intronic
961848698 3:129793173-129793195 ACACACACACACACACACCATGG + Intronic
962144517 3:132825972-132825994 ACACACACACACACATACCATGG - Intergenic
962187429 3:133274581-133274603 ACAGAGAAACAAATCTACAAGGG - Intronic
962502906 3:136013153-136013175 ACACACACACACACACACCATGG - Intronic
962555123 3:136541568-136541590 ACACACACACACACACACCAGGG + Intronic
962748888 3:138418246-138418268 ACACACACACAGTCCTACCATGG + Intergenic
964006119 3:151831399-151831421 ACACACACACACACACACCATGG + Intergenic
964017791 3:151968592-151968614 ACACACACACACACACACCATGG + Intergenic
964133701 3:153319316-153319338 ACACACACACACACACACCAAGG + Intergenic
964284946 3:155108057-155108079 ACAGAAACACACATAAAACAAGG + Intronic
964471506 3:157061757-157061779 ACACACACACACACACACCATGG + Intergenic
964829681 3:160870101-160870123 ACCCACACACACTTCTCCCATGG - Intronic
964985294 3:162731371-162731393 ACACACACACACACATATCATGG - Intergenic
965132696 3:164722315-164722337 ACACACACACACACATGCCATGG - Intergenic
965176379 3:165339216-165339238 AAAGGCATACACATCTACCATGG - Intergenic
965187817 3:165488082-165488104 ACACACACACACATATACACGGG - Intergenic
965228071 3:166017345-166017367 ACACACACACACACAAACCATGG - Intergenic
965273592 3:166651740-166651762 ACGCACACACACATCTCCTAAGG + Intergenic
965340741 3:167488176-167488198 ACACACACACACACACACCATGG + Intronic
965406533 3:168276170-168276192 ACACACACACACGTTTTCCAGGG - Intergenic
965477257 3:169172400-169172422 ACACACACACACACATACAAGGG - Intronic
965605238 3:170491879-170491901 AAAGACCAACACACCTACCAGGG + Intronic
965869098 3:173245030-173245052 ACACACACACACACACACCATGG - Intergenic
965961769 3:174437766-174437788 ACAGACACACACACACTCCATGG - Intergenic
965979991 3:174677650-174677672 ACAGAAACACACATAAAACAAGG - Intronic
966048573 3:175585193-175585215 ACAGACACACACACTAACCGAGG + Intronic
966220654 3:177547855-177547877 ACACACACACACAAAGACCATGG - Intergenic
966332426 3:178828916-178828938 ACACACACACACAGTGACCATGG - Intronic
966349389 3:179014701-179014723 ACACACACACACATACCCCAAGG + Intergenic
966394166 3:179484872-179484894 ACAGAAACACACATTAAACAAGG + Intergenic
966607403 3:181834915-181834937 ACACACACACACATATATCAAGG - Intergenic
966812801 3:183863138-183863160 ACAGATACAGACAGGTACCAAGG + Intronic
966862509 3:184238482-184238504 ACAGCCACACACATACACCTGGG - Intronic
967173397 3:186841891-186841913 ACACACACACACACATACCAAGG + Intergenic
967240778 3:187437341-187437363 ACAGACACACACATATCTGAAGG + Intergenic
967690180 3:192464495-192464517 ACACACACACACACACACCATGG - Intronic
967769249 3:193315859-193315881 ACACACACACACATAAAACAGGG - Intronic
968245912 3:197147454-197147476 ACACACACACACACACACCATGG + Intronic
968488387 4:876306-876328 ACAGACACACACACCAACGGGGG + Intronic
968675974 4:1879815-1879837 ACACACACACACAAGTGCCATGG - Intronic
968776899 4:2547581-2547603 ACACACACACACACATACTAAGG - Intronic
969210539 4:5683838-5683860 ACACACACACACAGCTGCCCAGG + Intronic
969318904 4:6398925-6398947 ATTGACACACACAGCAACCAGGG + Intronic
969546612 4:7834119-7834141 ACACACACACATATATACAATGG + Intronic
970064472 4:12076129-12076151 ACACACACACACATTTAGCACGG - Intergenic
970153299 4:13114397-13114419 ACACACACACACACACACCATGG + Intergenic
970296250 4:14633879-14633901 ACACACACACACGTCACCCAGGG - Intergenic
970890360 4:21036963-21036985 ACAAACACACACATTAGCCAAGG - Intronic
971027801 4:22605838-22605860 ATAGACACAAACATACACCATGG - Intergenic
971036450 4:22698208-22698230 TCAGCCATACACAACTACCAAGG + Intergenic
971163865 4:24161996-24162018 ACACACACACACACACACCATGG + Intergenic
971235766 4:24840844-24840866 ACAGAGACACACATAAAACAAGG + Intronic
971238015 4:24861267-24861289 ACACACACACACACACACCATGG + Intronic
971439732 4:26669009-26669031 ACACACACACACATTTACTATGG + Intronic
971576991 4:28287096-28287118 ACAGACTAACACATGTGCCATGG + Intergenic
971615885 4:28790126-28790148 ACACACACACACAAATATCAAGG + Intergenic
971814591 4:31470832-31470854 ACACACACACACACCCACAATGG + Intergenic
971918522 4:32907012-32907034 ATATGCACACACATGTACCATGG - Intergenic
972064409 4:34922594-34922616 ACAGAAACACACATAAAACAAGG + Intergenic
972154351 4:36140164-36140186 ACACACACACACATCTTAGAGGG + Intronic
972208390 4:36805673-36805695 AAAAACAAACACATATACCAGGG + Intergenic
972671281 4:41215503-41215525 ACACACACACAGTCCTACCAAGG + Intronic
972860788 4:43167306-43167328 ATACACACACACACATACCATGG - Intergenic
972977191 4:44650521-44650543 ACACACACACACTTGTACCAAGG + Intronic
973203163 4:47528454-47528476 ACACACACACACACACACCATGG - Intronic
973743952 4:53945573-53945595 ACACACACACACACACACCATGG - Intronic
973750414 4:54012957-54012979 ACACACGCACACATCTATGATGG + Intronic
973791267 4:54380298-54380320 ACAGAGACACACATGTAAAAGGG - Intergenic
974533134 4:63137926-63137948 ACACACACACACATATACAGAGG - Intergenic
974656776 4:64834965-64834987 ACACACACACACATACACCGTGG + Intergenic
974737931 4:65963471-65963493 ACACACACACACACACACCATGG - Intergenic
974790239 4:66679559-66679581 ACATACACACACACATATCATGG + Intergenic
974889084 4:67857335-67857357 ACACACACACACATACACAATGG + Intronic
975053106 4:69891247-69891269 ACACACACACACACACACCATGG - Intergenic
975053122 4:69891596-69891618 ACACACACACACACACACCATGG + Intergenic
975211710 4:71708233-71708255 AGAGACAGACACATCAATCAAGG - Intergenic
975315653 4:72950017-72950039 ACACACACACACACACACCATGG - Intergenic
975878829 4:78877440-78877462 ACAAACACACACATCAGCCCGGG + Intronic
976013660 4:80523483-80523505 ACAGACACACCCAGTTACCTAGG - Intronic
976252055 4:83062798-83062820 ACAGAAACACACATAAAACAAGG + Intronic
976455501 4:85242203-85242225 ACAGACACACACACACACAATGG - Intergenic
976528255 4:86118604-86118626 ACACACACACACATCTCTGAAGG + Intronic
976867444 4:89747254-89747276 ACACACACACACACCCCCCAAGG + Intronic
977172900 4:93784658-93784680 ACACACACACACACACACCACGG + Intergenic
977766324 4:100802481-100802503 ACAAACACACACATACACAAAGG + Intronic
977805177 4:101288850-101288872 ACACACACACACATATACACAGG + Intronic
977857777 4:101914654-101914676 ACAGAAACACACATAAAGCAAGG - Intronic
977904758 4:102464291-102464313 ACACACACACACACACACCATGG + Intergenic
978037219 4:104010034-104010056 ACACACACACACACACACCAGGG + Intergenic
978142452 4:105333111-105333133 ACACACACACATATATACAATGG + Intergenic
978287499 4:107095724-107095746 ACACACACACACACCCACAAAGG + Intronic
978323981 4:107530404-107530426 ACACACACACACACACACCATGG + Intergenic
978324817 4:107540795-107540817 ACATACATACACATTCACCAAGG - Intergenic
978345709 4:107766443-107766465 CCAGACACACACACATCCCAGGG + Intergenic
978771797 4:112465084-112465106 ACACACACACACATATAAAAGGG + Intergenic
978988486 4:115046610-115046632 ACACACACACACATCACACAGGG - Intronic
979043115 4:115825112-115825134 ACACACACACACACACACCATGG - Intergenic
979083215 4:116370047-116370069 ACACACACACACATGCACAATGG - Intergenic
979098999 4:116591166-116591188 ACACACACACACACACACCATGG - Intergenic
979570354 4:122216042-122216064 ACACACACATATATATACCATGG - Intronic
979590521 4:122474214-122474236 ACACACACACACATGCACAATGG - Intergenic
979663809 4:123288852-123288874 TCAGACACTCTCATCTAACAGGG + Intronic
979852054 4:125584267-125584289 ACACACACACACATATACATAGG + Intergenic
979887530 4:126048051-126048073 ACACACACACACACACACCACGG + Intergenic
980116371 4:128683314-128683336 ATACACACACACATTTTCCAAGG - Intergenic
980138728 4:128889360-128889382 ACAGAGACACACATGTACAAAGG + Intronic
980435150 4:132763200-132763222 ACAGAAACCCACAAATACCAGGG + Intergenic
980544271 4:134237684-134237706 ACACACACACACACACACCACGG - Intergenic
980710150 4:136555623-136555645 ACAAATTCACACATCCACCAAGG - Intergenic
980845257 4:138316467-138316489 ACACACACACACACACACCATGG - Intergenic
980863603 4:138528560-138528582 ACATACACATACTTCAACCAAGG + Intergenic
981186105 4:141805573-141805595 ACAAACACACACATTTGCCTAGG - Intergenic
981224518 4:142277691-142277713 ACACACACACACACACACCATGG + Intronic
981502267 4:145464690-145464712 ACAGACACACACATTAACCTAGG + Intergenic
981622708 4:146722073-146722095 ACACACACACACAATTACCTAGG + Intronic
982046110 4:151447775-151447797 ACAGACACAGACAGGTACAAAGG + Intronic
982081072 4:151790879-151790901 TCAGACACCTACATCTACCCTGG + Intergenic
982526076 4:156480598-156480620 ACACACACACACACCCACAAAGG + Intergenic
982950965 4:161695414-161695436 ACACACACACACGTACACCATGG - Intronic
982983512 4:162172428-162172450 ACACACACACACATATATGACGG - Intergenic
983462337 4:168042949-168042971 ACACACACACAAATACACCATGG + Intergenic
983474849 4:168201400-168201422 ACAAACACACACATCAGCCTAGG + Intergenic
983887426 4:172996172-172996194 ACACACACACACACACACCATGG + Intronic
983909330 4:173219329-173219351 ACACACACACACACACACCATGG - Intronic
984325363 4:178243209-178243231 ACACACACACACACACACCATGG - Intergenic
984341632 4:178464784-178464806 ACACACACACACATATCCTATGG - Intergenic
985188224 4:187341706-187341728 ACACACACACACACACACCATGG + Intergenic
985325925 4:188770163-188770185 ACATACACACACACATTCCATGG - Intergenic
985868125 5:2532385-2532407 ACAAACACACACATGCCCCATGG + Intergenic
986225800 5:5811055-5811077 ACACACACACACAGTTACTATGG - Intergenic
986241485 5:5964120-5964142 ACAGTGACAGAAATCTACCATGG + Intergenic
986406984 5:7436139-7436161 ACAGACGCACACATAAAACAAGG + Intronic
986505891 5:8450798-8450820 ACAGACACACATGTATACCAAGG + Intergenic
986596248 5:9425379-9425401 ACACACACACACAAATACCTGGG + Intronic
986619118 5:9652345-9652367 ACAGAGACACACATAATCCAAGG - Intronic
986722653 5:10570977-10570999 ACACAAACACACTTATACCAAGG - Intronic
986898375 5:12399859-12399881 ACATACACACACACACACCATGG + Intergenic
987337853 5:16912832-16912854 ACACACACACACACACACCATGG + Intronic
987453750 5:18118696-18118718 ACAAACACACACATATACATAGG + Intergenic
987477101 5:18403922-18403944 ACACACACACACACACACCATGG - Intergenic
987852189 5:23370213-23370235 ACACACACACACAACTATGAGGG - Intergenic
988235980 5:28545308-28545330 ACATACACACACACATACTATGG + Intergenic
988703971 5:33705262-33705284 ACACACACACACACACACCATGG - Intronic
989578515 5:43010698-43010720 ACACACAGACACATCCACCTGGG + Intergenic
989659310 5:43781823-43781845 ACACACACACACACACACCATGG + Intergenic
990542657 5:56790035-56790057 ACACACACACACACACACCATGG + Intergenic
990694062 5:58395578-58395600 AAAGACGCACACTTCTCCCATGG - Intergenic
990778267 5:59328636-59328658 ACAAAGCCACACATGTACCAAGG - Intronic
990813138 5:59751570-59751592 ACACACACACACACACACCAGGG - Intronic
990831125 5:59959120-59959142 ACACACACACACAAATACCTAGG + Intronic
991469363 5:66951591-66951613 ACACACACACACACATATCATGG - Intronic
992402791 5:76426897-76426919 ACACACACACACACCCTCCATGG - Intronic
992599383 5:78382772-78382794 ACACACACACACACACACCATGG - Intronic
992630268 5:78673172-78673194 ACACACACACACACACACCATGG - Intronic
992956927 5:81919512-81919534 ACACACACACACACACACCATGG - Intergenic
993058387 5:83009370-83009392 ACACACACACACATATATAAAGG + Intergenic
993553809 5:89309899-89309921 ACAAACACACACATATCACATGG - Intergenic
993607163 5:90005994-90006016 ACACACACACACACACACCATGG + Intergenic
994018802 5:95000524-95000546 ACAAACACACACATTAGCCAAGG - Intronic
994220398 5:97188517-97188539 ACATACATACACATAGACCATGG - Intergenic
994765069 5:103905197-103905219 ACACACACACACACACACCATGG + Intergenic
994823671 5:104684820-104684842 ACACACACACACACACACCATGG + Intergenic
994983583 5:106906440-106906462 ACACACACACACATACACTAGGG + Intergenic
994995021 5:107049885-107049907 ACAGACTAATACATCCACCAAGG + Intergenic
995041149 5:107589478-107589500 ACACACACACACACCAACAAAGG + Intronic
995254891 5:110034993-110035015 ACAGACACAGACATCACTCAAGG + Intergenic
995375333 5:111467954-111467976 ACACACACACACACACACCATGG + Intronic
995406147 5:111798730-111798752 ACACACACACACACACACCATGG - Intronic
995588023 5:113669673-113669695 ACACACACACACACGCACCATGG + Intergenic
995809034 5:116084760-116084782 ACAGACACACACCCCTATCCAGG + Intergenic
995895240 5:117003675-117003697 ACACACACACACACACACCATGG - Intergenic
995915928 5:117244754-117244776 ACAGAAACACACATAAAACAAGG + Intergenic
995983669 5:118141096-118141118 ACAGAGACACACATACATCAAGG - Intergenic
996105918 5:119503067-119503089 ACACACACACACAATTTCCAAGG - Intronic
996171550 5:120298697-120298719 ACAGAAACACACATAAAACAAGG + Intergenic
996629561 5:125611476-125611498 ACACACACACACAGTTACTAAGG - Intergenic
996668085 5:126084103-126084125 ACACACACACACACACACCATGG + Intergenic
996856190 5:128010051-128010073 ACACACACACACATCTAATGGGG - Intergenic
997003584 5:129791891-129791913 ACACACACACACACACACCATGG - Intergenic
997174714 5:131763315-131763337 ACACACACACACGACTACAATGG + Intronic
997533441 5:134597086-134597108 ACACACACACACACAAACCAGGG + Intergenic
997593934 5:135093678-135093700 ACACACACACACAAACACCATGG - Intronic
997780205 5:136649948-136649970 ACACACACACACACACACCATGG - Intergenic
997885514 5:137626397-137626419 ACATTCACACACAACTCCCAGGG + Intronic
998259195 5:140615586-140615608 AAAGACAGACACATAGACCAAGG + Intergenic
998492742 5:142561164-142561186 ACAAACCCAAACTTCTACCAGGG - Intergenic
998578014 5:143338519-143338541 ACAAACACACACATTAACCTAGG - Intronic
999067506 5:148705624-148705646 ACATACACACACACACACCATGG + Intergenic
999111814 5:149128062-149128084 ACAGACACATACATGTAACTGGG - Intergenic
999253875 5:150198803-150198825 ACACACACACACACCATCCAGGG - Intronic
999916094 5:156262894-156262916 ACACACACACACACACACCATGG - Intronic
999927053 5:156390393-156390415 ACAGACACACACATTAGCCTAGG - Intronic
1000612938 5:163395218-163395240 ACACACACACACACACACCATGG + Intergenic
1000747431 5:165051943-165051965 ACACACACACACATACACCATGG + Intergenic
1000770334 5:165345586-165345608 ACACACACACACACACACCATGG + Intergenic
1000958281 5:167568642-167568664 ACACACACACACACACACCATGG - Intronic
1000991979 5:167920545-167920567 ACACACACACACAAATAGCATGG + Intronic
1001015652 5:168138720-168138742 AAAGCCACACACATCATCCATGG + Intronic
1001018335 5:168161832-168161854 ACACACACACACATCAATAAAGG + Intronic
1001303052 5:170551609-170551631 ACACACACACACAGCTACCTTGG - Intronic
1001396223 5:171420929-171420951 ACAGACACACACACATGCCCGGG + Intronic
1001405329 5:171472705-171472727 ACAGAAACACACATACAACAAGG - Intergenic
1001452903 5:171839848-171839870 ACAGACACACACACATACAGAGG + Intergenic
1001472792 5:172026794-172026816 ACAGGCACACACCACTACCCCGG + Intergenic
1001675408 5:173508441-173508463 ACAGACACACACACATATCTTGG + Intergenic
1002417551 5:179128357-179128379 ACAGACTCACACATAAAACAAGG - Intronic
1002482312 5:179510833-179510855 ACATACACACACATATAAAACGG - Intergenic
1002595558 5:180319913-180319935 ACACACACACACATACACAAAGG + Intronic
1003415216 6:5901275-5901297 ACAAACACATACACATACCATGG + Intergenic
1003718781 6:8677006-8677028 ACACACACACACAACTAGCTGGG - Intergenic
1004152102 6:13131229-13131251 ACACACACACACACACACCATGG + Intronic
1004728229 6:18331827-18331849 ACACACACACACACACACCATGG + Intergenic
1004779145 6:18886485-18886507 ACAAACACACACATGAACCCAGG - Intergenic
1004889145 6:20081907-20081929 ACACACACACACAGACACCATGG + Intergenic
1004913562 6:20310138-20310160 ACACACACACACACACACCATGG + Intergenic
1005255236 6:23995710-23995732 ACACACACACACACACACCATGG + Intergenic
1005262260 6:24073532-24073554 ACACACACACACACATAGCATGG - Intergenic
1006068697 6:31481210-31481232 AGAGAGTCCCACATCTACCATGG - Intergenic
1006131147 6:31870254-31870276 ACTGCCACACACACCTGCCAAGG - Intronic
1006605711 6:35255637-35255659 GCAGGCACACACATTTACCAAGG + Intergenic
1006737193 6:36282652-36282674 ACATACACACAGATCAAGCAAGG - Intronic
1007269063 6:40621782-40621804 ACACACACACAAGTCTACCCTGG + Intergenic
1007315038 6:40980532-40980554 ACACACACACACAAATACCTAGG - Intergenic
1007630526 6:43270670-43270692 ACAGACACCCAATCCTACCAGGG - Intronic
1007941166 6:45782748-45782770 ACCCAGACACACATCTGCCAAGG - Intergenic
1007971694 6:46058066-46058088 ACACACACACACATACACAATGG - Intronic
1008055622 6:46942841-46942863 ACACACGCACACATCTCTCATGG - Intronic
1008129964 6:47710081-47710103 ATAGAAACACACATCAAACAAGG + Intronic
1008540126 6:52538964-52538986 ACAGAAACACACATAAAACAAGG - Intronic
1008885402 6:56427203-56427225 ACACACACATACATACACCATGG + Intergenic
1009012044 6:57854309-57854331 ACACACACACACATTTTTCAGGG - Intergenic
1009030400 6:58050390-58050412 ACACACACACACATATACATGGG - Intergenic
1009205928 6:60801560-60801582 ACACACACACACATATACATGGG - Intergenic
1009324064 6:62328414-62328436 ACACACACACACACCTTCCAAGG + Intergenic
1009444586 6:63726822-63726844 ACAGACTCACAAAGTTACCAAGG - Intronic
1009454184 6:63835353-63835375 ACACACACACACACATACAATGG + Intronic
1009712552 6:67344393-67344415 ACACACACACACACACACCATGG - Intergenic
1010160965 6:72854734-72854756 ACACACACACACACACACCATGG + Intronic
1010160966 6:72854751-72854773 ACACACACACACACAAACCATGG - Intronic
1010500772 6:76596887-76596909 ACACACACACACCCCAACCATGG + Intergenic
1010554390 6:77260971-77260993 ACACACACACACACCTACAGTGG + Intergenic
1011242902 6:85290975-85290997 ACACACACACACACACACCATGG + Intergenic
1011249145 6:85352620-85352642 ACACACACACACATCAACGTAGG + Intergenic
1011286450 6:85729555-85729577 ACACACACACACACACACCATGG - Intergenic
1011321547 6:86099294-86099316 ACACACACACACACACACCATGG - Intergenic
1011915112 6:92494387-92494409 ACACACACACACATACACAATGG + Intergenic
1012169019 6:95995283-95995305 ACACACACACACACACACCATGG + Intergenic
1012202882 6:96427505-96427527 ACACACACACACACACACCATGG - Intergenic
1012269572 6:97192110-97192132 ACAGACACACAGATGTACTGGGG - Intronic
1012547474 6:100436012-100436034 ACACACACACACCCCTCCCAAGG + Intronic
1012650359 6:101744487-101744509 ACACACACACACACACACCATGG - Intronic
1012715864 6:102668895-102668917 ACACACACACACATGCACAAAGG - Intergenic
1012729148 6:102858215-102858237 ACACATACACACACATACCATGG - Intergenic
1012934480 6:105351936-105351958 CCATTCACACACATATACCAGGG - Intronic
1013023714 6:106247629-106247651 ACAGAAACACACATAGAACAAGG - Intronic
1013148664 6:107422370-107422392 ACAGGCACTCCCATATACCATGG + Intronic
1013315150 6:108934621-108934643 ACATACACACATATATACCCTGG - Intronic
1013438033 6:110132970-110132992 ACACACACACACACACACCATGG + Intronic
1013900105 6:115145204-115145226 ACAGACAAACAAACCAACCAAGG + Intergenic
1014245827 6:119067608-119067630 ACAGAAACACACATAAAACAAGG + Intronic
1014448943 6:121561354-121561376 ACACACCTATACATCTACCATGG - Intergenic
1014578534 6:123105419-123105441 ACACACACACACAAATACCTAGG - Intergenic
1014899776 6:126948444-126948466 AGAGACACACACACCTCCCAAGG + Intergenic
1015153394 6:130063584-130063606 ACAGAAACACACATAAAACAAGG - Intronic
1015336522 6:132045442-132045464 ACACACACACACACATACCATGG + Intergenic
1015469674 6:133589903-133589925 ACACACACACACACATACCTAGG + Intergenic
1015595476 6:134862124-134862146 ACAGATACACACATAAAACAAGG - Intergenic
1015914550 6:138202912-138202934 ACACACACACATAGCTACCCAGG + Intronic
1015941233 6:138454174-138454196 ACACACGCACACATATAACAAGG - Intronic
1016180615 6:141143172-141143194 ACACACACACACACACACCATGG - Intergenic
1016186253 6:141201088-141201110 ATATACACACACATATATCATGG + Intergenic
1016496619 6:144669952-144669974 ACACACACACACACACACCATGG - Intronic
1017036772 6:150274143-150274165 ATAGCCACACACATCTCCCAGGG + Intergenic
1017399956 6:154049056-154049078 ACAGAAACACACATAAAACAAGG - Intronic
1018041627 6:159929028-159929050 ACAGACACACACATTAGCCTAGG - Intergenic
1018052327 6:160022030-160022052 ACACACACACACGTCTATCATGG + Intronic
1018306032 6:162456734-162456756 ACAGAAACACACATAAAACAAGG - Intronic
1018402482 6:163439040-163439062 ACAAACACACACATTAACCTAGG + Intronic
1018440716 6:163810143-163810165 ACACACACACACATATCTCAAGG - Intergenic
1018446036 6:163859331-163859353 ACACCCACACACATTTACCTGGG + Intergenic
1018542474 6:164897461-164897483 ACACACACACACAAATACAACGG - Intergenic
1018776183 6:167018376-167018398 ACACACACACACACATACCATGG - Intronic
1018991894 6:168680350-168680372 ACACACACACACACACACCATGG + Intergenic
1019000802 6:168749442-168749464 ACACACACACACACACACCATGG - Intergenic
1019004711 6:168786681-168786703 ACACACACACAAATCAGCCACGG - Intergenic
1019352449 7:561280-561302 ACACACACACACATCCACAGAGG + Intronic
1019553774 7:1618398-1618420 ACACACACATACATCTACACAGG - Intergenic
1019611474 7:1939011-1939033 ACACACACACACATGGGCCAGGG + Intronic
1020112563 7:5455776-5455798 ACACACACACACCACTTCCATGG + Intronic
1020992146 7:15212276-15212298 ACACACACACACAAATAGCATGG + Intronic
1021198909 7:17704870-17704892 ACACACACACACACGTACAATGG + Intergenic
1021323879 7:19243046-19243068 AAATACACACACATCTACATAGG - Intergenic
1021354591 7:19638442-19638464 ACAAACACACACATTAACCTAGG + Intergenic
1021357508 7:19670123-19670145 ACAGAAACAAACATATAACAAGG + Intergenic
1021469578 7:20985970-20985992 ACAGAAACACACATAAAACAAGG - Intergenic
1022114878 7:27252573-27252595 ACACACACACACCTCTACGCGGG - Intergenic
1022564760 7:31386620-31386642 ACATACACACACACACACCATGG - Intergenic
1022684800 7:32586598-32586620 ACACACACACACCTTCACCAGGG - Exonic
1023537447 7:41228380-41228402 ACACACACACACACACACCATGG - Intergenic
1023657165 7:42435142-42435164 ACACACACACACACACACCATGG - Intergenic
1023965721 7:44962257-44962279 TCAGACACCCACATCCAGCAGGG + Intergenic
1024020801 7:45366694-45366716 ACACACACACACATATACACAGG - Intergenic
1024199739 7:47094163-47094185 ACACACACACACACATAACACGG - Intergenic
1024229574 7:47354021-47354043 ACACACACACACAAATTCCAAGG + Intronic
1024351406 7:48368664-48368686 ACATACACACACACACACCATGG - Intronic
1024660795 7:51492052-51492074 AAAAACAGACACATCAACCAAGG - Intergenic
1024665110 7:51538300-51538322 ACACACACACATACATACCATGG - Intergenic
1024710461 7:52009632-52009654 ACACACACACACACACACCATGG - Intergenic
1024784016 7:52885818-52885840 ACAGAGACACACATGAAGCAAGG + Intergenic
1024923447 7:54586647-54586669 ACAAACACACACATTAGCCAAGG + Intergenic
1024954866 7:54906834-54906856 ACAGAAACACACATCAAACAGGG - Intergenic
1026199722 7:68204072-68204094 ACAGACACACACCATTTCCAAGG - Intergenic
1026214831 7:68339218-68339240 ACACACACTCACACTTACCATGG + Intergenic
1026340061 7:69427314-69427336 ACACACACACACATTTACAAGGG - Intergenic
1026501915 7:70950108-70950130 ACACACACACACACACACCATGG + Intergenic
1026542549 7:71293053-71293075 ACACACACACACATACACAATGG - Intronic
1026678520 7:72448080-72448102 CCACACACACACACCTACCCAGG + Intergenic
1026789956 7:73325003-73325025 ACACACACACATATCTTCAAGGG - Intronic
1027409366 7:77898669-77898691 ACAGAAACACACATAAAACAAGG - Intronic
1027676679 7:81167820-81167842 ACACACACACACATATATAATGG + Intergenic
1028218265 7:88162116-88162138 ACACACACACACACACACCATGG + Intronic
1028259603 7:88645697-88645719 ACAGACACAGACATGCACAAGGG + Intergenic
1028522541 7:91747724-91747746 ACACACACACACATAACCCAGGG + Intronic
1028899234 7:96077230-96077252 ACACACACACACAAATACTAGGG - Intronic
1028996220 7:97103225-97103247 ACACACACACACACACACCATGG + Intergenic
1030512467 7:110500581-110500603 ACACACACACACACTTACAATGG - Intergenic
1030702275 7:112654368-112654390 ACACACACACACACTTACAAAGG + Intergenic
1030721213 7:112872969-112872991 ACACACACACACAAATACCTAGG + Intronic
1030767160 7:113424503-113424525 ACAGAAACACACATAAAACAAGG + Intergenic
1031509513 7:122632049-122632071 ACATACACACATATATACCATGG - Intronic
1031875733 7:127138685-127138707 ACACATACACACATATGCCAAGG + Intronic
1031912163 7:127529280-127529302 ACACACACACACAAATACCTAGG + Intergenic
1032566071 7:132946163-132946185 ACACACACACACATATATAAAGG - Intronic
1032978031 7:137248301-137248323 ACACACACACACACATTCCATGG - Intronic
1033312129 7:140269120-140269142 ACAGACTAATACATCCACCAAGG + Intergenic
1033348114 7:140541073-140541095 AGAGACAAACACATCTCCAAAGG - Intronic
1033668086 7:143462552-143462574 ACAGAGACAGAAATCTAGCATGG - Intergenic
1033785437 7:144724680-144724702 ACACACACACACATCTTACTAGG - Intronic
1033880943 7:145883079-145883101 ACACACACACACATACACAAAGG - Intergenic
1033967303 7:146992051-146992073 ATATACACACACATCTCCCTTGG + Intronic
1034000569 7:147408172-147408194 ACACACACACACATACCCCATGG + Intronic
1034012734 7:147547639-147547661 ACACACACACACAACAACAACGG + Intronic
1034037508 7:147839948-147839970 ACACACACATATATATACCATGG + Intronic
1034106231 7:148492805-148492827 ACAGAAACACACATAAAACAAGG - Intergenic
1034384157 7:150724665-150724687 ACACACACACACACACACCAAGG + Intronic
1034657046 7:152737911-152737933 ACAGACACACACATTCACCTGGG + Intergenic
1034906522 7:154952636-154952658 ACAGAAACACACATAAAACAAGG + Intronic
1034930303 7:155156128-155156150 ACTCACACACACATCTCCCTTGG + Intergenic
1034990429 7:155544568-155544590 ACAGGCACTCACATCTTCCCTGG + Intergenic
1035028157 7:155840323-155840345 ACACACACACACACCTAGCAAGG + Intergenic
1035093788 7:156335388-156335410 ACAGAAACACACACCAAACATGG - Intergenic
1035675684 8:1454165-1454187 ACATACACACACATCCACAGAGG - Intergenic
1035909337 8:3548684-3548706 ACACACACACACACACACCATGG + Intronic
1036211288 8:6843193-6843215 ACTGACACACACATGCACCAAGG + Intergenic
1037155091 8:15689817-15689839 ACACACACACACACACACCATGG - Intronic
1037307847 8:17524440-17524462 ACACACACACACACACACCATGG + Intronic
1038143036 8:24866990-24867012 ACAGAAACACACATAAAACAAGG + Intergenic
1038182132 8:25239381-25239403 CCAAACACAAACACCTACCAAGG - Intronic
1038278848 8:26144330-26144352 ACAGAAACACACATAAAGCAAGG - Intergenic
1038370347 8:26982741-26982763 AAAGACAGACACATAGACCAAGG + Intergenic
1038511553 8:28140917-28140939 ACAGAAACACACATAAAACAAGG + Intronic
1038677569 8:29637284-29637306 ACATACACACACACATACCATGG + Intergenic
1038984272 8:32791741-32791763 ACACAAACACACATACACCATGG + Intergenic
1039000766 8:32977438-32977460 ACACACACACACACCCACCATGG - Intergenic
1039030527 8:33304357-33304379 ACATACACACATATATACCATGG + Intergenic
1039091364 8:33833188-33833210 ACACACACACACACACACCATGG + Intergenic
1039156976 8:34571335-34571357 ACAAACACACACATTAACCTAGG - Intergenic
1039432663 8:37537365-37537387 AGAGACAAACATATCTATCAGGG + Intergenic
1039448684 8:37653310-37653332 ACAGACACACACCACTACACTGG + Intergenic
1039772300 8:40699604-40699626 ACACACACACACACACACCATGG + Intronic
1039814088 8:41076831-41076853 ACAGACACACACATTAGCCTAGG - Intergenic
1039910175 8:41820318-41820340 ACACACACACACATTTAGCTTGG - Intronic
1039950766 8:42170740-42170762 AGTGACATACACATCCACCATGG + Exonic
1040430205 8:47333064-47333086 ACAGACACACACATTAGCCTAGG + Intronic
1040434192 8:47373938-47373960 ACAGAAACACATGCCTACCAGGG - Intronic
1040525710 8:48222770-48222792 ACACACACACACACACACCATGG - Intergenic
1040552920 8:48452653-48452675 ACACACACACACACACACCATGG + Intergenic
1040665642 8:49629262-49629284 ACACACACACACATCTTTAATGG + Intergenic
1040809856 8:51440061-51440083 ACACACACACACACACACCATGG + Intronic
1040837743 8:51750229-51750251 ACAGACACACACATTATCCCAGG + Intronic
1040867504 8:52064168-52064190 ACATACACACACACACACCATGG - Intergenic
1041222728 8:55667915-55667937 ACACACACACACATACACAATGG + Intergenic
1041257073 8:55988287-55988309 ACACACACACACACACACCAGGG - Intronic
1041288955 8:56290172-56290194 ACAGAAACACACATAAAACAAGG + Intergenic
1041610336 8:59839109-59839131 ACACACACACACAACTACAAGGG + Intergenic
1041618047 8:59931411-59931433 TCAGACACCCACAACTGCCATGG - Intergenic
1041697898 8:60756717-60756739 ACACACACACACATTTAAAATGG + Intronic
1041896705 8:62933012-62933034 ACACACACACACACACACCAGGG + Intronic
1042188416 8:66160352-66160374 ACACACACACACACACACCATGG - Intronic
1042209498 8:66365624-66365646 ACAGAAACACACATAAAACAAGG + Intergenic
1042296241 8:67221423-67221445 ATAGACACACACATTAACCTAGG - Intronic
1042567567 8:70128065-70128087 ACAGAAACACACATAAAACAAGG + Intronic
1042674360 8:71303263-71303285 ATAAACACACACATATATCATGG - Intronic
1042799076 8:72698274-72698296 ACACACACACACAAATACCTAGG + Intronic
1042847105 8:73179287-73179309 ACACACACACACCCCTACCTGGG - Intergenic
1043074736 8:75683764-75683786 ACACACACACACACACACCATGG - Intergenic
1043164947 8:76891928-76891950 ACACACACACACACACACCATGG + Intergenic
1043190119 8:77210042-77210064 ACAAACACACACACATACAAAGG - Intergenic
1043348937 8:79335869-79335891 ACACACACACACACATACAATGG + Intergenic
1043830664 8:84984717-84984739 ACACACACACACATACACAATGG - Intergenic
1044211809 8:89559488-89559510 ACAGAAACACACATTAAACAAGG - Intergenic
1044304299 8:90619919-90619941 ACATATACATACATATACCAAGG + Intergenic
1044424414 8:92034820-92034842 ACACACACACACACACACCATGG + Intronic
1044466665 8:92514435-92514457 ACACACACACACATATACAATGG - Intergenic
1044487515 8:92769973-92769995 ACACACACACACATATATAAAGG + Intergenic
1044748179 8:95391389-95391411 ACAGAAACACACATAAAACAAGG - Intergenic
1044953637 8:97457508-97457530 ACACACACACACACACACCATGG + Intergenic
1045008759 8:97938839-97938861 ACAGAAACACACATAAAACAAGG - Intronic
1045115463 8:98974782-98974804 ACACACACACACTTTTAACAGGG - Intergenic
1045184324 8:99821150-99821172 ACACACACACACACACACCATGG + Intronic
1045314215 8:101029156-101029178 ACAGACACAGGCTTCTCCCAGGG - Intergenic
1045403343 8:101840700-101840722 ATAGGCACACATATCTACAAAGG - Intronic
1045410985 8:101918762-101918784 ACACACACACACAGATACCTAGG + Intronic
1045947830 8:107816720-107816742 ACATACACACACATTTCCAATGG + Intergenic
1045963119 8:107992187-107992209 ACACACACACACACACACCATGG + Intronic
1046249044 8:111606152-111606174 ACACACACACACATACACAATGG - Intergenic
1046598308 8:116287443-116287465 ACACACACACACATGCACCATGG + Intergenic
1046717988 8:117587918-117587940 ACACACACACACACACACCAGGG + Intergenic
1046927910 8:119812714-119812736 ACACACACACACACACACCATGG - Intronic
1046956725 8:120069733-120069755 ACACACACACACATATATAAGGG - Intronic
1046989779 8:120439434-120439456 ACAGAAACACACATAAAACAAGG + Intronic
1047147313 8:122217683-122217705 ACACACACACACAAATACCTAGG + Intergenic
1047547928 8:125838452-125838474 AAAGACACACACTTCTGCCATGG + Intergenic
1048197835 8:132347085-132347107 ACAGACTCAGACATCTACAGGGG - Intronic
1048346413 8:133578691-133578713 ACATACATACATACCTACCATGG - Intergenic
1048394309 8:133999276-133999298 ACACACACACACATACACAATGG + Intergenic
1048415350 8:134222237-134222259 ACACACACACACACACACCATGG + Intergenic
1048821338 8:138383353-138383375 AAAAACACACATATCTAGCAGGG + Intronic
1049001753 8:139830723-139830745 ACAGACACACACCTCTAGAAGGG + Intronic
1049110711 8:140640933-140640955 ACATCCACACAAATCTCCCAAGG - Intergenic
1049167532 8:141135985-141136007 CCACACATACACATTTACCAGGG - Intronic
1049420984 8:142516549-142516571 ACACACACACACATGCACCTGGG - Intronic
1049920779 9:362152-362174 ACTGATACCCACATCTGCCAAGG - Intronic
1050789645 9:9450091-9450113 ACACACACACACACACACCATGG - Intronic
1051012611 9:12436770-12436792 ACACACACACACAAACACCATGG - Intergenic
1051012613 9:12436816-12436838 ACACACACACACACACACCATGG - Intergenic
1051026504 9:12619085-12619107 ACAGAAACACACATAAAACAAGG - Intergenic
1051058756 9:13021032-13021054 ACACACACACACATACACAATGG + Intergenic
1051249753 9:15147579-15147601 ATAGCCACACACATCTACATAGG + Intergenic
1051375689 9:16400180-16400202 ACACACACACTTTTCTACCACGG + Intergenic
1051781741 9:20696334-20696356 ACAGACACACACACACACAATGG + Intronic
1052333019 9:27289983-27290005 ACAGAAACACACATAAAACAAGG - Intronic
1052485793 9:29098485-29098507 ACATACACACACATCAATGAGGG + Intergenic
1052532878 9:29709999-29710021 ACACACACACATACATACCATGG - Intergenic
1055156764 9:73072358-73072380 ACACACACACACACACACCATGG + Intronic
1055703206 9:78969426-78969448 ACATACACACACACACACCATGG + Intergenic
1055739502 9:79370557-79370579 ACAGACACACATATATACATAGG - Intergenic
1055847018 9:80577788-80577810 ACACACACACACACACACCATGG + Intergenic
1055866879 9:80825119-80825141 ACACACACACACACACACCATGG - Intergenic
1055942184 9:81660967-81660989 ACACACACACACATTTAGCCTGG + Intronic
1056081689 9:83101813-83101835 ACAGAAACACACATAAAACAAGG - Intergenic
1056182700 9:84101339-84101361 TCAGACACAAGCATCTCCCAGGG + Intergenic
1056544151 9:87599870-87599892 ACAGAAACACACATAAAACAAGG - Intronic
1056731823 9:89172589-89172611 ACAGACACACACACACACGATGG + Intronic
1056782081 9:89558050-89558072 ATAGAAACACACATCAAACAAGG + Intergenic
1057028834 9:91757828-91757850 ACAGAAACACACATAAACCAAGG - Intronic
1057033061 9:91793171-91793193 ACAGACAAGCACATCTTCCTTGG + Intronic
1058211976 9:102180611-102180633 ACACACACACACACACACCATGG - Intergenic
1058377304 9:104338007-104338029 ACAGAAATGTACATCTACCATGG - Intergenic
1058571332 9:106348516-106348538 ACACACACACACACACACCAGGG + Intergenic
1058766038 9:108183588-108183610 AGAGACACACAGACCTACAAAGG - Intergenic
1058832171 9:108828630-108828652 ACACACACACACACACACCATGG + Intergenic
1059033190 9:110723253-110723275 ACACACACACATACATACCATGG + Intronic
1059180220 9:112204996-112205018 ACACACACACACAAATACCTAGG - Intergenic
1059735960 9:117099968-117099990 ACAGACACACACACTTTCCCTGG - Intronic
1059828739 9:118066610-118066632 ACACACACACACACACACCATGG + Intergenic
1059933642 9:119285767-119285789 CCAGATACACACCACTACCAAGG - Intronic
1060067362 9:120514378-120514400 ACACACACACCCTTCTGCCAAGG + Intronic
1060096435 9:120794497-120794519 ACACACACACACAACTAGCTGGG - Intergenic
1060197887 9:121635007-121635029 ACACACACACACATATACACAGG - Intronic
1060214389 9:121729941-121729963 ACACACCCACACACCTCCCAAGG - Intronic
1060352235 9:122868830-122868852 ACACACACACACATATAGGAGGG - Intronic
1060652632 9:125342384-125342406 ACAGACACACTCTTCTAGAAAGG - Intronic
1060738879 9:126084412-126084434 ACAGACACACACATCCTACCAGG - Intergenic
1061247448 9:129408024-129408046 ACAGACACACACACTGACCCTGG + Intergenic
1061372094 9:130203035-130203057 ACACACACACATATTTACCCTGG - Intronic
1061617319 9:131788752-131788774 ACAGATACACACATGTACAATGG + Intergenic
1062663345 9:137652230-137652252 ACAAACACACACATTAGCCAAGG - Intronic
1185457006 X:316302-316324 ACACACACACACATGCACCGTGG + Intronic
1185657219 X:1695174-1695196 ACAGGCACACACCACTACAAGGG + Intergenic
1185715701 X:2340423-2340445 ACAGACGCACACACACACCATGG - Intronic
1185807374 X:3070934-3070956 ACACACACACACACACACCATGG - Intronic
1185827129 X:3262226-3262248 ACACACACACACACACACCATGG - Intergenic
1185996964 X:4962469-4962491 ACAGACACAACCATGCACCAGGG + Intergenic
1186007168 X:5085415-5085437 ACAGGCACCCACATCCACAATGG - Intergenic
1186209796 X:7238117-7238139 ACACACACACACACACACCATGG - Intronic
1186278780 X:7969890-7969912 ACATACACACACACACACCATGG + Intergenic
1186582896 X:10840077-10840099 ACACACACACACACACACCATGG + Intergenic
1186590676 X:10926660-10926682 ACAAACACACACATATAACATGG - Intergenic
1187250073 X:17589532-17589554 ACATACACACATACATACCATGG - Intronic
1187287513 X:17919889-17919911 ACAGAAACACACATAAAACAAGG - Intergenic
1187343150 X:18439386-18439408 ACACACACACACACCTATTATGG - Intronic
1187478575 X:19634027-19634049 ACACACACACACACACACCAGGG - Intronic
1187632508 X:21190283-21190305 ACACACACACACACACACCATGG + Intergenic
1187796549 X:23010217-23010239 ATAGACACACACACTAACCATGG + Intergenic
1187974385 X:24690837-24690859 ACACACACACACACACACCATGG - Intergenic
1187984495 X:24795780-24795802 AAAGACAAACACCTCTATCATGG - Intronic
1187991864 X:24882680-24882702 ACACACACACACACACACCATGG - Intronic
1188258813 X:27998031-27998053 ACACACACACACATCTACTGTGG + Intergenic
1188500353 X:30818887-30818909 ACACACACACACACACACCATGG - Intergenic
1188576833 X:31661704-31661726 ACACACACACACATATACAAAGG - Intronic
1188676549 X:32948132-32948154 ACACACACACACACACACCAGGG + Intronic
1188799770 X:34514916-34514938 ACAAACACACACAACAAACATGG + Intergenic
1188942657 X:36260072-36260094 ACACACACACACACACACCATGG - Intronic
1189030284 X:37442521-37442543 ACATGCACCCACATATACCATGG - Intronic
1189146764 X:38663183-38663205 ACACACACACACACACACCATGG + Intronic
1189607050 X:42689924-42689946 ACACACACACACACACACCATGG - Intergenic
1189694220 X:43647142-43647164 TCAGACTCACAAAACTACCATGG - Intergenic
1190062569 X:47220534-47220556 ACAAACACACTGTTCTACCATGG - Intronic
1190216992 X:48486358-48486380 ACACACACACACAATTACAATGG - Intronic
1190357161 X:49616725-49616747 ACACACACACACACACACCATGG + Intergenic
1190457630 X:50641296-50641318 ACAGATACACACATCTAAAGTGG - Intronic
1190896885 X:54628208-54628230 ACACACACACACACACACCACGG - Intergenic
1192278476 X:69658203-69658225 ACACACACACACAAATACCTAGG - Intronic
1192296631 X:69856250-69856272 ACACACACACACACACACCATGG - Intronic
1192671624 X:73149844-73149866 ACACACACACACACACACCATGG - Intergenic
1192847017 X:74916741-74916763 ACAGACTAAGACATTTACCAAGG + Intronic
1192954538 X:76054801-76054823 ACACACACACACATATTCTATGG + Intergenic
1193095014 X:77538249-77538271 ACACACACACACACACACCATGG + Intronic
1193236978 X:79119124-79119146 ACACACACACACAAATACCTAGG - Intergenic
1193237953 X:79131676-79131698 ACAGACACTCAAATCTAACAAGG + Intergenic
1193303494 X:79921391-79921413 ACACACACACACACACACCATGG - Intergenic
1193375051 X:80749884-80749906 AGAAACAGACACATCAACCAAGG + Intronic
1193595981 X:83445800-83445822 ACACACACACACACACACCAAGG - Intergenic
1193604682 X:83551523-83551545 ACACACACACACACCTCCTATGG + Intergenic
1193611590 X:83638235-83638257 ACAGACACACACATGAACCTAGG + Intergenic
1193636823 X:83961240-83961262 ACACACACACACACACACCATGG + Intergenic
1193772298 X:85602592-85602614 ACACACACACATAAATACCATGG + Intergenic
1193814580 X:86089755-86089777 ACACACACACACAGACACCATGG + Intergenic
1194466595 X:94241513-94241535 ACACACACACAAAATTACCATGG + Intergenic
1194505196 X:94725791-94725813 ATACACACACACACCCACCATGG + Intergenic
1194535184 X:95097158-95097180 ACACACACACACACACACCATGG + Intergenic
1194547064 X:95249876-95249898 ACACACACACACATATTCAAAGG + Intergenic
1194634226 X:96324014-96324036 ATATACACACACACATACCATGG + Intergenic
1194759389 X:97776390-97776412 ACACACACACACATCACACAGGG - Intergenic
1194855995 X:98929929-98929951 ACAGACACACAAAACTACCTAGG + Intergenic
1194967805 X:100309164-100309186 ACACACACACACACACACCATGG + Intronic
1195464780 X:105168406-105168428 ACACACACACACACCTCCTATGG - Intronic
1195617771 X:106926711-106926733 ACACACACACACAACTAGCCAGG + Intronic
1195617783 X:106926815-106926837 ACACACACACACAACTAGCCAGG + Intronic
1195727920 X:107936400-107936422 ACACGCACACACATCCCCCACGG - Intergenic
1195749325 X:108148534-108148556 ACACACACACACACCACCCATGG + Intronic
1195943296 X:110182641-110182663 ACAGCCACTCACATCAACCCAGG - Intronic
1195965441 X:110426010-110426032 ACACACACACACATCCTGCATGG + Intronic
1196537991 X:116869892-116869914 TCATACACACACATCTATAAAGG + Intergenic
1196599303 X:117584000-117584022 ACACACACACACACACACCATGG - Intergenic
1196643039 X:118085792-118085814 ACACACACACACACACACCATGG - Intronic
1196659170 X:118252169-118252191 ACACACACACACACACACCAAGG + Intergenic
1196971008 X:121108623-121108645 ACACACACACACGTACACCATGG - Intergenic
1197339387 X:125247161-125247183 ACACACACACACACGCACCACGG + Intergenic
1197365537 X:125561540-125561562 AAAGACCCACACTTCTTCCACGG + Intergenic
1197495744 X:127177014-127177036 ACACACACACACATATAAAATGG - Intergenic
1198452150 X:136777770-136777792 ACACACACACACACACACCATGG + Intronic
1198485417 X:137082435-137082457 ACAGGCACAGGCATCTCCCATGG - Intergenic
1198796683 X:140404094-140404116 ACACACACACAAATACACCATGG - Intergenic
1198848141 X:140935577-140935599 ACACACACACACACATCCCACGG - Intergenic
1200088293 X:153622246-153622268 ACAAAAACACACATCTATAAAGG + Intergenic
1200365126 X:155654682-155654704 ACACACACACACACACACCATGG - Intronic
1201912647 Y:19148707-19148729 ACAGACACACACCTAAAACAAGG - Intergenic
1202111752 Y:21427959-21427981 ACAAACACACACATTGTCCATGG + Intergenic
1202334044 Y:23787622-23787644 ACTGACACATACCTCTCCCAAGG + Intergenic
1202536724 Y:25882437-25882459 ACTGACACATACCTCTCCCAAGG - Intergenic