ID: 1086149633

View in Genome Browser
Species Human (GRCh38)
Location 11:83594257-83594279
Sequence CTCAGTACTCACAATGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086149633_1086149636 17 Left 1086149633 11:83594257-83594279 CCTCCATCATTGTGAGTACTGAG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1086149636 11:83594297-83594319 GCCCTTCCTCAAGCCCTGATTGG 0: 1
1: 0
2: 1
3: 10
4: 138
1086149633_1086149640 29 Left 1086149633 11:83594257-83594279 CCTCCATCATTGTGAGTACTGAG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1086149640 11:83594309-83594331 GCCCTGATTGGTATGTACTGTGG 0: 1
1: 0
2: 0
3: 8
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086149633 Original CRISPR CTCAGTACTCACAATGATGG AGG (reversed) Intronic
904425452 1:30419858-30419880 CTCATTGCTGACAATGATGAGGG + Intergenic
905769454 1:40628058-40628080 CTAAGTATTAACAATCATGGTGG - Intronic
906187928 1:43875682-43875704 CTCAGGAAACACAATCATGGCGG - Intronic
907076262 1:51581880-51581902 TTCAAAAATCACAATGATGGGGG - Intronic
909131180 1:71739009-71739031 CTCAGTATTAACCATCATGGTGG - Intronic
909259799 1:73472880-73472902 CTCAGAAAACACAATCATGGCGG + Intergenic
910746623 1:90581782-90581804 CTCAGTACTGAAAATGATAAAGG - Intergenic
915324203 1:155072251-155072273 CTCAGTACTGACATTCCTGGTGG - Intergenic
915675422 1:157525639-157525661 TGCAGTAGTCAAAATGATGGTGG + Intronic
916672976 1:167041028-167041050 CTCAGTAGTCATATTGTTGGTGG - Intergenic
917154478 1:171981959-171981981 CTGACTACTCACATTGATGCTGG + Intronic
923410004 1:233698715-233698737 CTCAGGAAACACAATCATGGTGG + Intergenic
924183595 1:241464092-241464114 CTCATTGCTCACAGTGCTGGAGG - Intergenic
924322610 1:242864980-242865002 CTCAGAACCCTCAAGGATGGAGG + Intergenic
1062815440 10:496455-496477 CTCAGCACTCACATTGTTTGGGG - Intronic
1062815466 10:496696-496718 CTCAGCACTCACATTGTTTGGGG - Intronic
1063202161 10:3794373-3794395 CTCATTACTCACAATGGAGGTGG - Intergenic
1064627955 10:17280880-17280902 CTCAGGAAACACAATCATGGTGG + Intergenic
1069720561 10:70547149-70547171 CTCAGTTCTCAGACTGAGGGAGG - Intronic
1071197492 10:83178025-83178047 CTCAGGAAACACAATCATGGAGG + Intergenic
1071872033 10:89806467-89806489 CTCAGTACTCACAAGGTTCCAGG - Intergenic
1072641825 10:97216730-97216752 CTCAGGAAACACAATTATGGTGG - Intronic
1073244098 10:102077329-102077351 CTGCGTATTCACAATGATGGGGG + Intergenic
1078707519 11:13759368-13759390 CCCAGTACTAATAATCATGGTGG - Intergenic
1079884628 11:25971786-25971808 CTAAGTACTTACTATGATGGGGG + Intergenic
1082760228 11:57120227-57120249 CTTATTTCTCACAATTATGGAGG - Intergenic
1082827260 11:57589109-57589131 CTCAGTTCTCTCAATCATTGAGG - Intergenic
1083621460 11:64051408-64051430 CTCAGTGGTGACAGTGATGGCGG + Intronic
1083631932 11:64100102-64100124 CTCAGTCCACACAATGAAAGTGG + Intronic
1084786881 11:71447917-71447939 CTCAGCACTGACAAAGAGGGAGG + Intronic
1086149633 11:83594257-83594279 CTCAGTACTCACAATGATGGAGG - Intronic
1089071400 11:115702109-115702131 CTCAGTAGTCATAGTGATGGTGG + Intergenic
1091619940 12:2079372-2079394 CTCATTTCTCACAATTCTGGAGG + Intronic
1098161699 12:67651541-67651563 CTCAGTACTCCTCATAATGGAGG + Intronic
1100097519 12:91059879-91059901 CTCAGGAGTTACCATGATGGAGG - Intergenic
1100372304 12:93979573-93979595 CTCAGTAATCAGAAAAATGGAGG - Intergenic
1101795454 12:107968974-107968996 AGCAGAACTCACATTGATGGAGG + Intergenic
1104666707 12:130652778-130652800 CACAGAACTTACAATTATGGTGG + Intronic
1107678084 13:42817813-42817835 GGCAGGACTCACAATCATGGTGG + Intergenic
1109804839 13:67425644-67425666 CTCAGGAAACACAATCATGGTGG + Intergenic
1109891816 13:68623841-68623863 CTTATTACTCACAATTTTGGAGG - Intergenic
1113975714 13:114225812-114225834 CTCAGGGCTCAGAATGAAGGAGG - Intergenic
1114780576 14:25534008-25534030 CTCAGGAAACACAATCATGGTGG + Intergenic
1115505140 14:34086616-34086638 CTCAGGAAACACAATCATGGAGG + Intronic
1115521596 14:34238365-34238387 CACAGTCTTCACAATGGTGGTGG - Intronic
1119588241 14:75858969-75858991 TTCAATTGTCACAATGATGGGGG - Intronic
1121982840 14:98469590-98469612 CTCAATCCTCACAATAATGGAGG + Intergenic
1122589608 14:102838239-102838261 CTCAGCACTTACAATGGTGCTGG - Intronic
1122821843 14:104350718-104350740 CTCAGTACAAACAATGATCTCGG - Intergenic
1123140417 14:106072207-106072229 ATCAGGACGAACAATGATGGTGG - Intergenic
1129783106 15:78287698-78287720 GTCAGGACTAAAAATGATGGGGG + Intronic
1132239233 15:100244859-100244881 CTCAGGACTCACAGTGACAGAGG + Intronic
1134832669 16:17336381-17336403 TTCAGAACTCACCATCATGGAGG - Intronic
1135009810 16:18865335-18865357 CTCAGTATCCACAAAGATGAAGG + Intronic
1135930281 16:26730481-26730503 CCCAGAACACACAATGAAGGAGG - Intergenic
1136642521 16:31578769-31578791 CACAATACTTACAATCATGGTGG - Intergenic
1136995948 16:35188106-35188128 CTCAGTGCTGAGAATGTTGGGGG + Intergenic
1139888438 16:70228449-70228471 CTCAGTATCCACAAAGATGAAGG + Intergenic
1141313702 16:82939929-82939951 CACAGCCCTCACAATCATGGTGG + Intronic
1144554020 17:16265936-16265958 CTCAGTACTAACCATGAGGAAGG + Intronic
1144721700 17:17475682-17475704 CTCTGTACTGCCCATGATGGTGG + Intergenic
1147428941 17:40359862-40359884 CTTTGTTTTCACAATGATGGGGG - Intergenic
1147914302 17:43877498-43877520 CTCTGTACTGACCATTATGGAGG + Intronic
1153389101 18:4534320-4534342 CCCAGCAGTCACAGTGATGGTGG - Intergenic
1154296075 18:13149959-13149981 CACAAAACTTACAATGATGGGGG + Intergenic
1155100466 18:22605536-22605558 CTCACAAATCCCAATGATGGAGG + Intergenic
1156362445 18:36395119-36395141 CTCAGTAGTTATATTGATGGTGG - Intronic
1159177241 18:64853680-64853702 CTCAAAAAGCACAATGATGGGGG - Intergenic
1159282778 18:66309497-66309519 GGCAGGCCTCACAATGATGGTGG + Intergenic
1159718405 18:71853837-71853859 CACAGTACTCAGGATGATGGGGG - Intergenic
1160566741 18:79790641-79790663 CTCAGCACCCACAACGGTGGTGG - Intergenic
1164532143 19:29056856-29056878 CTCAGAGCTCACAGTGTTGGGGG - Intergenic
1165410542 19:35658090-35658112 CTCAGTATAAACAATGATGGAGG - Intronic
1165652095 19:37500488-37500510 TTTGGTTCTCACAATGATGGGGG - Intergenic
1165939707 19:39408884-39408906 CTCAGTATTCATGATGGTGGGGG + Exonic
925127838 2:1474042-1474064 CTAAGTACCAACAATGATAGCGG + Intronic
925242781 2:2347171-2347193 CTCCGTAATCATATTGATGGTGG - Intergenic
925246739 2:2390215-2390237 CTCAGGAAACACAGTGATGGTGG + Intergenic
926626997 2:15099611-15099633 CTCAATACTCACAATGACCCTGG + Intergenic
927098777 2:19770638-19770660 CTCAGGAAACACAATCATGGTGG + Intergenic
928899390 2:36301180-36301202 CTCAGGAAACACAATCATGGTGG + Intergenic
930941985 2:57024858-57024880 GTGAGTCCTCACAATCATGGCGG + Intergenic
931216426 2:60249055-60249077 CTAACTACTCACAAGGCTGGTGG + Intergenic
933949619 2:87317370-87317392 CTCAGGAAACACAATTATGGTGG + Intergenic
936251125 2:110869221-110869243 CTGAGTATTCACAATGCCGGTGG - Intronic
936330574 2:111544227-111544249 CTCAGGAAACACAATTATGGTGG - Intergenic
936663683 2:114570486-114570508 CACAGTAGGCAGAATGATGGGGG + Intronic
938992746 2:136646045-136646067 CTCAATAATGAAAATGATGGAGG + Intergenic
942240378 2:173958950-173958972 CTTAGCACTCACAATGATCTTGG - Intronic
945333076 2:208561680-208561702 CTCAGTATTAACCATCATGGGGG + Intronic
947995396 2:234523116-234523138 CTCAGGAAACACAATAATGGCGG - Intergenic
1170585543 20:17731498-17731520 CTCAGTACTCACCATAATGCTGG - Intronic
1174443973 20:50578090-50578112 CTCACGAGTCACAATGATGCTGG - Intronic
1174541461 20:51292987-51293009 CTCAGGAAACACAATCATGGCGG + Intergenic
1182991247 22:34769963-34769985 CTGAGAACTAACAATGAGGGAGG + Intergenic
1184122664 22:42462661-42462683 CTCAGTACACACAAGGAAAGGGG + Intergenic
1184956412 22:47889772-47889794 CTCAGGAAACACAATTATGGTGG - Intergenic
1185104709 22:48860836-48860858 CTCAGTTCTCACAAAGATTTAGG + Intergenic
1185226677 22:49657442-49657464 CTCAGGAAACACAATCATGGCGG + Intronic
951034849 3:17921632-17921654 CTCAGGAAACACAATCATGGTGG - Intronic
952014938 3:28945309-28945331 CTCAGAAAACAAAATGATGGGGG - Intergenic
954942637 3:54388677-54388699 CTCAGTTCTCACAAAGATCTAGG + Intronic
955450141 3:59057627-59057649 ATCAGTATGGACAATGATGGTGG - Intergenic
957784636 3:84866335-84866357 CTCAGGAAACACAATCATGGTGG - Intergenic
958471813 3:94531085-94531107 CTCAGGACTTACAATAATGGTGG + Intergenic
958590205 3:96148021-96148043 CTCAGTGCTTACAATGCTGCAGG + Intergenic
961152620 3:124652329-124652351 CTGAGTACTCACAAAGCTGAGGG - Intronic
962202070 3:133409177-133409199 TTCAGTAATCACATTGGTGGTGG + Intronic
962948365 3:140194917-140194939 CTCATTACTGCCAGTGATGGTGG + Intronic
963899458 3:150720190-150720212 AGGAGTACTCACAATCATGGCGG + Intergenic
964879144 3:161404335-161404357 CTTACTACTTACAGTGATGGAGG - Intergenic
966960127 3:184927211-184927233 CTTAGTGCCCACAATTATGGTGG - Intronic
967155193 3:186685456-186685478 GGAAGAACTCACAATGATGGTGG + Intergenic
969103496 4:4787691-4787713 CTCAGGAAACACAATCATGGCGG - Intergenic
970356420 4:15258118-15258140 CTCAGTACCCACAATTGTAGAGG + Intergenic
970388918 4:15587574-15587596 ATCAATACTCACTATGATTGTGG - Intronic
971264646 4:25087291-25087313 CACAGCACTCTCTATGATGGTGG - Intergenic
972137243 4:35907676-35907698 CTGAGGTCTCACAATCATGGTGG - Intergenic
972618152 4:40720419-40720441 CTGAGTTCTCTCAATGATGCTGG + Intergenic
977138726 4:93339789-93339811 CTCAGGAAACACAATCATGGTGG + Intronic
981434625 4:144705995-144706017 ATCAGTTGTCACAACGATGGTGG - Intronic
981458530 4:144984665-144984687 CTCAGTAATCAAAATAATTGAGG + Intronic
981985258 4:150846558-150846580 CTCAGAACTCAGAAGGATGAGGG + Intronic
982635596 4:157892710-157892732 ATCATTGCTCACAGTGATGGTGG - Intergenic
987059668 5:14230413-14230435 TGCAGTTGTCACAATGATGGGGG - Intronic
988119455 5:26942114-26942136 CTCAGGAAACACAATCATGGTGG + Intronic
989197162 5:38726884-38726906 CTCAGGAAACACAATCATGGCGG + Intergenic
992286754 5:75243586-75243608 CTCAGCACTGGCAATGATCGGGG + Intergenic
993713662 5:91253019-91253041 CTCAGGAAACACAATCATGGTGG - Intergenic
993773727 5:91964422-91964444 CGGAGTCCTCACAATCATGGTGG - Intergenic
995412014 5:111868864-111868886 TTCCATACTCACAATGAAGGAGG + Intronic
997871504 5:137509552-137509574 CTCACTTCTGACAAAGATGGTGG + Intronic
998317628 5:141198484-141198506 CAAAGTACTCTCAATAATGGAGG - Intergenic
1000878320 5:166667789-166667811 CTCATTATTCACAATGAAGGAGG - Intergenic
1001476346 5:172053872-172053894 CTCAGTGCTCACACTGAGGCAGG + Intronic
1002067478 5:176659266-176659288 CTCTGTACTCAAAATAAGGGCGG + Intergenic
1005150741 6:22747071-22747093 TTAAGAACTCACAATGATGGAGG - Intergenic
1005879776 6:30047260-30047282 CTCAGGAAACACAATAATGGTGG + Intergenic
1010399822 6:75435747-75435769 CTCAGTAGTATCAATGATGACGG - Intronic
1011882782 6:92051653-92051675 CTCAGTTCTCACTATGAACGAGG + Intergenic
1014703800 6:124722022-124722044 CTGAGTAGTCAAAATCATGGAGG - Intronic
1014951357 6:127559231-127559253 CTCAGGAAACACAATCATGGAGG - Intronic
1017883727 6:158581197-158581219 CTCAGTACTTAGGAAGATGGTGG + Intronic
1019650109 7:2152265-2152287 TTCAGTCCTCCCTATGATGGGGG - Intronic
1019878085 7:3833560-3833582 CTCATTAGTCAGAATGATGTAGG + Intronic
1020870571 7:13624005-13624027 CCAATTACTCACAGTGATGGGGG + Intergenic
1023634651 7:42197613-42197635 CTCAGTACAGAGAAGGATGGGGG + Intronic
1025711595 7:63915461-63915483 CTGAGTTCTCACAGTTATGGAGG + Intergenic
1025713922 7:63936570-63936592 CTTAGTTCTCACAGTTATGGAGG - Intergenic
1026112294 7:67468138-67468160 CTCAGCACTCCCACTGATGATGG + Intergenic
1028441899 7:90872627-90872649 CTCAGTACCCAACATGATAGTGG - Intronic
1029975212 7:104827146-104827168 GTCAGTGCTCACATTGATAGTGG - Intronic
1034477640 7:151296021-151296043 CTCAGGAAACACAATCATGGTGG + Intergenic
1038230928 8:25699234-25699256 CTCAGGACTCAATCTGATGGAGG - Intergenic
1041236074 8:55804046-55804068 CTCATTTCTGACAATGATGAGGG + Intronic
1043421180 8:80100632-80100654 CTCATATCTCACAATTATGGAGG + Intronic
1044843966 8:96362018-96362040 CTCAGTGCACACAAGCATGGAGG + Intergenic
1044968777 8:97599516-97599538 CAAAGTTCTCACAAGGATGGAGG + Intergenic
1046050306 8:109013999-109014021 GGAAGTACTCAGAATGATGGAGG + Intergenic
1050593387 9:7182591-7182613 CTGAGGCCTCACAATCATGGTGG - Intergenic
1052429251 9:28345813-28345835 CTCAGTAGTGACAATGAGGAAGG + Intronic
1058653310 9:107197181-107197203 CTCAGGAAACACAATCATGGCGG + Intergenic
1059771353 9:117429469-117429491 ATCATTAGTCACAAAGATGGAGG + Intergenic
1186720898 X:12302454-12302476 CTCAATACTCACAATCTTAGAGG + Intronic
1188024472 X:25194263-25194285 CACAGTACTCTCAAAGAAGGTGG - Intergenic
1188473235 X:30563289-30563311 CTCAGGAAACACAATCATGGTGG - Intronic
1188660722 X:32754847-32754869 CACAGAAGTCACAATGATAGTGG - Intronic
1193233997 X:79084329-79084351 ACCAGTACTCAGAATGATAGGGG - Intergenic
1193876380 X:86867370-86867392 CGGAGGACTCACAATCATGGTGG - Intergenic
1195042727 X:101028932-101028954 CTCAGGACACACTATCATGGTGG - Intronic
1195814538 X:108870382-108870404 CTACGTAATCACAATGATGTTGG + Intergenic