ID: 1086141709

View in Genome Browser
Species Human (GRCh38)
Location 11:83506739-83506761
Sequence TAGTGTCCCCAGCTTTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 9, 2: 149, 3: 154, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086141709 Original CRISPR TAGTGTCCCCAGCTTTATCA GGG Intronic
900708936 1:4098906-4098928 TAGCCGCCCCAGCTTTCTCATGG + Intergenic
905296968 1:36960490-36960512 CAGTGTCCCCTGCTTTCTCCAGG - Intronic
905341439 1:37280719-37280741 TAGTGGCCAAAGCTCTATCATGG - Intergenic
905353720 1:37366129-37366151 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
905464857 1:38145453-38145475 CAGTGTCTCCAGCTTCAGCAGGG - Intergenic
906159943 1:43640688-43640710 TAGTTTCCTCAGCTTTACAATGG + Intergenic
906867724 1:49440856-49440878 CAGTGTCCCCAGCTTCATCAGGG - Intronic
906879341 1:49573831-49573853 CAGTGTCCCCAGCTTCATCAGGG - Intronic
906930895 1:50168245-50168267 GAGTGTCCCCAGCTTCATCAGGG + Intronic
907779985 1:57558127-57558149 CAGTGTCCCCAGCTTCATCAGGG - Intronic
907928489 1:58977111-58977133 TAGTGTCCTCATCTATATAAAGG - Intergenic
908737212 1:67289448-67289470 CAGTGTCCTCAGCTTCATCAGGG - Intergenic
909172964 1:72318100-72318122 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
909242593 1:73234036-73234058 CATTTTCCCCAGCTTTATTAAGG + Intergenic
909549311 1:76879805-76879827 CAGTATCCCCAGCTTCATTAGGG + Intronic
909576551 1:77183221-77183243 CAGTGACCCCAGCTTCATCTGGG - Intronic
910561506 1:88597037-88597059 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
910587857 1:88899081-88899103 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
910639323 1:89442612-89442634 CAGTGTCTCCAGCTTCATCAGGG + Intergenic
910640156 1:89452087-89452109 TACTTTGCCCAGATTTATCAGGG - Intergenic
910789973 1:91041197-91041219 CAGTGGCCCCAGCTTCATCAGGG - Intergenic
910831515 1:91466361-91466383 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
910948063 1:92615517-92615539 CTATGTCCCCAGCTTCATCAGGG - Intronic
911109366 1:94166154-94166176 CAGTGTCCCTAGTTTCATCAGGG + Intronic
911883219 1:103267825-103267847 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
911980119 1:104557021-104557043 CAGTGTCCTCAGCTTCATCAGGG - Intergenic
911982235 1:104581962-104581984 CAATGTCCCCAGCTTCATCAGGG + Intergenic
912051019 1:105527593-105527615 CAGTGTCCCCAGCTTCAACAAGG + Intergenic
912066682 1:105753952-105753974 CAGCGTCCCCAGCTTCATCAGGG - Intergenic
912211056 1:107557317-107557339 TAGTTTCCCCAGCCCTATTAAGG - Intergenic
912252189 1:108022449-108022471 CAGCGTCCCCAGCTTCATCAGGG + Intergenic
912733678 1:112131469-112131491 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
912944184 1:114070821-114070843 CAGTGTCCCCAGCTTCATCGGGG + Intergenic
915376448 1:155400510-155400532 CAGTGTCCTCAGCTTTAAAATGG - Intronic
915668016 1:157462301-157462323 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
916017695 1:160764625-160764647 GAATATCCCCAGCTCTATCATGG + Intergenic
916407166 1:164508932-164508954 GAATATCCCCAGCTTTATTAGGG + Intergenic
917217573 1:172693553-172693575 CAGTGTCCCCAACTTCATCAGGG + Intergenic
917276216 1:173334660-173334682 TAGTGTCCCCAGCTTCATCAGGG - Intergenic
917462378 1:175243568-175243590 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
917764347 1:178200763-178200785 CAGTGTCCCCAGCTTCGTCAGGG - Intronic
918143327 1:181735835-181735857 TAGTTTTCCCATCTGTATCATGG + Intronic
918667048 1:187164070-187164092 TAGTTTGCCCAGATTTTTCATGG + Intergenic
919130029 1:193439965-193439987 CAATGTCCCCAGATTCATCAGGG - Intergenic
919230361 1:194765207-194765229 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
919241452 1:194921861-194921883 CAGTGTCCCCAGCTTTACTGGGG - Intergenic
919594908 1:199549088-199549110 TAGAGTCACCAGCTTTATTTTGG + Intergenic
920197059 1:204235686-204235708 ACATGTCCCCAGCTTCATCAGGG - Intronic
920197066 1:204235716-204235738 CAATGTCCCCAGCTTCATCAGGG - Intronic
920281398 1:204846400-204846422 TAGTTTCCCCATCTTTATGGAGG - Intronic
921188103 1:212686777-212686799 GAGTGTCCCCGGCTTCATCGGGG + Exonic
921607846 1:217176111-217176133 TTGTTTCCCCAGCTTTATTGAGG + Intergenic
921941036 1:220839967-220839989 GAGTGTTCCCTGCATTATCATGG + Intergenic
924032513 1:239900588-239900610 GGCTGTACCCAGCTTTATCAAGG - Intronic
924477919 1:244397573-244397595 CAATGTCTCCAGCTTTATCTAGG + Intergenic
924847538 1:247788179-247788201 CAGGGTCCTCAGCTTTATCAGGG + Intergenic
1063743366 10:8851496-8851518 CATTTTCCCCAGCTTTATTAAGG - Intergenic
1064518008 10:16170883-16170905 CAGCATCCCCAGCTTCATCAGGG + Intergenic
1064520030 10:16191112-16191134 TAGTGTCCCCAGCTGCGTCAGGG + Intergenic
1064784058 10:18874783-18874805 CAATGTCCCCAGCTTTTCCATGG - Intergenic
1066330244 10:34413862-34413884 TAGTGTCACAAGTTTTCTCATGG - Intronic
1067125946 10:43515499-43515521 CAGTGTCCTCAGCTTCATCAGGG + Intergenic
1067332792 10:45337567-45337589 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1067754762 10:48996701-48996723 CAATGTCCCCAGCTTCATCAGGG + Intergenic
1068225689 10:54104273-54104295 CAGTGTCCCCAGCCTTATCAGGG + Intronic
1068837596 10:61571243-61571265 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1069192666 10:65509003-65509025 CAGTATCCCCAGCTTCATCAAGG + Intergenic
1069791225 10:71022388-71022410 CACTGTCCCCAACTTCATCAGGG + Intergenic
1071267452 10:83976641-83976663 CAGTTTCCCCAGCTTCATCAGGG + Intergenic
1071378039 10:85030769-85030791 TAGTGTCCCAAGCTTCTTCAGGG - Intergenic
1071937347 10:90546679-90546701 CAGTATCTCCAGCTTTATCAGGG - Intergenic
1071943140 10:90610424-90610446 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1072209616 10:93234340-93234362 TAGTGTTCCCAGCTTCATCAGGG + Intergenic
1072360140 10:94651536-94651558 TAGTGTCCCCAGCTTCATCAGGG - Intergenic
1073854743 10:107661533-107661555 CAGTGTCTCCAGCTTCATCGGGG - Intergenic
1074056224 10:109924526-109924548 GAGTGTACCCTGCTTTTTCAAGG - Intergenic
1074236626 10:111591145-111591167 CAATGTCACCAGCTTTAGCAGGG + Intergenic
1074244587 10:111676216-111676238 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1074330501 10:112502724-112502746 AAATGTCCCCAGCTTCCTCAAGG + Intronic
1074567409 10:114593205-114593227 AAGTTCACCCAGCTTTATCAAGG - Intronic
1074949108 10:118311638-118311660 CAGTGTCTGCAGCCTTATCAGGG - Intronic
1075606513 10:123815467-123815489 CAGTGTCCCCAGCTTCATCAGGG - Intronic
1075790054 10:125077712-125077734 CGGTGCCCCCAGCTTTTTCATGG - Intronic
1076927772 10:133501882-133501904 AAGTGTCTCCAGCTTCATCAGGG + Intergenic
1077380518 11:2234863-2234885 CAATGTCCCCAGCTTCATCAAGG - Intergenic
1077400686 11:2355388-2355410 GACCGTCCCCAGCTTCATCAGGG - Intergenic
1078411332 11:11122053-11122075 TATTTTCCCCAGCTTTATTCAGG + Intergenic
1079132392 11:17754945-17754967 AACTTTCCTCAGCTTTATCAAGG - Intronic
1082204398 11:49414826-49414848 CAGTGTCCTCACCTTTATCTTGG + Intergenic
1082671345 11:56040395-56040417 CAGTGTCCCCGGTTTCATCAGGG - Intergenic
1082999271 11:59276890-59276912 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1083092661 11:60217368-60217390 CAGTGTCCCCAGCTTCATCAAGG - Intronic
1083177128 11:60957441-60957463 TAGTCTCCCCTGATTTTTCAAGG + Intergenic
1085303043 11:75469488-75469510 CAGTGTCCCCAGCTGTCTCGGGG + Intronic
1085398602 11:76220645-76220667 TAGTTTCCCCATCTTTAACATGG + Intergenic
1085685601 11:78619532-78619554 CAGTGTCCCCAGTTTCATCAGGG - Intergenic
1085747218 11:79125579-79125601 CAGAATCCCCAGCTTCATCAGGG - Intronic
1085792789 11:79510516-79510538 CAGTGTCCCCATCTTTAAAATGG - Intergenic
1086141709 11:83506739-83506761 TAGTGTCCCCAGCTTTATCAGGG + Intronic
1086833772 11:91597723-91597745 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1086961915 11:92986507-92986529 CCGTGTCCCGAGCTTCATCAGGG + Intergenic
1087495158 11:98881671-98881693 CAATGTCCCCAGCTTCATCATGG + Intergenic
1088192044 11:107237164-107237186 CTGTGTCCCCAGCTTCACCAGGG + Intergenic
1088264785 11:107978883-107978905 CAGTGTCCCCAGCTTCACCATGG - Intergenic
1088407962 11:109501336-109501358 TAGTTTCCCCAGCTTCATCAGGG + Intergenic
1088417514 11:109605848-109605870 TAGTATCTCCATCTTTATGAAGG + Intergenic
1088425201 11:109694196-109694218 TGGTGTCCCCATCTCTAGCAAGG + Intergenic
1089706305 11:120280486-120280508 CAGTTTCCCCAGCTTTATAATGG - Intronic
1089903265 11:122010905-122010927 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1090210010 11:124912434-124912456 CAGTGTCCCCAGTGTCATCAGGG + Intergenic
1090221958 11:125034255-125034277 CAGTGTCCCCAGTGTCATCAGGG + Intronic
1092656492 12:10690188-10690210 CAATGTCCCCAGCTTCATCAGGG + Intergenic
1093050003 12:14493621-14493643 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1094102183 12:26776601-26776623 CAGTGTCCCCAGCTTCATCAGGG - Intronic
1094240148 12:28213044-28213066 CAAAGTCCCCAGCTTCATCAGGG - Intronic
1095525331 12:43118261-43118283 CAATGTCCCCAGATTCATCAGGG + Intergenic
1095603726 12:44043437-44043459 CAGTGCCCCCAGCTTCATCAGGG - Intronic
1095844830 12:46733154-46733176 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1095856579 12:46866334-46866356 CAGTGTCCCCAGTTTCATCAGGG + Intergenic
1096457888 12:51802376-51802398 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1097076501 12:56398829-56398851 CAGTGTCCCCGGCTTCATCAGGG - Intergenic
1097821795 12:64135174-64135196 CAGTGCCCCCAGCTTCATCAGGG + Intronic
1097843736 12:64345447-64345469 CAGTGTCCCCAACTTCATCAGGG + Intronic
1098134993 12:67392534-67392556 AAGTGCCCCCTGCTTTATTAGGG - Intergenic
1098715695 12:73826776-73826798 CAGTGTCTCCAACTTCATCAGGG - Intergenic
1098749483 12:74276829-74276851 CAGTGTCCCCACCTTCATCAGGG - Intergenic
1098805098 12:75013409-75013431 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1099350666 12:81565044-81565066 CAGTATCTCCAGCTTTATCAGGG - Intronic
1099365585 12:81762793-81762815 CAGTGTCCCCTGCTTTATCAGGG - Intergenic
1099375295 12:81891305-81891327 CAGTGTCCCTAGCTTCATCAGGG - Intergenic
1099380014 12:81941404-81941426 CAGTGTCTCCAGCTTCATCAGGG + Intergenic
1099400118 12:82193614-82193636 CAGTGCTCCCAGCTTCATCAGGG - Intergenic
1099401462 12:82207363-82207385 CAGTGCCCCCAGCCTCATCAGGG + Intergenic
1099449991 12:82796862-82796884 CAGTTTCCCCAGCTTTAAAATGG + Intronic
1099577739 12:84402780-84402802 CAATGTCCCCAGCTTCATCATGG - Intergenic
1099722354 12:86381147-86381169 ATGTGTACCCAGCTTTATAATGG + Intronic
1099778074 12:87160001-87160023 TTGTGTCCATAGCTTTCTCAAGG - Intergenic
1099859750 12:88211271-88211293 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1099995379 12:89772271-89772293 CAATGTCCCCAGCTTCATCAGGG + Intergenic
1100049891 12:90435367-90435389 CAGTGTCCCCATCTTTATCAGGG - Intergenic
1101222309 12:102654406-102654428 TAGTGTCCCCATTTTCATCAAGG - Intergenic
1101263769 12:103063445-103063467 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1101535043 12:105608774-105608796 CAGTGTCCTCAGCTTCATCAGGG + Intergenic
1101542734 12:105679984-105680006 CAGTGTCCTCACCTTCATCAGGG - Intergenic
1102211988 12:111133893-111133915 CAGTGTGCCCAGCTTCACCAGGG + Intronic
1103035192 12:117651065-117651087 CAATGTCCCCAGCTTCATCAGGG - Intronic
1106046588 13:26147584-26147606 CAATGTCCTCAGCTTCATCAGGG + Intronic
1107424768 13:40281861-40281883 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1107490114 13:40873689-40873711 CAGTGTCCTCAGCTTCATCAGGG - Intergenic
1107983930 13:45758630-45758652 CAGCATCCCCAGCTTCATCAGGG + Intergenic
1108903898 13:55447013-55447035 CAGTGTACCCAGCTTCATCAGGG - Intergenic
1108914641 13:55591557-55591579 CAGTGTCCCCGGCTTCATCAGGG + Intergenic
1109292911 13:60497733-60497755 CAGTGTCCCCAGCTTCATCAGGG - Intronic
1109526239 13:63580195-63580217 TAGTGTCTGCAGCTTTTCCAGGG + Intergenic
1109582703 13:64363469-64363491 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1111016534 13:82388493-82388515 CAGTGTCCCCAGCTTCATAAGGG + Intergenic
1111576099 13:90155427-90155449 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1112231492 13:97592820-97592842 CAGTGTCCCCAGTTTTATCAGGG + Intergenic
1112250285 13:97772881-97772903 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1113320066 13:109224343-109224365 CAGTGTCCCCAGCTTCATCATGG + Intergenic
1114157289 14:20118948-20118970 TAGTGTCCCCAGGCCTATTAGGG - Intergenic
1114205554 14:20568437-20568459 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1114758606 14:25286391-25286413 CAGTGTCCCCAGTGTCATCAGGG + Intergenic
1116270590 14:42760201-42760223 CAGTGTCTCCAGCTTCATGAGGG + Intergenic
1116414724 14:44666646-44666668 CAGTGTCCTCAGCTTTATCAGGG - Intergenic
1116531806 14:45980866-45980888 CAGTGTCCCCAGTTTCATCAGGG + Intergenic
1117001768 14:51377493-51377515 CAGTGTCCCCAGCTTCATCATGG + Intergenic
1117216463 14:53557439-53557461 CAGTGTCCCCAGCTTCACCAGGG - Intergenic
1117597110 14:57334510-57334532 CAGTGTCCCCAGTTTCATCAGGG + Intergenic
1117633762 14:57721714-57721736 CAGTGTCCCCCACTTCATCAGGG - Intronic
1118950908 14:70435752-70435774 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1119971609 14:78977067-78977089 CAGTGTCCCCATCTGTATAAGGG - Intronic
1120082382 14:80230206-80230228 CAGCGTCCCCAGCTTCATCAGGG + Intronic
1120556352 14:85933093-85933115 CAGTGTCCCCAGCTTCATTAGGG + Intergenic
1120973302 14:90227789-90227811 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1121224064 14:92308420-92308442 ACGTGTCCCCAGCAGTATCACGG + Intergenic
1121371014 14:93358621-93358643 CAGTGTCTCCAGTTTCATCACGG - Intronic
1124530190 15:30499040-30499062 CAATGTTCCCAGCTTTACCAAGG - Intergenic
1124768469 15:32508648-32508670 CAATGTTCCCAGCTTTACCAAGG + Intergenic
1126846369 15:52764434-52764456 TAGTGTCCCCAGCTGCAAAATGG - Intronic
1126972599 15:54133904-54133926 TTCTTTCCCCAGCTTTATTAAGG + Intronic
1129207572 15:74046083-74046105 TAGTGTCCCCATCTGTAAAATGG + Exonic
1129827178 15:78641430-78641452 CAGTCTCCCCAGCTGTACCAAGG - Intronic
1132145713 15:99428241-99428263 TGGTGTCACCAGCTAGATCAGGG - Intergenic
1132306099 15:100813818-100813840 CAATGTCCTCAGCTTCATCAGGG + Intergenic
1134634149 16:15779450-15779472 TAGTTTTCCCAGCTTTAAAATGG - Intronic
1135625675 16:23992855-23992877 CAATGTCCCCAGCTTCATTAGGG - Intronic
1135995182 16:27242641-27242663 CAGTGCCCACTGCTTTATCACGG + Intronic
1138827013 16:60332979-60333001 TAGTGTCCTTAGTGTTATCATGG + Intergenic
1140597773 16:76436306-76436328 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1140988461 16:80183872-80183894 TATTTCCCCCAGCTTTATTAAGG - Intergenic
1141327973 16:83080564-83080586 TAGTGTCCTCATCTTTAAAACGG - Intronic
1141559902 16:84860680-84860702 CAGTGTCCCTAGCTTCAGCAGGG + Intronic
1142804721 17:2365344-2365366 GAGTGTCCCGAGCTTCATCCCGG + Intronic
1143067159 17:4259161-4259183 CAGTGTCCTCAGCTTTAAAAGGG - Intronic
1146237841 17:31184957-31184979 CAGAGTCCCCAGCTTCATCAGGG - Intronic
1146758472 17:35454495-35454517 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1146836135 17:36112443-36112465 CAGTGTCCCCAGCTTCATCTGGG - Intergenic
1148207533 17:45788536-45788558 CAGTGTCCCCAGCTATAAAATGG + Intronic
1149231868 17:54544386-54544408 TAGTCTCCCCAGCTCCAGCAGGG - Intergenic
1149236363 17:54594911-54594933 CAGTGTTCCCAGCTTCATCAGGG + Intergenic
1149426672 17:56561434-56561456 TAATGTCCCCATGTTCATCAAGG - Intergenic
1151037973 17:70822881-70822903 CAGTATCCCCAGCTTCATCAGGG + Intergenic
1151047631 17:70940337-70940359 TAGTGCCACCAGACTTATCATGG - Intergenic
1151775663 17:76199819-76199841 TAATGTCCTCATCTTTATTAAGG + Intronic
1152271383 17:79326922-79326944 TAGTGTCCTCATCTTTAAAATGG - Intronic
1152400639 17:80064534-80064556 CAGTGTCCCCAGCTGTGACATGG - Intronic
1153181491 18:2440103-2440125 TAGTGTGGCCAACTTCATCAAGG + Intergenic
1153218067 18:2838271-2838293 CAGTGTCCCCACCTTCATCAGGG + Intergenic
1154068115 18:11128469-11128491 CAGTGTCCTCAGCTTCATCAGGG - Intronic
1155573491 18:27220541-27220563 CAGTGTCCCCAGCTTCAATAGGG - Intergenic
1155822735 18:30398434-30398456 CAATGTCCCCAGCTCCATCAGGG + Intergenic
1156537428 18:37877860-37877882 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1156990646 18:43403370-43403392 TGGTGTCCCCGGCTTCAACAGGG + Intergenic
1156998255 18:43495048-43495070 CTGTGTCCCCAGCTTCATCACGG - Intergenic
1157341049 18:46778911-46778933 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1159287438 18:66372797-66372819 CAGTGTCCCCAGCTCCATCAGGG - Intergenic
1159479447 18:68968981-68969003 TATTTTTCCCAGCTTTATTAAGG - Intronic
1159527701 18:69614685-69614707 TAGTGTCTACAGCTGTAACACGG - Intronic
1162348265 19:10134076-10134098 TCGTGGCCCCATCTTTCTCAAGG - Intronic
1163534848 19:17871333-17871355 TAGTTTCCCCATCTGTAACAAGG - Intergenic
1163559190 19:18009004-18009026 TAGTGTCCGCTACTGTATCAAGG + Exonic
1167668355 19:50836011-50836033 CAGTGTCCCCGTCTGTATCAGGG - Intronic
1168539750 19:57200283-57200305 CAGTGTCCCCAGCTTCATCAGGG - Intronic
925499751 2:4489580-4489602 CAGTGTCCTCAGCTCCATCAGGG + Intergenic
925575845 2:5358930-5358952 CAGTATCCCCAGCTTCATGAAGG + Intergenic
926362495 2:12103063-12103085 TTTTTTCCCCAGCTTTATTAAGG + Intergenic
926447220 2:12957624-12957646 TAGAGTCCACAGATTTAGCAGGG - Intergenic
926810752 2:16753345-16753367 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
926929564 2:18023554-18023576 GAGTGTCTGCAGCTTTTTCACGG + Intronic
929821320 2:45276295-45276317 TAGGGTCCCCTTCTTTATTAAGG + Intergenic
930536950 2:52654930-52654952 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
930909801 2:56618165-56618187 CAATGTCCCCAGCTTCAACAGGG - Intergenic
931017768 2:58005782-58005804 TAATGTCCCTAGCTTCATCTGGG - Intronic
931186275 2:59954423-59954445 TAGTGTGCCCAGCTATATTCTGG - Intergenic
932870830 2:75396061-75396083 CAGTGCCCCCAGCTTCTTCAAGG + Intergenic
935425454 2:102913994-102914016 CAGCGTCCCCAGCTTCATCAGGG + Intergenic
935464778 2:103383308-103383330 CAATGTCCCCAGTTTTCTCAGGG - Intergenic
935564665 2:104592901-104592923 CAGTGTCCCTAGCTTCATCAGGG + Intergenic
936646610 2:114379104-114379126 TAATGTCACCAGCCTCATCAGGG + Intergenic
937785544 2:125890330-125890352 CAGTGCCCCCAGCTTCATCAGGG + Intergenic
937799978 2:126072078-126072100 CAGTGTCCCTAGCTTCATCAGGG - Intergenic
937852910 2:126651362-126651384 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
939068732 2:137515190-137515212 CAGAGTCTCCAGCTTCATCAGGG - Intronic
939637144 2:144595943-144595965 TACTCTCTCCAGCTTTATTATGG + Intergenic
939789027 2:146548747-146548769 CAGTGTCCCCAGTTTCATCAGGG + Intergenic
940162686 2:150730350-150730372 CATTGTGCCCAGCTTTATCTAGG + Intergenic
940472483 2:154116227-154116249 CAGCGTTCCCAGCTTCATCAGGG + Intronic
941223910 2:162820967-162820989 TAGCAGCCCCAGCTTTTTCAGGG + Intronic
941581643 2:167303997-167304019 TACTGTCCCCAGCTTCATCAAGG + Intergenic
941667597 2:168258155-168258177 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
942542686 2:177031145-177031167 TAGTGTCCCCATGTTTACCTAGG - Intergenic
943384369 2:187183524-187183546 CAGTGTCCCTAGCTTTATCAGGG + Intergenic
943395187 2:187324616-187324638 CAATGTCCCCAGCTTCATCAGGG + Intergenic
943517944 2:188909910-188909932 CAATGTCCCCAGATTCATCAGGG + Intergenic
944231958 2:197404664-197404686 TACTGTCTTCATCTTTATCAAGG - Intronic
945146328 2:206742356-206742378 CAGTGTCCCCAGCTTCATCAGGG - Intronic
946790571 2:223297083-223297105 CAGTGCCCCCAGCTTCATCAGGG - Intergenic
948340729 2:237249154-237249176 CAATGTCTCCAGCCTTATCAGGG + Intergenic
948371025 2:237489057-237489079 TAGTTTCCCCATCTGTACCATGG - Intronic
1169518418 20:6344111-6344133 TAGTGTAGCCACCTTCATCAAGG + Intergenic
1170507757 20:17046014-17046036 TATTGTCCTCAGCTTTATTAAGG + Intergenic
1170748815 20:19125316-19125338 TATTTTCTCCAGCTTTATCAAGG + Intergenic
1171280175 20:23889678-23889700 TATCGTCCCCTCCTTTATCATGG - Intergenic
1171296343 20:24020427-24020449 CAGTGTCCCCAGTGTCATCAGGG - Intergenic
1173709493 20:45141915-45141937 CAGTGTCCTCAGCTTCATCAGGG + Intergenic
1174528880 20:51195280-51195302 AAGTGTTCCCAGCTCTATGAAGG - Intergenic
1175173502 20:57095437-57095459 TAGTTTCCCCAGCTGTAAAATGG + Intergenic
1175409575 20:58757732-58757754 CAGTGTTCTCAGCTTCATCAGGG + Intergenic
1176997801 21:15577557-15577579 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1177002990 21:15636209-15636231 CAGTGTCCCCGGCTTTATCAGGG + Intergenic
1177363369 21:20103183-20103205 CAGTGTCCCTAGTTTCATCAGGG - Intergenic
1177505963 21:22017181-22017203 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1177912828 21:27053551-27053573 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1177934053 21:27319583-27319605 CAGTGGCCCCAGCTTCATCAGGG + Intergenic
1178012283 21:28302245-28302267 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1178061097 21:28853818-28853840 CAATGTCCCCAGCTTCATCAGGG + Intergenic
1178633889 21:34285824-34285846 CAGTGTCCCCAGCTTCATCAAGG - Intergenic
1178764185 21:35433608-35433630 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1179383170 21:40918439-40918461 CAGTGTCCCGAGCTTTATCAGGG - Intergenic
1182558591 22:31142103-31142125 TAGTTTCCTCATCTGTATCATGG + Intergenic
1184512737 22:44942844-44942866 GAGTTTCCCCATCTTTATGATGG + Intronic
1184657120 22:45947456-45947478 TCCTGTCCCCAGCTTTCTCCCGG - Intronic
949245515 3:1922246-1922268 CAGTGTCTCCTGCTTCATCAGGG - Intergenic
949418015 3:3833855-3833877 TAGTGTCCTCAGCTTCATCAGGG + Intronic
949445260 3:4128342-4128364 CGGTGTCCCCTGCTTCATCAGGG - Intronic
949638429 3:6009855-6009877 CAGTGTCCCTAGCTTCATGAGGG - Intergenic
950437591 3:12989824-12989846 AAGCTTCCCCATCTTTATCATGG - Intronic
951209394 3:19957881-19957903 TATTCCCCCCAGCTTTATTAAGG - Intronic
951291031 3:20872727-20872749 TAATGTCCCCAGCTTCATCAGGG - Intergenic
951384189 3:22025093-22025115 CAGTGTCCCCAGCTTCATCAGGG - Intronic
951971096 3:28444492-28444514 TAGTGTCCCCAGCTTCATCAGGG + Intronic
951978380 3:28539920-28539942 CAGGGTCCCCAGATTCATCAGGG - Intergenic
953897748 3:46815170-46815192 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
954053710 3:48004742-48004764 CAGTGTTCCCAGCTTCATCAGGG - Intronic
954511910 3:51132812-51132834 CAGTGTCCCCAGCTTCATCAGGG - Intronic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
955688076 3:61564194-61564216 TAGTCTCCCCTGCTTTACCACGG + Intronic
956509284 3:69977691-69977713 CAGTGTCCCTAGCGTCATCAGGG - Intergenic
957247887 3:77736002-77736024 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
957448850 3:80349758-80349780 TGGTGTTCCCATCTTCATCAGGG - Intergenic
957634092 3:82759463-82759485 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
957754256 3:84466699-84466721 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
957897772 3:86446080-86446102 CATTGTCCCCAGCTTCATCAGGG - Intergenic
958131049 3:89423561-89423583 TAATGACCCAAGTTTTATCATGG + Intronic
958715447 3:97774582-97774604 TGGTGTCCCCAGCTTCATCAGGG + Intronic
958789197 3:98631249-98631271 CAGTATCCCCAGCTTTATCAGGG + Intergenic
958845836 3:99262909-99262931 CAGTGTCCCCAGCTTTATCAGGG + Intergenic
959746358 3:109779912-109779934 CAGTGTCTCCAGCTCCATCAGGG + Intergenic
960151321 3:114251552-114251574 TAGTCTCTCCAGCTTCAGCAGGG - Intergenic
960349205 3:116573318-116573340 CAGTATCCCCAGCTTCATCAGGG - Intronic
960495086 3:118363432-118363454 CAGCATCCCCAGCTTCATCAGGG + Intergenic
963356018 3:144209509-144209531 CAGTCTCCCCAGCTTCATCAGGG + Intergenic
963432706 3:145230021-145230043 CAGTGTCCCCATTTTCATCAGGG + Intergenic
963629953 3:147720548-147720570 CAGTGTCCCCATCTTCATCGGGG - Intergenic
963661045 3:148129506-148129528 CAGTGTCCCCAGATTCATCATGG - Intergenic
965034892 3:163425164-163425186 CAGTGTCCTCAGCTTCATCAGGG + Intergenic
965050295 3:163638292-163638314 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
965127365 3:164648381-164648403 TGGTGTCTTCAGCTTCATCAGGG + Intergenic
965191176 3:165531217-165531239 CAGTGTCCCCAGTTTCATCAGGG + Intergenic
965207549 3:165741799-165741821 TAATGTTCCGAGCTTCATCAGGG - Intergenic
965251830 3:166352311-166352333 CAGTGCTCCCAGCTTCATCAGGG + Intergenic
965299272 3:166989482-166989504 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
966044676 3:175533581-175533603 CAGTGTCCCCAGCTTCATCAGGG + Intronic
966445321 3:179995905-179995927 CAGTGTCCCCAGCTTCATCAGGG - Intronic
966962567 3:184954600-184954622 CCGTGTCCCTAGATTTATCATGG + Intronic
967505638 3:190249851-190249873 TATTGTCCCCAGCTCCATCAGGG + Intergenic
967831409 3:193923305-193923327 CAGTGTCTCCAGCTTCATCAGGG - Intergenic
968906507 4:3454953-3454975 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
970089549 4:12389024-12389046 TAGTGTCCCTAGCTTCATCAGGG + Intergenic
971144363 4:23960925-23960947 GAGTGTTCTCAGCATTATCAAGG + Intergenic
971464251 4:26938201-26938223 AAATGTCCCCAGCTTTATTGAGG + Intronic
971685203 4:29756928-29756950 CAGTGTCCACAGCTTAATTAGGG - Intergenic
971857062 4:32057881-32057903 GAGTGTCTGCAGCTTTTTCAGGG + Intergenic
972201638 4:36719819-36719841 CAGTGTCCCCAGTTTCATCAGGG + Intergenic
972805616 4:42527365-42527387 CAGTGTCCCCAGCTTCATCAGGG - Intronic
973092651 4:46157651-46157673 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
973118085 4:46486366-46486388 CAGTGTCCCCAGCTTCATTAGGG - Intergenic
973540337 4:51928752-51928774 CAATGTTCCCAGCTTCATCAAGG + Intergenic
973655738 4:53045981-53046003 TAGTTTCCCCATCTTTAAGATGG - Intronic
974289254 4:59910095-59910117 CAGTGTCCCCAGCTTCAACAGGG - Intergenic
974726741 4:65808793-65808815 GAGTGTCTCCAGATTCATCAGGG - Intergenic
974747245 4:66091597-66091619 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
974910965 4:68119374-68119396 TAGTTTACCCACCTTTATCAGGG - Intronic
975982971 4:80179937-80179959 CAGTGTCCCCAGCTTCATCTGGG + Intergenic
976906683 4:90245369-90245391 TAGTGTCCTCAGCTGAAACAAGG + Intronic
977204288 4:94152619-94152641 TAGTGTCCCCAGCTTCATCAGGG - Intergenic
977414260 4:96711266-96711288 TAGTGTTATCAGCTTTACCATGG + Intergenic
977430408 4:96925565-96925587 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
977490433 4:97702726-97702748 CAGTGTCCCCAGCTTCATCAGGG + Intronic
977702091 4:100032554-100032576 CAGTGTCCCCAGTTTCATCAGGG + Intergenic
978899438 4:113929513-113929535 CAGTGTCCCCAGGTTTATCAGGG + Intronic
978966494 4:114748265-114748287 CAGTGTTCTCAGCTTCATCAGGG - Intergenic
979766669 4:124472128-124472150 CAGTGTCCCCAACTTCATCAGGG - Intergenic
979898796 4:126191992-126192014 TATTGTCCCCAGCCTCATTAGGG + Intergenic
980386590 4:132093157-132093179 TAGTGCCCCCGGCTTCATTAGGG + Intergenic
980497878 4:133608051-133608073 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
981834502 4:149039787-149039809 CAGTGTCCTCAACTTCATCAGGG - Intergenic
982344062 4:154336723-154336745 TTTTTTCCCCAGCTTTATTAAGG + Intronic
982521621 4:156424287-156424309 TTTTTTCCCCAGCTTTATCGAGG + Intergenic
982526852 4:156489746-156489768 CAGTGTCCCCAGCTTCATCAAGG - Intergenic
982835148 4:160113888-160113910 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
982847440 4:160271656-160271678 CAGTGTCCTCAGCTTCATCAGGG - Intergenic
983184716 4:164688947-164688969 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
983581889 4:169317594-169317616 CAGTGCCCCCAGCTTCATCAGGG - Intergenic
986021809 5:3811740-3811762 TAGAGTCCACAGCTACATCAGGG - Intergenic
986037388 5:3953114-3953136 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
986080224 5:4384103-4384125 TCGTGTCCCCCACTTTAGCATGG - Intergenic
986086767 5:4460045-4460067 CAGTGTCCCCAGTTTCATCAGGG - Intergenic
986258668 5:6123682-6123704 GAGTGTCTGCAGCTTTTTCAAGG + Intergenic
986742637 5:10717436-10717458 CAGTGTGCCCAGCTTCATCAGGG - Intronic
986955885 5:13148809-13148831 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
986959489 5:13196537-13196559 CAGTGACCCCAGCCTCATCAGGG - Intergenic
987504055 5:18747189-18747211 CAGTGTCCCCAGCATCATCAGGG - Intergenic
987621478 5:20342244-20342266 TAGTGTCCCCAGCTTCATCAGGG - Intronic
987752897 5:22065005-22065027 TAGTGTCTCCAGCTTCATCAAGG - Intronic
987885272 5:23805242-23805264 CAGTGGCCCCAGTTTCATCAGGG - Intergenic
987901576 5:24018722-24018744 CAATGTCTCCAGCTTTATCAGGG + Intronic
988005350 5:25403310-25403332 CTGTGTCCCCAGCTTCATCAGGG - Intergenic
988080163 5:26404083-26404105 CAGTATACCCAGCTTCATCAGGG + Intergenic
988188434 5:27898576-27898598 CAGTGTCCTCAGCTTCATCAAGG - Intergenic
988307985 5:29518483-29518505 TACTGCCCCCAGCATTATCTAGG + Intergenic
988561771 5:32288212-32288234 CAGTGTCCCCAGCTTCATCAGGG - Intronic
989045663 5:37270907-37270929 CAGTGTCCCCGACTTCATCAGGG + Intergenic
989097421 5:37794328-37794350 CAGTGTTCCCAGCTTTGTCAGGG - Intergenic
989457998 5:41664438-41664460 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
989490202 5:42042144-42042166 TTGTCTGCTCAGCTTTATCATGG + Intergenic
990834812 5:60005637-60005659 TTGTTTCCCCAGCTTTATTAAGG - Intronic
991945774 5:71897472-71897494 CTCTGTCCCCAGCTTCATCAGGG - Intergenic
992242548 5:74786901-74786923 CTGTGTCCCCAGCATCATCAGGG - Intronic
993210480 5:84944094-84944116 TATTTTCCCCAGCTTTATTGAGG + Intergenic
993319497 5:86455932-86455954 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
993412928 5:87594487-87594509 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
993791433 5:92216238-92216260 CAGTGTCCCCAGCTTCATCATGG - Intergenic
994291741 5:98034650-98034672 CAGTGTCCCCAGTGTTATCCGGG + Intergenic
994836783 5:104865480-104865502 CAGTGTCCTCATCTTCATCAGGG - Intergenic
994958111 5:106561662-106561684 TAGTGTCCTCAGCTTCATCAGGG - Intergenic
994984764 5:106918396-106918418 CAGTGTCCCCAACTTAATCAGGG + Intergenic
995269903 5:110208140-110208162 CAGTGTCTCCAGCTTCCTCAGGG + Intergenic
995428086 5:112046446-112046468 CAGTGTCCCCAGCTTCATTGGGG + Intergenic
996165302 5:120215202-120215224 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
996909054 5:128634690-128634712 CAGTGTCTCCAGCTTCATCAAGG + Intronic
998290694 5:140911264-140911286 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1000223645 5:159237271-159237293 CAGTGTCCCAAGCCTCATCAGGG + Intergenic
1000621939 5:163495733-163495755 TAATGTCCCCAGCTTCATCAAGG + Intergenic
1000730425 5:164828287-164828309 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1001596457 5:172901970-172901992 CAGTTTCCCCAGCTGTAACATGG - Intronic
1002011798 5:176289172-176289194 TAGTTTCCCCATCTGTATGATGG + Intronic
1003696260 6:8408770-8408792 CAGTGTTCCCAGCTTCATCAAGG + Intergenic
1004824660 6:19405899-19405921 CAGTGTCCCCAGCTTCAGCAGGG + Intergenic
1004867466 6:19868453-19868475 GAGTGTCCCCACCTTCAGCAAGG + Intergenic
1005622827 6:27635696-27635718 CAGTGCCCCCAGCTTCATCAGGG + Intergenic
1006151082 6:31990355-31990377 TTGTGTCCCTAGCTTTCTCTGGG + Intronic
1006157383 6:32023093-32023115 TTGTGTCCCTAGCTTTCTCTGGG + Intronic
1008079716 6:47181036-47181058 CAGTGTCTCCATCTTCATCAGGG + Intergenic
1008399925 6:51052809-51052831 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1009308295 6:62119630-62119652 TAGCGTCCCCAGCTTCATCAGGG - Intronic
1009390460 6:63137725-63137747 CAGTGTCTCCAGCTTCATCAGGG + Intergenic
1009665686 6:66675100-66675122 TAATGTCCCAAGCTCTATGATGG - Intergenic
1009770661 6:68139520-68139542 TAGTGTCCCCAGCTTCATCAGGG + Intergenic
1009806127 6:68604140-68604162 CAGTGTCCACAGCTTCATCAGGG - Intergenic
1010323207 6:74537720-74537742 CAATGTCCCCAGCTTCATCAGGG - Intergenic
1010325666 6:74559269-74559291 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1010552080 6:77236049-77236071 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1010581070 6:77596416-77596438 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1010818237 6:80385435-80385457 CAGTGTCCCCAGCTTCAACAGGG - Intergenic
1010938509 6:81888377-81888399 CAGTATCCCCAGCTTCATCAGGG + Intergenic
1011011010 6:82704357-82704379 TTTTGCCCCCAGCTTTATTAAGG + Intergenic
1011039717 6:83015939-83015961 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1012001591 6:93661789-93661811 CAGTGTCCTCAGCTTCATTAGGG - Intergenic
1012643120 6:101647571-101647593 TAGTGTCTCCAGTTTTAGAAAGG + Intronic
1012820459 6:104080278-104080300 CAGCGTCCCCAGCTTCATCAGGG - Intergenic
1014416658 6:121192714-121192736 CAGTGTCCTCAGCTTCATCATGG - Intronic
1014534559 6:122599309-122599331 CAGTATCCCCAGCTTTATCAGGG + Intronic
1014631383 6:123794654-123794676 CAGTGTTCCCAGCTTCATCAGGG - Intergenic
1014969897 6:127801530-127801552 CAGTGTCTCCAGCTTCTTCAGGG - Intronic
1015467280 6:133560897-133560919 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1015475383 6:133654651-133654673 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1016120256 6:140335313-140335335 TAGTGTCCCCAGCTTCATCAGGG + Intergenic
1016219852 6:141654937-141654959 CAGTGTGCCCAGCTTCATCAGGG - Intergenic
1016420336 6:143875952-143875974 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1016576605 6:145575268-145575290 CAGTGTTCCCAGTTTCATCAGGG + Intronic
1016580628 6:145626015-145626037 TAGTTTCCCCATCTTTATCATGG + Exonic
1017044501 6:150334490-150334512 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1017228173 6:152043758-152043780 CAGTGCCCCCAGCCTTATCAGGG + Intronic
1018107686 6:160504478-160504500 CAGTGTCCTCAGTTTCATCAGGG + Intergenic
1018123334 6:160658204-160658226 CAGTGTCCTCAGCTTCATCAGGG + Intronic
1018562040 6:165110018-165110040 TATTTTCCCCAGATTTATTAAGG + Intergenic
1018599511 6:165524855-165524877 TGGTGTCCCCAGCTTCATCAGGG - Intronic
1018955446 6:168407004-168407026 CAATGTCCCCAACTTTACCAGGG + Intergenic
1019926114 7:4193525-4193547 CAGTGTCCCCAGCTTCATCAAGG + Intronic
1020396360 7:7722861-7722883 CAGTGTCCCCAGCTTCATCAGGG - Intronic
1020567714 7:9818421-9818443 CAGTATCCCCAGCTTTATCAGGG + Intergenic
1020709968 7:11594943-11594965 CAGTGTCCCCAGCTTCATCAGGG - Intronic
1022078536 7:26997668-26997690 CAGTGTCCCCACCTTCATCAGGG - Intergenic
1022412628 7:30150890-30150912 CAGTGTCCCCAGCTTTAAAATGG + Intronic
1022983246 7:35624610-35624632 TACAGTCTCCAGCTTTCTCAGGG + Intergenic
1023526882 7:41113762-41113784 TAGTGTTCCCATCTTTATCTAGG + Intergenic
1024040234 7:45547345-45547367 CAATGTCCCCAGCTTCTTCAGGG + Intergenic
1024149107 7:46551295-46551317 AATTTTCCCCAGCTTTATTAAGG - Intergenic
1024159463 7:46659375-46659397 CGATGTCCCCAGCTTCATCAGGG + Intergenic
1024332373 7:48169115-48169137 CAGTGTCTCCAGCTTCATCAGGG - Intergenic
1024884709 7:54127323-54127345 CAGTGTTCCCAACTTCATCAGGG + Intergenic
1024958616 7:54951753-54951775 CAGTGTCCCCAGCTTCATCGGGG + Intergenic
1025761797 7:64402818-64402840 CGGTGTCCGCAGCTTCATCAGGG - Intergenic
1026244853 7:68610891-68610913 AAGTGTCAGCAGATTTATCAGGG - Intergenic
1026984418 7:74545963-74545985 TAGTGTCCCCATCCTCATGATGG - Intronic
1027791263 7:82640625-82640647 TATTGTCCCCTGCTTTAGGAGGG + Intergenic
1029895221 7:103976577-103976599 TAGTCTCTCCAGCTATATTAAGG - Intronic
1029960887 7:104688494-104688516 CAGTGTCCTCAGCTTCATCAAGG - Intronic
1030277099 7:107733437-107733459 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1030368195 7:108670283-108670305 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1030815587 7:114032684-114032706 TATTGGCCCCAGTTTTATAAAGG + Intronic
1031279595 7:119781041-119781063 TATTGTCCCAAGTTTTATTAAGG + Intergenic
1031474790 7:122208013-122208035 CAGTGTACCCAGCTTCATCAGGG + Intergenic
1032153472 7:129449610-129449632 CAGTGTGCCCAGCTTCACCAGGG + Intronic
1034169589 7:149052698-149052720 CAGTGCCCCCAGCTTCATCAGGG - Intergenic
1036142032 8:6217542-6217564 CAGTGTCCCCAGCCTCATCAGGG - Intergenic
1036722029 8:11185040-11185062 TAATGTGCCCAGCTTTGTCTGGG - Intronic
1037191241 8:16128497-16128519 TCCTGCCCCCAGCTTGATCATGG + Intronic
1038589709 8:28825360-28825382 CATTGTCCCCAGCTTTGCCAGGG + Intronic
1039147401 8:34464287-34464309 TAGTGTCACCACCTTTAAAAAGG + Intergenic
1040713215 8:50214849-50214871 TAGTATCCTCAGCTTTGTCAGGG - Intronic
1041320006 8:56603184-56603206 TGGTCTCCCCAGCTTGATAATGG + Intergenic
1041643361 8:60226528-60226550 TAGTGTCCAGAGATTTATTAGGG - Intronic
1041985841 8:63921810-63921832 CAGTGTCCCCAGCCTCATCAGGG - Intergenic
1042001411 8:64126642-64126664 CAATGCCCCCAGCTTTGTCAGGG + Intergenic
1042076688 8:65003453-65003475 TAGTCTCACCACCTGTATCATGG + Intergenic
1042391210 8:68237451-68237473 TAGTGTCCACTGCTTTGTCTTGG - Intergenic
1043100534 8:76039746-76039768 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1043257663 8:78156714-78156736 CAGTGTCCCCAGCTTCAGCAGGG - Intergenic
1043260304 8:78186824-78186846 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1044150461 8:88770454-88770476 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1044202045 8:89449811-89449833 CAGTGTCCTCAGCTTCATCAGGG - Intergenic
1044286350 8:90415369-90415391 CAGTGTCCCCAGCTGCACCAGGG + Intergenic
1044487506 8:92769824-92769846 CAGTGTCCCTAGCTTCATCAGGG + Intergenic
1044542860 8:93427314-93427336 TAGTGTCCACAGTTATATTAGGG + Intergenic
1044780656 8:95740363-95740385 TAGTTTCCACATCTGTATCATGG + Intergenic
1045050111 8:98316583-98316605 TACTTTTCACAGCTTTATCAAGG + Intergenic
1045221412 8:100203986-100204008 CAGTGTCCCCAGTTTCATCAAGG - Intronic
1046128967 8:109943906-109943928 CAGTGTCCCCAGGTCCATCAGGG + Intergenic
1048084238 8:131159823-131159845 CAATGTACCCAGCTTCATCAGGG + Intergenic
1048494884 8:134926783-134926805 TAGCCTACCCAGCTTCATCAGGG - Intergenic
1048654704 8:136522898-136522920 TAGTGTGCCCAGCTTCATCAGGG + Intergenic
1051881774 9:21847965-21847987 CAGTGTCCCCAGCTTCATCAGGG - Intronic
1051966061 9:22831560-22831582 CGTTGTCCCCAGCTTCATCAGGG - Intergenic
1052171768 9:25407408-25407430 TAGTGTGACTTGCTTTATCATGG + Intergenic
1052227260 9:26105699-26105721 CGGTGTCCCTAGCTTCATCAGGG - Intronic
1052368277 9:27638171-27638193 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1052576976 9:30303347-30303369 CAATATTCCCAGCTTTATCAGGG - Intergenic
1052718436 9:32146445-32146467 CAATGTCCCCAGCTTCATCAGGG - Intergenic
1052789329 9:32859945-32859967 CAGTGTCCCCAGCCTCATCAGGG + Intergenic
1056314592 9:85375623-85375645 CCGTGTCCCCAGCTTCGTCAGGG + Intergenic
1057316224 9:93970458-93970480 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1058259587 9:102812351-102812373 CAGTGTCTCCAGCTTCATTAGGG + Intergenic
1058571123 9:106345881-106345903 TAGTTTCCTGAGATTTATCAAGG - Intergenic
1059066567 9:111091845-111091867 CAGCGTCCCCAGCTTCATCAAGG - Intergenic
1060103246 9:120857865-120857887 TAGGCTCCCCAGCTTTCTCCAGG - Exonic
1061006151 9:127929422-127929444 CAGTGTCCCCATCTGTATAATGG - Intronic
1061052554 9:128204907-128204929 CAGTGTCCCCATCTCTAACATGG + Intronic
1061902481 9:133680194-133680216 CAGTGTCCCCACCTGTAGCACGG - Intronic
1186279277 X:7975479-7975501 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1186470151 X:9814757-9814779 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1187910844 X:24109938-24109960 TTGTGTCCCCAGCTTACTGAAGG - Intergenic
1189372196 X:40437692-40437714 CAATGACCCCAGCTTCATCAGGG - Intergenic
1189665943 X:43354898-43354920 CAAAGTCCCCAGCTTTATCAGGG + Intergenic
1190318299 X:49165009-49165031 GAGTGTCCCCAGCTACATCCCGG - Exonic
1191630448 X:63315887-63315909 TAGTGTCCACAGCTTCATCAGGG + Intergenic
1191742880 X:64453977-64453999 CAGTGTCCCCAGGTTCATCAGGG + Intergenic
1191759018 X:64627233-64627255 CTGTGTCCCCAGCTTCATCAGGG - Intergenic
1191769835 X:64742785-64742807 CAGTGTCCTCAGCTTCATCAGGG + Intergenic
1191864582 X:65693740-65693762 TAGTTTCCCCATCTTTAAAATGG + Intronic
1191941577 X:66486534-66486556 CAGTTTCCCCAGCTTCATCAGGG + Intergenic
1191945911 X:66535229-66535251 CAGTGTCCTCAGCTTCATTAGGG - Intergenic
1192298070 X:69870663-69870685 CAGTGTGCCCAGCTTCATCAGGG + Intronic
1192673590 X:73171058-73171080 CAGTGTCCCTAGCTTCATCAGGG + Intergenic
1192995886 X:76512907-76512929 CAGTGTCCCCAGCTTTATTAAGG - Intergenic
1193053088 X:77122501-77122523 CAGTGTCTCCATCTTCATCACGG - Intergenic
1193574027 X:83177647-83177669 CAGTGTCCCCAACTTCATCAGGG + Intergenic
1193688785 X:84613081-84613103 TAGTGTCTCAAGCTTAGTCAAGG + Intergenic
1193832594 X:86307441-86307463 CAGTGTCCCCAGCTTCATCAGGG - Intronic
1193876940 X:86872623-86872645 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1193879161 X:86900417-86900439 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1193904251 X:87223878-87223900 CAGTGTCCCCAGCTTCATCAAGG - Intergenic
1194032347 X:88832516-88832538 CAGTGTCCCCAGCTTCATTAGGG + Intergenic
1194106665 X:89778210-89778232 TCATCTCCCCAGCTTTATCAGGG - Intergenic
1194179935 X:90698634-90698656 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1194342963 X:92728424-92728446 CAATGTCCCCAGCCTCATCAGGG - Intergenic
1194443233 X:93958418-93958440 CAATGTCCCCAGCTTCATCAAGG - Intergenic
1194491469 X:94555279-94555301 CAGTGTACTCAGCTTCATCAGGG - Intergenic
1194513759 X:94824918-94824940 CAGTGTCCCCAGCTTCATCAAGG + Intergenic
1194604746 X:95964661-95964683 CAGTGTCCTAAGCTTCATCAGGG + Intergenic
1194833588 X:98656124-98656146 CAGTGTCCCCGGCTTAATCAGGG - Intergenic
1195234587 X:102883990-102884012 TAGTGTCCCCTTCTGTATAATGG + Intergenic
1195749205 X:108147354-108147376 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1195782723 X:108482544-108482566 CAGTGTCCCCAGCTTTATCAGGG + Intronic
1195810014 X:108818504-108818526 CAGTGTACCCACCTTCATCAGGG + Intergenic
1196275464 X:113761435-113761457 CAGTGTCCCCAGCTTCAACAGGG - Intergenic
1196372673 X:114996819-114996841 CAGTGTCCTCAGCTTCATCAGGG + Intergenic
1196656842 X:118227445-118227467 TATTTTCCCCAGCTTTATTGAGG + Intergenic
1197044111 X:121975769-121975791 TAGTGTCCCCAGCTTCTTCAGGG - Intergenic
1197074407 X:122337576-122337598 CAGTGTCCCCAGATTCATCAGGG + Intergenic
1197084545 X:122456180-122456202 CAGTGCCCACAGCCTTATCAGGG + Intergenic
1197245460 X:124161993-124162015 CAGTGTACCCAGCTTCATCATGG + Intronic
1197342649 X:125291627-125291649 TTGTGTCCCCAGATCTAGCACGG - Intergenic
1197372373 X:125640527-125640549 CAGTGTCCCCAACTTCATCAGGG + Intergenic
1197404741 X:126036510-126036532 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1197409561 X:126098509-126098531 CTGTATCCCCAGCCTTATCAGGG + Intergenic
1197426091 X:126298292-126298314 CAGTGTTCCTAGCTTCATCAGGG + Intergenic
1197529515 X:127605882-127605904 CAGTGTCCCCACCTTCATTAGGG - Intergenic
1197534473 X:127670857-127670879 TAATGTCCCCAGCTTCGTCAGGG - Intergenic
1197537272 X:127706586-127706608 CAGTGCCCCCAGCTTCATTAGGG - Intergenic
1197956199 X:131951196-131951218 CAGTGTCCCCAGCTCTATCAGGG - Intergenic
1198169675 X:134093526-134093548 CACTGTCCTCAGCTTCATCAGGG - Intergenic
1198698301 X:139367550-139367572 TTGTTTTCCCAGCTTTATTAAGG + Intergenic
1198783395 X:140260507-140260529 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1199024038 X:142917036-142917058 CAGTGTCCCCAGCTTCATTGGGG - Intergenic
1199627433 X:149753268-149753290 CAGCGTCCCCAGCTTCATCAGGG + Intergenic
1199855681 X:151756956-151756978 CAGAGTCCCCAGCTGTATAATGG - Intergenic
1200289171 X:154855559-154855581 CAATGTCCCCAGCTTAATCAGGG - Intronic
1200340648 X:155391764-155391786 CTGTGTCCCCAGCTTCATCAGGG + Intergenic
1200458629 Y:3426074-3426096 TCATCTCCCCAGCTTTATCAGGG - Intergenic
1200526590 Y:4280803-4280825 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1200651324 Y:5845090-5845112 CAATGTCCCCAGCCTCATCAGGG - Intergenic
1201529953 Y:14980630-14980652 CAGTGTCCCTAACTTCATCAGGG + Intergenic
1202100105 Y:21298758-21298780 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1202341386 Y:23872584-23872606 CAGTATCCCCTGCTTCATCAGGG + Intergenic
1202529380 Y:25797502-25797524 CAGTATCCCCTGCTTCATCAGGG - Intergenic