ID: 1086141122

View in Genome Browser
Species Human (GRCh38)
Location 11:83501597-83501619
Sequence TTGACCTTGAATGAGGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086141122 Original CRISPR TTGACCTTGAATGAGGTTTC AGG (reversed) Intronic
900143041 1:1146462-1146484 TTGACCTTGAATGGGTTTTTTGG + Intergenic
901361579 1:8705499-8705521 TTGACCTAGAATGGGATCTCAGG - Intronic
902960352 1:19958895-19958917 AGGTCCTTGCATGAGGTTTCAGG - Intergenic
908081194 1:60580282-60580304 TTGACATTAAATGAGGTCACAGG - Intergenic
909113445 1:71506937-71506959 TTGACCTTCAAGGAGCTTTAGGG - Intronic
912563839 1:110570892-110570914 GTGACCTTAAATGATGTTTATGG - Intergenic
917473766 1:175350485-175350507 TAGACCTTGGATGAAATTTCAGG + Intronic
919887003 1:201941974-201941996 TTGTCCTTGTCTCAGGTTTCAGG - Intronic
920628320 1:207625989-207626011 TTGGCCTTTCATTAGGTTTCAGG + Intronic
920721707 1:208393526-208393548 TTTACCTTGATGGAGCTTTCTGG - Intergenic
922445620 1:225694607-225694629 TTGGTCTTGGAGGAGGTTTCTGG - Intergenic
924425550 1:243946789-243946811 TTGGCCTTGGATGAGGTGTCTGG - Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1066100365 10:32112328-32112350 TTGACCTCTAATGAGGTCTTAGG + Intergenic
1066284874 10:33955857-33955879 ATGAACTTGGCTGAGGTTTCTGG - Intergenic
1067730172 10:48805019-48805041 TTGTCTTTGAAGGTGGTTTCCGG + Intronic
1073642326 10:105265430-105265452 CTGATCTGGAAGGAGGTTTCAGG + Intergenic
1080779059 11:35413958-35413980 AAGACCTTGAATGATGTTTGGGG - Intronic
1081193250 11:40129977-40129999 TGTACCTGGCATGAGGTTTCTGG + Intronic
1081806523 11:45893837-45893859 TTGACCTTCCATGAGCCTTCAGG + Intronic
1086141122 11:83501597-83501619 TTGACCTTGAATGAGGTTTCAGG - Intronic
1087335775 11:96842446-96842468 TTGGCTTTAAATGAGTTTTCAGG + Intergenic
1088188247 11:107197427-107197449 TTGACCTGCCAGGAGGTTTCAGG + Intergenic
1088778643 11:113112133-113112155 TTGACCTTGAATTAGATGTAGGG + Intronic
1090484211 11:127097986-127098008 ATGAACTGGAATGAGGTTTCAGG - Intergenic
1090598113 11:128341537-128341559 GTGACATTGGATGAGGTTTCAGG - Intergenic
1090968242 11:131616929-131616951 TTGACCTTGAAATAAGTTCCAGG + Intronic
1093176632 12:15920076-15920098 TTGACATTGAACTAGGTATCTGG + Intronic
1093276021 12:17128200-17128222 GTCACATTGAATGAGGTTTCAGG - Intergenic
1094625560 12:32120638-32120660 TTGACCTTGTGTGAGGTTACTGG + Intronic
1095952849 12:47790994-47791016 TAGATGTTGAGTGAGGTTTCAGG - Intronic
1097019342 12:56008622-56008644 TTGACCTTGGATGGGGATTGGGG - Intronic
1098939773 12:76520504-76520526 TGGACCTTACATGAGGTTACAGG + Intronic
1099352233 12:81588139-81588161 TTTATCTTGAATTAGGTTTCAGG + Intronic
1100399677 12:94218130-94218152 TTGAGCATGAATGAGAGTTCAGG + Intronic
1101579385 12:106028113-106028135 TTGATCTTGGATGAGATTGCTGG - Intergenic
1102841578 12:116130397-116130419 TTTTTCTTGAATGAGGTTTTAGG - Intronic
1109591668 13:64491830-64491852 TTGACAGTGAGTGAGGTTTGAGG - Intergenic
1109645292 13:65246178-65246200 TTGAAGTTAAATGAGATTTCCGG - Intergenic
1109895837 13:68688241-68688263 TTGTCCTTGAGTGAGGATTAGGG + Intergenic
1111501533 13:89127905-89127927 TTGAACTTGAAAGAGATTTAGGG - Intergenic
1112169735 13:96958577-96958599 TTAACATTGAAAGTGGTTTCTGG + Intergenic
1117242152 14:53844896-53844918 TAGGCCTTGAATCAGATTTCTGG - Intergenic
1117425316 14:55589088-55589110 TTTACCTTGTCTGAGGTTTTGGG + Intronic
1120649121 14:87109867-87109889 TTGATTTTGAATGACATTTCAGG - Intergenic
1123117456 14:105901100-105901122 CTGACTTGGAATGGGGTTTCTGG + Intergenic
1125158655 15:36618207-36618229 ATGACCTAAAATGAGGCTTCAGG - Intronic
1125258623 15:37796823-37796845 TTGACCTTGAGGCAGGTTGCTGG + Intergenic
1126878401 15:53068748-53068770 CTGACCTTGAATGACATTGCCGG - Intergenic
1126914165 15:53447182-53447204 TTAACCTTGCATGTGGATTCAGG + Intergenic
1132002638 15:98195413-98195435 TTGGCCTGGAATAAGCTTTCTGG - Intergenic
1132071051 15:98776830-98776852 GTGACCTTGAATGGTCTTTCCGG + Intronic
1134239063 16:12491280-12491302 GTGCCCATGAATGAGGTTCCTGG + Intronic
1135547121 16:23373893-23373915 TTTTCCTGGAATGAGGTTTCTGG - Intronic
1138320985 16:56111611-56111633 TTGGCCTGGAATGAGTTTACTGG + Intergenic
1139333137 16:66209846-66209868 TTGACCGTGAATGAGGTTTTGGG + Intergenic
1140526045 16:75623718-75623740 TTGACTTTTAATGAGGCTACTGG - Intergenic
1149374132 17:56027031-56027053 GTGACCTTGGATAATGTTTCAGG - Intergenic
1149497465 17:57128610-57128632 TTGATGTTCATTGAGGTTTCTGG + Intergenic
1150706812 17:67494497-67494519 TTGCCATTGAAAGAGGTTACAGG - Intronic
1151267970 17:72971216-72971238 TTGAACTAAAATGAGATTTCTGG + Intronic
1152258583 17:79254517-79254539 GTGACCCTGACTGAGGGTTCTGG + Intronic
1154394575 18:13975303-13975325 TTGACCTTATATGAAGTATCAGG + Intergenic
1158229856 18:55242224-55242246 ATGACCTTGAATGTGTTTTAAGG - Intronic
1158416820 18:57256184-57256206 TTGACCTTGAATGGGGCACCAGG + Intergenic
1159318084 18:66806675-66806697 ATGACATTGAGTGAGGTCTCAGG + Intergenic
1162718681 19:12649059-12649081 TGGACCTTGAAGGCTGTTTCTGG - Intronic
1166598823 19:44075211-44075233 TGGACTTTGAATGGGGTTACAGG - Intronic
927700098 2:25262592-25262614 TTGGCCTTGACTGAGGGTTGAGG - Intronic
931180487 2:59895362-59895384 TTGACCTTGAAGGGAGTCTCTGG + Intergenic
933645421 2:84809274-84809296 TTGACCTTGAAGTAGGTGTTTGG - Intronic
934766485 2:96882873-96882895 ATGATGTTGACTGAGGTTTCCGG - Intronic
937343884 2:121110723-121110745 TGGAATTTGAATGAGATTTCTGG + Intergenic
939012307 2:136861102-136861124 TTTACCTTGAATGAGGATATGGG + Intronic
939322465 2:140642065-140642087 TGGACCTTCATAGAGGTTTCTGG + Intronic
943002820 2:182350660-182350682 TTGACTGTGAATGAGGAATCTGG - Intronic
946880623 2:224173790-224173812 TTGACATTGACTGAGATGTCAGG - Intergenic
948662248 2:239514832-239514854 TTGACCTTGAATGATGCCTGCGG - Intergenic
1170306541 20:14944818-14944840 TTGCTCTAGGATGAGGTTTCTGG + Intronic
1174571029 20:51501395-51501417 TTGATGGTGAATGAGGTTTTTGG - Intronic
1179711191 21:43264121-43264143 TTGTCCTTGAAGGAAGTTCCTGG - Intergenic
1182024908 22:27110601-27110623 TTGATCTTGGGTGAGGATTCTGG - Intergenic
1183078297 22:35440564-35440586 CTGTCCTTGAATGGGTTTTCTGG - Intergenic
1184940199 22:47759359-47759381 ATGACAATGAATGAGATTTCTGG - Intergenic
950069119 3:10137817-10137839 TTGACCATGAAGGAGTTTTGGGG + Intergenic
950210114 3:11116967-11116989 GTGACATTGAATGAGGTATCAGG - Intergenic
954403188 3:50330173-50330195 TGGATCTTGAATGTGGTCTCAGG - Exonic
955651948 3:61204311-61204333 TTGGCCTAGAAAGAGGTATCTGG + Intronic
966273597 3:178138645-178138667 TAGACTTTTATTGAGGTTTCAGG - Intergenic
966643643 3:182218326-182218348 TTGATTTTGAATATGGTTTCAGG + Intergenic
966927068 3:184651579-184651601 TAGGCCTTCCATGAGGTTTCTGG - Intronic
969975892 4:11101120-11101142 TTGGCCTTGAATGAGGTGGTGGG - Intergenic
971041630 4:22759467-22759489 TTGATATTGATTGAGGTTCCAGG + Intergenic
972096717 4:35356304-35356326 TTGGGCTTGCATGAGTTTTCAGG + Intergenic
979354235 4:119684131-119684153 TCTACCTTGGGTGAGGTTTCAGG + Intergenic
981196777 4:141930011-141930033 TTGACCTTAAATGATGCATCTGG - Intergenic
984475399 4:180228597-180228619 TTAACCTTTAATGATGTATCTGG + Intergenic
987497264 5:18663575-18663597 TTTACAATTAATGAGGTTTCTGG + Intergenic
992373236 5:76166780-76166802 GTGACATTGAATGAGGTTTGTGG - Intronic
992560942 5:77952269-77952291 GTTCCCTTGAATGAGGTTTCTGG + Intergenic
996482160 5:123988022-123988044 ATGCTCTTGTATGAGGTTTCTGG + Intergenic
996655010 5:125925196-125925218 TTGGCCTTCAAGGAGGTTTAGGG - Intergenic
996853040 5:127974159-127974181 AGGACCTTGAATGGGATTTCTGG - Intergenic
999674077 5:153981657-153981679 ATGACCTTGATTGTGGTTACAGG - Intergenic
1001147451 5:169197207-169197229 TAAACCCTGAATGAGGATTCTGG + Intronic
1006244475 6:32718423-32718445 CTTACCTTGAATGAGCATTCAGG - Intergenic
1006428826 6:33982760-33982782 AAGACCTTGGATGAGGTCTCTGG + Intergenic
1007933765 6:45715328-45715350 TGAACCTTGAACGTGGTTTCTGG + Intergenic
1009845915 6:69134278-69134300 TTAACCTTTACTGAGGGTTCAGG + Intronic
1011755263 6:90492410-90492432 TTGACATTGTGTGAGGTTACTGG + Intergenic
1012303541 6:97620818-97620840 TGGAATCTGAATGAGGTTTCTGG - Intergenic
1012346507 6:98194136-98194158 TGGACCTATAATGAGGTTGCTGG - Intergenic
1015709990 6:136129172-136129194 TTGGCCTAGAATGAGGTTCAAGG - Intronic
1016137838 6:140568356-140568378 TTGAACTTGAAAGATGATTCAGG - Intergenic
1016345309 6:143106686-143106708 TTGACCTTGGGTTAGGTTTGGGG + Intronic
1019057182 6:169232167-169232189 TTGTCCTTGCATGGGTTTTCGGG + Exonic
1020700193 7:11472253-11472275 TTGACCTTGAATAAGATTTGGGG - Intronic
1021586606 7:22215344-22215366 TGGACCTTAAATTAGGTTTTGGG - Intronic
1022211018 7:28209501-28209523 TTCAGGTTAAATGAGGTTTCTGG + Intergenic
1022563774 7:31376259-31376281 TTGTGATTGAATAAGGTTTCCGG + Intergenic
1023761858 7:43471675-43471697 TAGACTTGGAATGAGGTTTGAGG - Intronic
1026378734 7:69777843-69777865 TTGGCCTTTAATCAGGTTTCTGG + Intronic
1026477042 7:70745404-70745426 TTGACTTTGTATCAGGTTTCCGG + Intronic
1029649544 7:101881771-101881793 TCCACCTTCAAGGAGGTTTCTGG - Intronic
1029787436 7:102806781-102806803 ATGACCTTGAAAGAGTTTCCAGG + Intronic
1031517605 7:122720360-122720382 TTGACAATAAATAAGGTTTCAGG + Intronic
1034156668 7:148961266-148961288 CTGCCCTGGAATGAGGTTTGGGG - Intergenic
1034722077 7:153302646-153302668 TTGACCTTGAATGCAATTTAGGG + Intergenic
1035111354 7:156484816-156484838 TTGAACTGAAATGAGGTTTCTGG - Intergenic
1035415571 7:158681905-158681927 TTGATATTGAAAGAGGTTTCAGG - Intronic
1035427625 7:158791167-158791189 TTGCACTTGTGTGAGGTTTCTGG - Intronic
1037729812 8:21514932-21514954 GTCACCTTGAATGAGGTGTGAGG - Intergenic
1038426259 8:27465838-27465860 TTAACCTTGAGTGGGGTATCTGG + Intronic
1038683469 8:29693243-29693265 TTGACCCTGAAGGAGGTTTTGGG - Intergenic
1038850326 8:31269182-31269204 TGGACCTTGGATGAGTCTTCAGG - Intergenic
1042446797 8:68894136-68894158 TTGTCCTGGAATGAGTTTACTGG + Intergenic
1044908943 8:97036068-97036090 TTTACCCTGCATGAGGTTTGTGG + Intronic
1045330519 8:101152124-101152146 CTGACCTTTAAAGAGGATTCTGG + Intergenic
1047613871 8:126546893-126546915 TTGCACATGAATGAGGTTTAGGG + Intergenic
1051157589 9:14167797-14167819 TTGACCATGAATGAGGAACCTGG - Intronic
1051381038 9:16458860-16458882 TTGAGCTGAAATGTGGTTTCAGG - Intronic
1051395963 9:16621026-16621048 TTGATCTTGGGTGAGTTTTCTGG - Intronic
1051511291 9:17880923-17880945 TTGCCTTTGAATGTGGTTCCCGG + Intergenic
1056343921 9:85670880-85670902 TTGACCTTGATTGAAGTATTTGG + Intronic
1056508784 9:87283077-87283099 TTGAGCTTGAAGGAGCTTTTAGG - Intergenic
1058748602 9:108016714-108016736 CTGACTGTGAAGGAGGTTTCAGG - Intergenic
1062360747 9:136186786-136186808 TTGACCTTGAACGAGGCAGCAGG - Intergenic
1189280136 X:39815463-39815485 TTGAACTTAAATGATGATTCTGG - Intergenic
1192344754 X:70292234-70292256 TGAAACTTGAATGGGGTTTCAGG - Intronic
1197435716 X:126425680-126425702 TAGACCTTGAATGGGGTGGCGGG - Intergenic
1200923935 Y:8637741-8637763 TAGGCCTTGCATGAGCTTTCTGG - Intergenic