ID: 1086146248

View in Genome Browser
Species Human (GRCh38)
Location 11:83555393-83555415
Sequence TGGATTGGAGAACCATAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086146248 Original CRISPR TGGATTGGAGAACCATAGAT TGG Intronic
900004307 1:34696-34718 GTGATGGCAGAACCATAGATGGG - Intergenic
900024034 1:205212-205234 GTGATGGCAGAACCATAGATGGG - Intergenic
902648827 1:17823260-17823282 TGTGTTGGAGAACCACAGACGGG + Exonic
902726564 1:18339869-18339891 TGGATGAGAGAACCAAAAATGGG - Intronic
912574211 1:110650068-110650090 TGGACTGGAGCTCCAGAGATTGG + Intergenic
913428838 1:118766335-118766357 TGGATTGGGATAGCATAGATAGG + Intergenic
913479349 1:119272026-119272048 TAAAATGGAGATCCATAGATTGG + Intergenic
915540410 1:156562351-156562373 CTGACTGGAGAACCATAGAGAGG - Intronic
915623619 1:157100983-157101005 TGAATTGGTGAACCATGGACAGG + Intergenic
915781906 1:158561753-158561775 AAGATTGAAGAGCCATAGATAGG - Intergenic
916770923 1:167907181-167907203 TGGGCTGGAATACCATAGATGGG + Intronic
918356275 1:183708691-183708713 TGGATTGGAGAAACCAAGAGAGG + Intronic
919646889 1:200104062-200104084 TGCATTGGAGAAACATGGAAAGG + Intronic
921531715 1:216291033-216291055 TGGATTGGAGAAGGTTAGAGTGG - Intronic
1065318648 10:24488286-24488308 TGGATGGGAGCACCAGGGATGGG + Intronic
1066766998 10:38811812-38811834 TGGATTGGAGTAGCACGGATTGG - Intergenic
1069637533 10:69934845-69934867 TGGCTTAGAGAAGCAGAGATTGG - Intronic
1072135714 10:92543734-92543756 TGGAATGAACAACCATTGATAGG - Intronic
1072376495 10:94821908-94821930 TGGGTTGGAGAACCATCTGTTGG - Intronic
1073459182 10:103656305-103656327 TGGATTGGCAAACGTTAGATCGG - Intronic
1074916457 10:117960461-117960483 TGGATGGGAGAACCAAAGCGTGG - Intergenic
1081998975 11:47382532-47382554 TGCATTAGGGAACCATTGATTGG + Intergenic
1086146248 11:83555393-83555415 TGGATTGGAGAACCATAGATTGG + Intronic
1089921781 11:122215732-122215754 TGGAGCAAAGAACCATAGATGGG + Intergenic
1091377730 12:36744-36766 GTGATGGCAGAACCATAGATGGG - Intergenic
1092230947 12:6774927-6774949 TGGTTTGGGGACCCATAGTTAGG - Intronic
1099007709 12:77254207-77254229 AGGCTTGCAGAACTATAGATTGG + Intergenic
1104118765 12:125777135-125777157 AGGAATGGAAAACCATAGAAAGG + Intergenic
1106375086 13:29178416-29178438 TGAATTGCAGAACCAGAGTTAGG + Intronic
1107077914 13:36343738-36343760 AGGATTGGATAACCTTAGAAGGG - Intronic
1107731205 13:43350790-43350812 TGAATTTCAGAACAATAGATAGG + Intronic
1110198504 13:72819549-72819571 TGGATTTGACAAACTTAGATTGG + Intronic
1110386597 13:74919430-74919452 TGGAATGGAGAGACACAGATGGG + Intergenic
1110992231 13:82056983-82057005 TGGATAGGAGAAACATATAAAGG + Intergenic
1111239043 13:85451011-85451033 CTGATTGCAGAACCAAAGATTGG + Intergenic
1112379845 13:98878442-98878464 TGGATTGGATGAAGATAGATTGG - Intronic
1113055724 13:106265151-106265173 TGGAATGGAGCACCTTGGATGGG - Intergenic
1113931150 13:113969676-113969698 TGGGTGGGAGAACCAGAGCTGGG + Intergenic
1115630229 14:35237386-35237408 TGGATTTGAGAAACAGAGCTGGG - Intronic
1117714884 14:58570506-58570528 TTTATTGGAGAATCATAGAATGG + Intergenic
1119980225 14:79072252-79072274 TGGCTTGCAGAAGCATATATTGG - Intronic
1126531200 15:49713022-49713044 TGGAGTGGAGAAACAGAGCTAGG - Intergenic
1130917627 15:88318281-88318303 TGGATTGAAGAATCGTAGAATGG - Intergenic
1131664752 15:94558400-94558422 TGGATTGTAAAACCATGAATGGG - Intergenic
1132449197 15:101956248-101956270 GTGATGGCAGAACCATAGATGGG + Intergenic
1136904148 16:34071463-34071485 TGGATTGGAGTGCAGTAGATTGG + Intergenic
1138916221 16:61467865-61467887 TGGATTGGAGAAACTTCAATTGG + Intergenic
1139104053 16:63804331-63804353 GCGATTAGAGAACCAAAGATAGG + Intergenic
1140977835 16:80077360-80077382 TGGATTGGAGGCTCATAGCTGGG - Intergenic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1144283035 17:13745687-13745709 TTTATTGGAGAAACATTGATCGG - Intergenic
1144552547 17:16253976-16253998 TGGAGAGGAGAGACATAGATTGG - Intronic
1144648113 17:16989132-16989154 TGGATTGGAGACACACAGAGGGG + Intergenic
1144969583 17:19099316-19099338 TGGATCTGAGAACCAAATATAGG + Intergenic
1144978333 17:19152748-19152770 TGGATCTGAGAACCAAATATAGG - Intronic
1144989888 17:19225485-19225507 TGGATCTGAGAACCAAATATAGG + Intronic
1145343269 17:21972465-21972487 TGGATTGGAATGCCATAGAGTGG + Intergenic
1146616157 17:34358911-34358933 TGGAGTGGGGAGGCATAGATTGG - Intergenic
1147632761 17:41942719-41942741 GGACTTGGAGAACCATAGGTAGG + Intronic
1152185415 17:78853556-78853578 TGAACTGGAGAACCAAAGACGGG + Exonic
1203177052 17_KI270729v1_random:26629-26651 TGGAATGGAATACAATAGATGGG + Intergenic
1203177079 17_KI270729v1_random:26804-26826 TGGAATGGAATACAATAGATGGG + Intergenic
1203180362 17_KI270729v1_random:51849-51871 TGGATTGGAATACAATAGAAAGG + Intergenic
1155331828 18:24726730-24726752 GGGCTTGGAGACCCACAGATTGG + Intergenic
1158692836 18:59676735-59676757 TGAAATGGACAACCACAGATAGG + Intronic
1158994376 18:62902398-62902420 TGAATGGGAGCACCAGAGATGGG - Intronic
1160636059 19:76305-76327 GTGATGGCAGAACCATAGATGGG - Intergenic
1164112133 19:22176124-22176146 TCTATGGGAGAACCATATATAGG - Intergenic
1165983430 19:39746446-39746468 TGGAGTGTAGAACAATAGAAGGG - Intergenic
1166157998 19:40929793-40929815 TGAATTGGAGAAGCATAAATTGG - Intergenic
930809464 2:55525575-55525597 TGTATTGGAGAACTATAGCAAGG - Intronic
936040138 2:109143293-109143315 AGGCTTGGAGGACCATAGTTTGG + Intronic
936444837 2:112587258-112587280 TGGAATTGAGAACCATGGAAAGG - Intronic
936565421 2:113578745-113578767 GTGATGGCAGAACCATAGATGGG + Intergenic
936669247 2:114637340-114637362 TGGATTGGAGGACAATAGTGAGG - Intronic
936843097 2:116797665-116797687 AGGAGTGGAGAATCATAGAAGGG + Intergenic
939858783 2:147393053-147393075 TGGGTTCGAGGACCACAGATGGG - Intergenic
944647929 2:201798474-201798496 TGGAAAGCAGAACCATGGATTGG + Intronic
945925530 2:215799539-215799561 TGGAAAGGAAAACCATGGATAGG + Intergenic
946096185 2:217275948-217275970 TGGATTGGAGTACCACAGTTAGG + Intergenic
1171931492 20:31233128-31233150 TGGAATGGAATCCCATAGATTGG + Intergenic
1173668539 20:44780886-44780908 AGGATTTGAGAACCCTAGAGAGG + Intronic
1176529082 21:7944251-7944273 TGGATTGGAGAAGAATAGAGTGG - Intergenic
1182489453 22:30661229-30661251 TGGATTTGAGATCCATGAATGGG - Intronic
1203297125 22_KI270736v1_random:51214-51236 TGGATTGGAGAGAAATAGAATGG + Intergenic
1203313294 22_KI270736v1_random:157820-157842 TGGATTGGAGAGCAATGGAGTGG + Intergenic
949232564 3:1768444-1768466 TGGATAGGAAAATCAGAGATCGG - Intergenic
949338925 3:3007713-3007735 TGGCTTGGTAACCCATAGATTGG + Intronic
955749510 3:62173494-62173516 TGAGTTGGAGAACCCTAAATGGG + Intronic
956498673 3:69857243-69857265 TGGAACAGAGAACCATAGAGAGG + Intronic
956680809 3:71778482-71778504 TGAAACTGAGAACCATAGATAGG - Intronic
957007658 3:74969133-74969155 GGGATTGGAAATCCATATATCGG + Intergenic
960398733 3:117169838-117169860 TGGCTTGGAAAACAAAAGATGGG + Intergenic
960409024 3:117299104-117299126 TGGATTTGAGAAACATATAAGGG - Intergenic
969105695 4:4805582-4805604 TGGACTTGAGAGCCATAGAAGGG + Intergenic
969224119 4:5783528-5783550 TGGAGCGGAGAACCACAGATGGG - Intronic
979613762 4:122718623-122718645 TGGATTGAAGAGAAATAGATTGG + Intergenic
980629252 4:135411966-135411988 TTGATTGGAGAGCGATTGATTGG - Intergenic
981602107 4:146501499-146501521 AAGATTGGAGAACCACAAATAGG - Intronic
984043955 4:174773992-174774014 TGGGTGTTAGAACCATAGATGGG + Intronic
984535809 4:180973793-180973815 AGGAATGGAGAACCAAAAATGGG + Intergenic
988497927 5:31760518-31760540 TGGATTGTAGAGCAATAGAAAGG + Intronic
989376792 5:40771916-40771938 TAGGTTGGAGAATTATAGATAGG - Intronic
989969948 5:50511529-50511551 TGATTTGGGGAAACATAGATTGG - Intergenic
995265789 5:110158328-110158350 TGGATTGGAGAACTTAATATTGG + Intergenic
995598702 5:113773904-113773926 TCTATTGGGGAACCATAGAAAGG + Intergenic
997596248 5:135109137-135109159 TGCATTGGAGCACCATCAATGGG - Intronic
997712110 5:136014596-136014618 TGGATTGTAGAACCTTGGAGAGG + Intergenic
1001233183 5:170007583-170007605 TGGATTGTAGATCCATGGTTTGG + Intronic
1003265034 6:4558191-4558213 CTGATAGGAGAACCAGAGATAGG + Intergenic
1003624503 6:7728904-7728926 TGGAGTTGGGAATCATAGATAGG - Intronic
1004974577 6:20950656-20950678 AGGAATGGAGAACAAAAGATGGG + Intronic
1005151452 6:22756419-22756441 TGGATTGAAGAAGCAAAGAATGG - Intergenic
1005616821 6:27581334-27581356 TGGATTGCTGAGCCTTAGATTGG + Intergenic
1005886043 6:30098494-30098516 TGGCTTGGAAAACCAGAGAAAGG - Intergenic
1007276750 6:40679734-40679756 TGGACTGGGGCTCCATAGATTGG - Intergenic
1022275515 7:28851666-28851688 TGAATTGGAGAATCATAAATGGG + Intergenic
1023116249 7:36865480-36865502 TGGATTGGAGAACTATTGGCCGG - Intronic
1028166031 7:87539279-87539301 TGGATCGGAAAACCATGTATCGG + Exonic
1028765293 7:94550493-94550515 TGTAATAGAGTACCATAGATTGG + Intronic
1031714948 7:125097453-125097475 TATTTTGGAAAACCATAGATGGG + Intergenic
1031831940 7:126638612-126638634 TGGAATGGAGTACCATAGAGAGG + Intronic
1032682904 7:134203709-134203731 GGGATTGGGGAACATTAGATTGG + Intronic
1032906034 7:136367823-136367845 TGGTTTGGAGAACTGTATATGGG + Intergenic
1032993612 7:137421301-137421323 TAGATTGTGTAACCATAGATGGG + Intronic
1033091328 7:138388846-138388868 AGGATTGGATAACCTAAGATTGG - Intergenic
1033481050 7:141741061-141741083 TGGTTTAGAGAACGAGAGATAGG - Intronic
1035065589 7:156102768-156102790 TGGGTTAGAGAAGCATAGATGGG - Intergenic
1037208112 8:16349921-16349943 TGGATAGGAGAAACAGAGAAAGG - Intronic
1041871932 8:62644616-62644638 TGGAAAGGACAACTATAGATTGG + Intronic
1042277521 8:67020499-67020521 TGGATTGAAAAACCCTGGATTGG - Intronic
1042797500 8:72680502-72680524 TGGATTGGTGAATCCTATATGGG + Intronic
1047368211 8:124232335-124232357 TGGATAGCAGAATCATGGATTGG + Intergenic
1049887004 9:34479-34501 GTGATGGCAGAACCATAGATGGG - Intergenic
1054823229 9:69544908-69544930 TTCATTGAAGAACCATACATTGG - Intronic
1055796396 9:79979005-79979027 GGTATTGGAGAACCATTGAAGGG + Intergenic
1059850968 9:118339190-118339212 TGGCTTGAAGAACCATAGAGCGG - Intergenic
1061282616 9:129606179-129606201 TGGATTGGGGAGATATAGATGGG - Intergenic
1203387867 Un_KI270438v1:71421-71443 TGGATTGGAGAAGAATAGAGTGG + Intergenic
1195372457 X:104191476-104191498 TGGTTAGGAGAACCAAAGAGGGG - Exonic
1198600192 X:138275554-138275576 TTTATTAGAGAACCATACATAGG - Intergenic
1201097194 Y:10630410-10630432 TGGAGTGGAGTAGCATAGAGTGG - Intergenic
1201098045 Y:10648840-10648862 TGGAGTGGAGTAGCATAGAGTGG - Intergenic
1201110246 Y:10793915-10793937 TGGAATGGAGTACCATGGACTGG - Intergenic
1201114408 Y:10824466-10824488 TGGAGTGGAGAACAATGGAGTGG - Intergenic
1201117884 Y:10848421-10848443 TGGAGTGGAGAAGAATAGAATGG - Intergenic
1201119555 Y:10862509-10862531 TGGATTGGAGAAGAATGGAGTGG - Intergenic