ID: 1086148768

View in Genome Browser
Species Human (GRCh38)
Location 11:83585274-83585296
Sequence CAGGATGGAGACATTGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086148768 Original CRISPR CAGGATGGAGACATTGATCT GGG Intronic
900129133 1:1080242-1080264 CAGGAGGGACACACTGAGCTGGG - Intergenic
901279131 1:8018851-8018873 CAGGCTGGAGTCATTGATTCAGG - Intronic
901386148 1:8910576-8910598 CAGGCTGGAGACAGACATCTGGG + Intergenic
902574775 1:17370802-17370824 CAGGAGGGAGACTCTGAACTTGG + Intergenic
904317897 1:29677686-29677708 GAGGATGGAGCCATTGTTCTTGG + Intergenic
904759674 1:32793591-32793613 CAGGCTGGAGTGATTGATCTTGG - Intronic
905518279 1:38578203-38578225 CAGGATGGAGAAAGTGAGATTGG + Intergenic
906237114 1:44218797-44218819 GAGGATGGAGACAATGAGCAAGG - Intronic
910811386 1:91240836-91240858 CAGAATGGAGTCATTGACCTAGG + Intergenic
911684957 1:100765084-100765106 CAGGCTGGAGACAGTGATTAAGG + Intergenic
912481684 1:109986158-109986180 AAGAAGGGAGACATTTATCTGGG - Intronic
917061835 1:171049516-171049538 CAGAGAGGAGTCATTGATCTGGG + Intronic
918052733 1:180988703-180988725 GTGGATTGAGACCTTGATCTTGG - Intronic
918333279 1:183480836-183480858 CAAGAAGGAAGCATTGATCTGGG + Intronic
918360624 1:183753587-183753609 CAGGAAGGGAACATTGACCTTGG + Intronic
919760738 1:201096511-201096533 AAGGTTGGTGACTTTGATCTTGG - Intronic
921851582 1:219937829-219937851 CAGGGTGGAGAAATTGATTAAGG - Intronic
924753137 1:246915667-246915689 CAGGATGAATAAATTGAACTTGG - Intronic
1063704698 10:8419569-8419591 TAGGAGGGAGAGAGTGATCTGGG + Intergenic
1063720943 10:8580801-8580823 CAGGATTCAGACCTTTATCTAGG + Intergenic
1068817006 10:61327926-61327948 CAAGATGGAGATATTGATAATGG - Intergenic
1070931602 10:80264876-80264898 CAGGATGGGGAGAGTGCTCTGGG - Intergenic
1072657055 10:97337128-97337150 CAGGAATGAGACTTGGATCTAGG - Intergenic
1072916778 10:99541653-99541675 CAGAATGGATACATTGATTGTGG - Intergenic
1074364693 10:112848555-112848577 CAGGCTGGAGACACAGATCATGG + Intergenic
1076497501 10:130906448-130906470 CAGGGTGGAGAAAATGATTTGGG + Intergenic
1076730052 10:132433930-132433952 CAGGATGGGGACAGTCAGCTGGG - Intergenic
1083559729 11:63663774-63663796 CAGGAGGGAGAAATTAATATTGG - Intronic
1083748564 11:64748262-64748284 CAGGATGGAGACAGTGCTGGAGG - Intronic
1084124156 11:67087861-67087883 CAGGCTGGAGTGCTTGATCTTGG - Intergenic
1085483840 11:76845169-76845191 GAGGATGGTGATATTTATCTTGG + Intergenic
1085743309 11:79094888-79094910 GATGATGCAGGCATTGATCTGGG - Intronic
1086148768 11:83585274-83585296 CAGGATGGAGACATTGATCTGGG + Intronic
1088126839 11:106436758-106436780 CAGAATGGGGAAATTGATCAAGG + Intergenic
1088134541 11:106538441-106538463 CAAGATGGAGAAAGTGATTTGGG - Intergenic
1088308108 11:108431530-108431552 GAGTATGAAAACATTGATCTGGG + Intronic
1089074551 11:115727813-115727835 CAGGGTGGAGTGATTGCTCTGGG + Intergenic
1090586315 11:128216389-128216411 CAGGATATTGACATTGATATGGG - Intergenic
1102363389 12:112309312-112309334 CTGGCTGGAAACAATGATCTTGG + Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1103009526 12:117447664-117447686 CTGGATGAAGCCACTGATCTTGG + Intronic
1103824121 12:123722469-123722491 CTGGTTGCAGCCATTGATCTTGG + Intronic
1107126427 13:36851348-36851370 CTGGAAGGAGACATGGAGCTAGG - Intronic
1111583762 13:90258302-90258324 CAGCATGGAGGCATTGATGATGG - Intergenic
1113343545 13:109450443-109450465 CAGGAGGGAGACACTGAGCCTGG - Intergenic
1113507903 13:110829833-110829855 AAGGATGAATACATTGTTCTGGG + Intergenic
1114473831 14:22981090-22981112 CAGGAAGGGGACAGTGCTCTGGG + Intronic
1115296260 14:31830753-31830775 CAGGCAGGATACTTTGATCTGGG + Intronic
1118020806 14:61712129-61712151 CAAGATGGAGGCAGTGATCAGGG + Intronic
1118807892 14:69253632-69253654 CAGGATGGACCCCTTGACCTAGG - Intergenic
1120949116 14:90024547-90024569 CAGTATGGAGACTGTGATTTTGG + Intronic
1121055155 14:90846022-90846044 CAGGAAGGAGCCATGAATCTAGG - Intergenic
1122879716 14:104685283-104685305 CAGGAGGTAGACATTGGTCAGGG - Intergenic
1125048304 15:35268951-35268973 CATGTTGGAAACATTCATCTTGG - Intronic
1127209520 15:56758816-56758838 CAAGAAGGAGAGATTGAACTTGG - Intronic
1127384697 15:58457857-58457879 CAGGATGGAGACATGGGCCCGGG - Intronic
1127849320 15:62899137-62899159 GAGGTTAGAGACATTCATCTGGG - Intergenic
1128993099 15:72276849-72276871 CAGGATGGAAATATAGATTTGGG - Intronic
1129433672 15:75520362-75520384 CAGGATGAGCACTTTGATCTGGG - Intronic
1130821547 15:87501463-87501485 CAGAATGGAGCCATCCATCTGGG - Intergenic
1130927239 15:88394814-88394836 CAGAAAGGAGAGATTGAACTGGG - Intergenic
1131241590 15:90748554-90748576 CAGGTTGTAGACTTTGTTCTGGG + Intronic
1133951363 16:10396697-10396719 CAGGATGGAGTGCTTGATCTTGG + Intronic
1136742986 16:32556095-32556117 CAGGATGGAAACATTGTTTTTGG + Intergenic
1137730681 16:50687387-50687409 CAGGACGGACACATGGAACTTGG + Intergenic
1138068572 16:53967441-53967463 AAGGATGGAGACAGAGAGCTAGG + Intronic
1138918915 16:61502839-61502861 CAGGAGTGAGCCATTGAACTGGG + Intergenic
1139325653 16:66150787-66150809 CAGGCTGGAGACATAAACCTGGG + Intergenic
1140588070 16:76318152-76318174 CAGAATGGAGACCTTATTCTAGG - Intronic
1142139479 16:88466430-88466452 CAGGATGGAGACTCTGACCTCGG - Intronic
1203026613 16_KI270728v1_random:519134-519156 CAGGATGGAAACACTGTTTTTGG - Intergenic
1203045108 16_KI270728v1_random:815297-815319 CAGGATGGAAACACTGTTTTTGG + Intergenic
1144507253 17:15842995-15843017 CAGGATCCAGACACTGACCTGGG - Intergenic
1144588524 17:16503923-16503945 CAGGATGCAGATATTGACATGGG - Intergenic
1144796578 17:17895585-17895607 AAAGGTGAAGACATTGATCTAGG + Intronic
1145009348 17:19358796-19358818 CAGGCTGGAGACATAAATTTGGG - Intronic
1145171382 17:20660600-20660622 CAGGATCCAGACACTGACCTGGG - Intergenic
1146054729 17:29575384-29575406 CTGGATGGAGACCTAGATCCTGG - Exonic
1146182453 17:30706909-30706931 CAGGCTGGACACCTGGATCTGGG - Intergenic
1147985864 17:44307774-44307796 CTGAATGGGGTCATTGATCTCGG - Intergenic
1150669511 17:67180008-67180030 CACTATTGAGACATTAATCTTGG - Intronic
1151518126 17:74610247-74610269 TAGGAGGAAGACATTGATCAAGG - Exonic
1153328618 18:3848751-3848773 TAGGATGGTGACAGTGATATTGG - Intronic
1153661168 18:7327577-7327599 CAGGCTGGAGACATAAATTTGGG + Intergenic
1153841855 18:9014902-9014924 CTGCATGGAGCCATTGCTCTTGG - Intergenic
1157098367 18:44707933-44707955 CAGCAAGGAGAGATTGGTCTAGG + Intronic
1158851656 18:61500836-61500858 CAGGATTGACACATTCACCTGGG + Intronic
1160483899 18:79270693-79270715 CAACATGGAGTCATTAATCTCGG + Intronic
1163713781 19:18862506-18862528 CAGAATGGACACCTTGTTCTCGG - Intronic
1164145702 19:22511237-22511259 CAGGATGGGGCCTTTCATCTAGG + Intronic
1164526698 19:29018304-29018326 CAGCATGGAGGGATTGATCAGGG - Intergenic
1165277146 19:34764187-34764209 CAGGATGGCAACAGTGACCTGGG + Intronic
1165648211 19:37462840-37462862 TAGGATGGAGACATATATTTGGG - Intronic
1167233824 19:48301985-48302007 CTGGATGGAGAGATAGATATAGG + Intronic
1167233872 19:48302239-48302261 CTGGATGGAGAGATAGATATAGG + Intronic
1168541900 19:57219781-57219803 CAGTCTGGAGACATAGATTTGGG - Exonic
926854756 2:17242684-17242706 CAGGATGATGGCATTGATATTGG - Intergenic
928389952 2:30901838-30901860 CAGGATGGTGAGACTGCTCTAGG + Intergenic
929464219 2:42130178-42130200 CAGGAATGACACATTGTTCTAGG + Intergenic
930869069 2:56151568-56151590 CAGAATGGAGGCAGTGATTTTGG - Intergenic
932189026 2:69723515-69723537 CTGGTTGGAGACATTGGACTAGG - Intronic
932967814 2:76498539-76498561 CATGATGCAGACAGGGATCTGGG - Intergenic
935040069 2:99417552-99417574 CAGGACGGAGACATGCATATGGG + Intronic
935552940 2:104478052-104478074 CCAGAAGGAGACAGTGATCTGGG + Intergenic
936373018 2:111918900-111918922 CATGATGGAGAAATTAAACTTGG + Intronic
937777712 2:125799450-125799472 AATGTTGGAGACATTGGTCTTGG + Intergenic
937956782 2:127426267-127426289 CAGGATGGACTCAGTGATCCCGG - Intronic
938244195 2:129764725-129764747 CAGGACGGGGACATTTATCGGGG - Intergenic
938671377 2:133589523-133589545 CAGGATGGAGGTATAGATCTGGG + Intergenic
938832156 2:135062069-135062091 CAGGCTGGAGTGCTTGATCTTGG + Intronic
939024460 2:136995414-136995436 CAGGAAGAAGAGCTTGATCTTGG - Intronic
939562737 2:143751589-143751611 GAGGATGGAGACAATGAGCTGGG - Intronic
940450407 2:153828567-153828589 CAGCATGGAGACCTTGAACCTGG + Intergenic
941135177 2:161707200-161707222 CAGGTTGGAGACACAGAGCTTGG - Intronic
946766363 2:223044628-223044650 CAGGAGGGAGACACAGACCTGGG - Intergenic
948362693 2:237434052-237434074 CTGGAGGGAGACATAGTTCTTGG - Intergenic
948802180 2:240437935-240437957 CAAGATGGAGAAGTTGATGTGGG + Intronic
1170397092 20:15938124-15938146 AAGTAGGGAGACATTGATCTGGG + Intronic
1170469070 20:16650176-16650198 CAACATGGAGGCATTGCTCTAGG + Intergenic
1171904795 20:30892344-30892366 CGGGATGGAGAGATAGATATGGG - Intergenic
1172780989 20:37437059-37437081 GAGGATGGAGAGTTTGATCCTGG - Intergenic
1172786842 20:37474171-37474193 CAGGAGGGAGACTTTTCTCTGGG + Intergenic
1174310346 20:49648387-49648409 CAGGATGGGGAAATGGGTCTGGG + Intronic
1174904834 20:54539417-54539439 CAGGATACAGACATTGATACAGG - Intronic
1176067605 20:63206669-63206691 CAGGCTGGATACAGTGACCTGGG + Intronic
1176945473 21:14975142-14975164 AAGGAAGGAAACATTCATCTAGG + Intronic
1178285849 21:31324760-31324782 CAGGCTGGAGACAAAGATTTTGG + Intronic
1178902363 21:36607480-36607502 CAGAATGGAGACACTCATTTGGG - Intergenic
1179011996 21:37563493-37563515 CAGGAAGCAGACATGTATCTGGG + Intergenic
1179197436 21:39178695-39178717 CAGAATGGAAACATTCCTCTAGG + Intronic
1180791149 22:18576497-18576519 CAGGATGGAGGGATGGAGCTGGG - Intergenic
1181230589 22:21418817-21418839 CAGGATGGAGGGATGGAGCTGGG + Intronic
1181248061 22:21516052-21516074 CAGGATGGAGGGATGGAGCTGGG - Intergenic
1182397524 22:30046954-30046976 CTGCATGGAGTGATTGATCTTGG + Intergenic
1183268708 22:36847315-36847337 CAGGATGGGGACATGGAACACGG + Intergenic
1183324767 22:37185222-37185244 CAGGATGGTGATATTAATGTAGG + Exonic
1184161903 22:42702012-42702034 CAGGAAGAAGACACTGATCAGGG - Intronic
950847287 3:16027250-16027272 CAGGGAAGAGACAATGATCTAGG - Intergenic
953475418 3:43201908-43201930 CAGGAAGTGGACATTGACCTAGG - Intergenic
954406372 3:50347571-50347593 CTGGATGGACACATTGCTGTGGG - Exonic
956587594 3:70881069-70881091 CAAGAAGGTGAAATTGATCTTGG + Intergenic
958730102 3:97952277-97952299 CAGCCTGGACACATTGATCATGG + Intronic
959324313 3:104917506-104917528 CATGATGTATACATTGATCCAGG - Intergenic
960952979 3:123011624-123011646 CAGGATGCAGGCATTAACCTTGG - Intronic
961808230 3:129504521-129504543 CAGGATGAAGTCATCTATCTTGG - Intronic
963273430 3:143307735-143307757 CAGGCTGGAGACCTTGATCCAGG - Intronic
964158368 3:153614773-153614795 CACAATGGAGAAATAGATCTGGG + Intergenic
964262985 3:154861300-154861322 CAGGATGGAATCATAGATCTAGG - Intergenic
964491195 3:157238127-157238149 AAGGATGGAGACAGCGGTCTAGG - Intergenic
964622947 3:158733694-158733716 CAGGATGGAGAAATGGATGTTGG - Intronic
964674039 3:159257814-159257836 CAGGATGGAGACAGTGGGTTTGG - Intronic
966155270 3:176909621-176909643 TGGGATGGAGATATGGATCTGGG - Intergenic
966542804 3:181110583-181110605 AAGGAGGGAGGCATTGTTCTTGG + Intergenic
970651849 4:18187424-18187446 GAGGATGAAGACATTGATGCAGG + Intergenic
976606922 4:86992274-86992296 AAGGATGGTGACATTGTACTTGG + Intronic
977741631 4:100491228-100491250 CAGAATAGAGACATTAGTCTAGG - Intronic
980196565 4:129596320-129596342 CAGAGTGGAGAAATTGATCATGG - Intergenic
983476749 4:168221234-168221256 CAGGATGAAGAAATTGACTTGGG - Intronic
983991448 4:174124987-174125009 TAGGATGGAGACACAGATTTAGG - Intergenic
984858330 4:184215027-184215049 CTGGATGCAGACATAGAACTAGG - Intronic
984954227 4:185029931-185029953 CAGGAGAGAGAGACTGATCTTGG - Intergenic
988114799 5:26872362-26872384 GAGGATGGTGGCATTGAGCTGGG - Intergenic
988970169 5:36458932-36458954 CAGGAAGGAGACATTGACAGAGG + Intergenic
989028285 5:37090899-37090921 TAGGATGTGTACATTGATCTAGG - Intergenic
989664451 5:43837555-43837577 GAAGATGTAGAAATTGATCTTGG + Intergenic
992150778 5:73900679-73900701 CAGGAGGGAGACATCTTTCTAGG - Intronic
992331853 5:75725189-75725211 CAAGATGGAGACTATGACCTGGG - Intergenic
995232731 5:109787620-109787642 TAGGATGCAGACATTGATCCTGG + Intronic
996355455 5:122591624-122591646 CAGGAAGTAGACATTGACCATGG - Intergenic
996416538 5:123216855-123216877 CATGATGGAGCCAGCGATCTAGG + Intergenic
997161027 5:131609392-131609414 CAGGATGGAGACATGGGAATGGG + Intronic
1002308391 5:178297725-178297747 CAGCAAGGAGACAATGAACTGGG - Intronic
1003652678 6:7975834-7975856 CAGGATGGAAACCCTGCTCTGGG + Intronic
1004685401 6:17938404-17938426 GAGGGTGGAGACATTGCTCCTGG + Intronic
1004790113 6:19016253-19016275 AAGGAAGAAGATATTGATCTGGG + Intergenic
1008161599 6:48083471-48083493 TAGGATGTAGACATATATCTAGG - Intergenic
1008951564 6:57165913-57165935 CAGGATGGGGAAGTTGCTCTGGG + Intronic
1011047425 6:83100764-83100786 CTGGATGTAGACATTGAGCTAGG - Exonic
1012593064 6:101006320-101006342 GAAGATGGAGACAGAGATCTGGG + Intergenic
1014888761 6:126816005-126816027 CAGGATAAAGATATTAATCTTGG + Intergenic
1015331269 6:131981928-131981950 CAGGACAGAGACACAGATCTAGG - Intergenic
1015351091 6:132220718-132220740 GAGGATTGAGAAATAGATCTGGG + Intergenic
1018135724 6:160777102-160777124 CAGGTTGAAGACATGGATATGGG + Intergenic
1018265111 6:162016027-162016049 CCAGATGGAGACCTTCATCTTGG - Intronic
1018463688 6:164022882-164022904 CAGGATTGGGAGATGGATCTTGG - Intergenic
1019151969 6:170012513-170012535 CATGATGTGGACATTGGTCTAGG - Intergenic
1022681257 7:32548423-32548445 CAGGCTTGAGCCATTGCTCTTGG + Intronic
1023665944 7:42523593-42523615 GGGGATGGAGACAGTGATATAGG - Intergenic
1025535954 7:61948086-61948108 CAGGTTGGAAACATTGTTTTTGG + Intergenic
1025590308 7:62851224-62851246 CAGGTTGGAAACATTGTTGTTGG + Intergenic
1028715999 7:93969510-93969532 CAGGAAGGAGACATAGATGCTGG + Intronic
1028764954 7:94543901-94543923 CATGATGAAGACAGTGATGTAGG + Intronic
1029475555 7:100781689-100781711 CAGGCTGGAGTCTATGATCTCGG + Intronic
1037654083 8:20867955-20867977 CAGGATCGAGACATGGTTCTAGG - Intergenic
1038541455 8:28393563-28393585 GAGGAAGGAGACACAGATCTGGG - Intronic
1038768278 8:30451063-30451085 CAGGATGGAAACATTTCTTTTGG - Intronic
1039496786 8:37986365-37986387 CAGGCTGGAGACATTTGTGTAGG - Intergenic
1039669106 8:39576574-39576596 GAGGATGTAGAGATTGGTCTAGG - Intergenic
1044421440 8:92000253-92000275 CAGGCTGGAGTGACTGATCTGGG - Intronic
1045403131 8:101838518-101838540 CAGGATGGAAACACTTAACTGGG - Intronic
1045886143 8:107100004-107100026 AAGGATGGAGAAATGGAACTTGG + Intergenic
1046897418 8:119487854-119487876 CAGGAAGGAGATATAGATCTGGG - Intergenic
1047297436 8:123583598-123583620 GAGGATAGAAACATTGAGCTAGG + Intergenic
1048434570 8:134403877-134403899 CAGGATTAAGACATCGTTCTGGG - Intergenic
1048639594 8:136338833-136338855 CAGGATTAAGAATTTGATCTGGG - Intergenic
1049241666 8:141540481-141540503 CAGGAGGGACACCTTGATCTGGG - Intergenic
1049371132 8:142267973-142267995 CAGGAAGGAGACTGTGGTCTTGG - Intronic
1055660798 9:78502129-78502151 CAGGTTGGAGAAATGGATCACGG + Intergenic
1057426145 9:94951335-94951357 CAAGATGGGGACCTGGATCTTGG + Intronic
1058569919 9:106330310-106330332 CAGGATTTAGACATTTTTCTAGG - Intergenic
1058924541 9:109649745-109649767 GGGGATGGAGACAGTGATTTGGG + Intronic
1059464420 9:114458713-114458735 CATGATGCAGACACAGATCTAGG - Intronic
1060022658 9:120145759-120145781 GGGAATGGAGAAATTGATCTAGG + Intergenic
1060568686 9:124617703-124617725 CAGGATGCAGACATTAAGCCTGG + Intronic
1060718591 9:125958138-125958160 CAGGATGGAGACAGATATTTGGG - Intronic
1061388459 9:130303945-130303967 CAGGATGGCGCCATCGAGCTGGG + Intronic
1062310620 9:135934122-135934144 CAGCATGGAGCCATCGATCCTGG - Intronic
1186309898 X:8306531-8306553 CTGGATGAAGAGATTAATCTTGG - Intergenic
1186364195 X:8874363-8874385 TAGGATGGAGACATTGCTTTTGG + Intergenic
1187355507 X:18566720-18566742 CTGAATGGAGACATGGAACTTGG + Intronic
1187904758 X:24055149-24055171 CAGGAGGGAGACCTGGAACTGGG + Intronic
1189143742 X:38634951-38634973 AAGCATGAAGACATTTATCTAGG + Intronic
1189577788 X:42373770-42373792 CAGGATGGAGATTTTTATCAGGG + Intergenic
1192436303 X:71145589-71145611 CAGGATGGAGATCTTGGCCTTGG + Intronic
1195446193 X:104955701-104955723 AAGGATGAAGACATTGTACTGGG - Intronic
1199184235 X:144896394-144896416 CAGGCTGGAGATATTAATTTAGG + Intergenic