ID: 1086152688

View in Genome Browser
Species Human (GRCh38)
Location 11:83629647-83629669
Sequence GGTATAATAAAGAAAGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 514}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086152688_1086152691 6 Left 1086152688 11:83629647-83629669 CCTTGTTCTTTCTTTATTATACC 0: 1
1: 0
2: 1
3: 44
4: 514
Right 1086152691 11:83629676-83629698 TATCAGCTAGTAGATAAGAAGGG 0: 1
1: 0
2: 0
3: 12
4: 138
1086152688_1086152690 5 Left 1086152688 11:83629647-83629669 CCTTGTTCTTTCTTTATTATACC 0: 1
1: 0
2: 1
3: 44
4: 514
Right 1086152690 11:83629675-83629697 TTATCAGCTAGTAGATAAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 135
1086152688_1086152692 12 Left 1086152688 11:83629647-83629669 CCTTGTTCTTTCTTTATTATACC 0: 1
1: 0
2: 1
3: 44
4: 514
Right 1086152692 11:83629682-83629704 CTAGTAGATAAGAAGGGAAAAGG 0: 1
1: 0
2: 0
3: 23
4: 351
1086152688_1086152694 28 Left 1086152688 11:83629647-83629669 CCTTGTTCTTTCTTTATTATACC 0: 1
1: 0
2: 1
3: 44
4: 514
Right 1086152694 11:83629698-83629720 GAAAAGGATATTTTAGAGTAGGG 0: 1
1: 0
2: 2
3: 26
4: 373
1086152688_1086152693 27 Left 1086152688 11:83629647-83629669 CCTTGTTCTTTCTTTATTATACC 0: 1
1: 0
2: 1
3: 44
4: 514
Right 1086152693 11:83629697-83629719 GGAAAAGGATATTTTAGAGTAGG 0: 1
1: 0
2: 2
3: 31
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086152688 Original CRISPR GGTATAATAAAGAAAGAACA AGG (reversed) Intronic
901437718 1:9258289-9258311 GGTATAACAACGTAACAACACGG - Intronic
902714704 1:18264619-18264641 GGTATGTTAAGGAAATAACAAGG - Intronic
902959583 1:19953499-19953521 TGTATAACAAGAAAAGAACATGG - Intergenic
905427840 1:37898281-37898303 GGTCAAATAAATGAAGAACAGGG + Intronic
905979916 1:42215512-42215534 GGAAGAATAAAGAGAGAAAAGGG + Intronic
906262998 1:44407284-44407306 GGAAAAATAAAGAAAAAAAAGGG + Intronic
908503521 1:64770703-64770725 GTTATAGTAAAGATTGAACATGG + Intronic
909273414 1:73653665-73653687 GGTAGAAAAAAAAAAAAACATGG - Intergenic
909301472 1:74018012-74018034 GCTATGGCAAAGAAAGAACATGG - Intergenic
909730119 1:78879336-78879358 GGTATAAGAAAGCAAGAGGAAGG - Intergenic
909779074 1:79520156-79520178 GGTAGAAGAAAAAAAGAAGAAGG + Intergenic
909953771 1:81752429-81752451 ATTATAATAATGAAAGAAAAAGG + Intronic
910040302 1:82843512-82843534 GGTGTAATACAGAAATAAGATGG - Intergenic
910700160 1:90064626-90064648 AGTATAATAAAAAAAGAGAAAGG + Intergenic
911073293 1:93848798-93848820 TGTACAATAATAAAAGAACAAGG - Intergenic
911269891 1:95788417-95788439 AGTATAATAAAAAAAAAAAAAGG - Intergenic
911553942 1:99319237-99319259 GGTATACTCTAGAAAGATCAAGG - Intergenic
911586938 1:99702306-99702328 GATATAATACAAAAAGTACAGGG - Intergenic
911631859 1:100192495-100192517 GGTTTAAGAAAGAAATGACAGGG - Exonic
911809573 1:102258223-102258245 AATAAAATAAAGAAAAAACATGG + Intergenic
912302133 1:108529269-108529291 GTTACAATAAAGAAAGAATTTGG + Intergenic
912679117 1:111717536-111717558 AGTATAATAGAGAGGGAACAAGG + Intronic
913460347 1:119079570-119079592 GGTATAAAAAAGACTTAACATGG - Intronic
913472069 1:119198135-119198157 GGGTTAATAAAGAAATAAAAAGG + Intergenic
913596258 1:120380292-120380314 GGTAAGATATAGAATGAACAAGG - Intergenic
914091015 1:144498683-144498705 GGTAAGATATAGAATGAACAAGG + Intergenic
914307586 1:146435522-146435544 GGTAAGATATAGAATGAACAAGG - Intergenic
914424702 1:147564813-147564835 GGTATAAAGATAAAAGAACAAGG - Intronic
914594522 1:149137616-149137638 GGTAAGATATAGAATGAACAAGG + Intergenic
914771876 1:150694331-150694353 CGTTTATTAAAGTAAGAACAAGG - Intronic
914829396 1:151159609-151159631 GGGATACTAAAGACAGAAGAGGG + Exonic
917171808 1:172184890-172184912 GGTGTGCAAAAGAAAGAACATGG - Intronic
917515885 1:175707899-175707921 TGTTTTATAAAGAAAAAACAGGG + Intronic
917807638 1:178628102-178628124 GAAAGAAAAAAGAAAGAACAAGG + Intergenic
918592337 1:186253986-186254008 GGTATTTTAAAGAAAGAATGAGG - Intergenic
918809300 1:189094541-189094563 GGTACAACAAGGCAAGAACATGG + Intergenic
919125209 1:193384798-193384820 AGTATAATAAAAAAAAAAAAAGG - Intergenic
919177675 1:194038818-194038840 GGTAGAATACAGAAAGTACAGGG + Intergenic
919414400 1:197289196-197289218 GATATAATTAAGAAAGAAAATGG - Intronic
919523544 1:198619449-198619471 GCTGTAAAAAAGAAAGACCAAGG - Intergenic
920797343 1:209152627-209152649 GCTATCATAAAGCAAGAAGAGGG - Intergenic
921186385 1:212673290-212673312 TGTATAATAGAAAAAGAACTGGG + Intergenic
921389137 1:214602029-214602051 GGTAGAAGATAGTAAGAACAAGG + Intergenic
921540836 1:216413235-216413257 GATATATTAAAGAAATAATATGG + Intronic
921698703 1:218243241-218243263 GTAATAATAAAAAAAGTACATGG + Intergenic
921864854 1:220077862-220077884 GCTATAATAAAGAAAGATTTAGG + Intronic
922026170 1:221751240-221751262 GGGATAGAAAAGAAAGAATAGGG + Intergenic
922166660 1:223121246-223121268 GATATAAAAAAGAAATAAAAGGG - Intronic
922385470 1:225076793-225076815 AGTATAATAAAAAAAAAAGAAGG - Intronic
922501979 1:226103948-226103970 GGTATAAAAGAGAAAAAATATGG - Intergenic
922870173 1:228896297-228896319 GCTATCATAAAGAAATACCACGG - Intergenic
922952606 1:229571625-229571647 GGAAAAAAAAAGAAAGCACAAGG + Intergenic
923444526 1:234056215-234056237 TTTATAAAAAAGAAAGAAAAAGG - Intronic
923805498 1:237252848-237252870 TTTATAATAAATAAAGAATATGG - Intronic
923867728 1:237957898-237957920 GGTATAAGAAAAAAGGAAGAAGG + Intergenic
924393087 1:243584909-243584931 GGTAAAAGAAAGAAATAAAAAGG + Intronic
924427492 1:243966205-243966227 AGTATAAAAAAGGAAGAAAAGGG - Intergenic
1062820901 10:533924-533946 GGTATAATAATGAAATCACATGG + Intronic
1063461903 10:6220417-6220439 GGGAGAAAAAAGAAAGAAAATGG - Intronic
1063475590 10:6326100-6326122 TGTGAAATAAAGAATGAACATGG + Intergenic
1063544995 10:6972257-6972279 GTTAAAAGAAATAAAGAACAGGG - Intergenic
1064425637 10:15226807-15226829 GTTATAAGGAAGAAAGAAAAGGG - Intronic
1064814037 10:19235921-19235943 GGGACAATAAAGAAAGAAATTGG + Intronic
1066252483 10:33648124-33648146 GGAATAATAGAGGAGGAACAGGG - Intergenic
1068071252 10:52199083-52199105 GGAAAAAAAAAGAAAGAGCAAGG - Intronic
1068823272 10:61402944-61402966 GGTATAAGAAAAAAGAAACAAGG + Intergenic
1068866687 10:61902433-61902455 AAAATAATAAAGAAAGAAGAGGG - Intronic
1068873461 10:61971017-61971039 AGAATAAAAAAGAAAGAAAAGGG + Intronic
1069122097 10:64579267-64579289 AGTATAATAAAAAAAAATCATGG + Intergenic
1069201411 10:65621659-65621681 TGTATGATGAAGAAACAACACGG + Intergenic
1071139803 10:82495238-82495260 GCTATGATTAAGAAAGAGCAGGG - Intronic
1071868656 10:89767106-89767128 GCTATAATAAACTAAGTACATGG + Intronic
1072557576 10:96533508-96533530 GTTATAATAATGAAAGACAATGG - Intronic
1073054849 10:100692884-100692906 GATAAAATAAGGAAAGAGCATGG + Intergenic
1073733235 10:106316089-106316111 GAAATAAGAAAGAAAGAAAATGG + Intergenic
1073870167 10:107854263-107854285 GAGAGAATAAAGACAGAACAGGG - Intergenic
1073913207 10:108371345-108371367 AGTATAATAAAAAAAAAAGAGGG - Intergenic
1074478801 10:113799186-113799208 GGTATAATTCAGAAAGAAGTAGG - Intergenic
1074849046 10:117424172-117424194 ATTATAAGAAAGAAAGAAAAGGG - Intergenic
1075352422 10:121735607-121735629 GGTATAATGGAGAAATAAAACGG - Intergenic
1075821564 10:125317343-125317365 AGTATAATAAAAAAATAAAAAGG + Intergenic
1075919875 10:126201755-126201777 GGTGAAATGAAGAAAGAAAAAGG + Intronic
1076171204 10:128321550-128321572 TGTATTATAAAAAAAGATCATGG + Intergenic
1078176471 11:8975195-8975217 GGTACTAGAAAGAAAGAATAAGG + Intergenic
1079691411 11:23422592-23422614 GGAATAATCGAGAGAGAACAGGG + Intergenic
1079754718 11:24242452-24242474 AGTATCATTAAAAAAGAACATGG + Intergenic
1080217437 11:29861204-29861226 GGTATAAAAAATGAAGACCAAGG - Intergenic
1080237745 11:30091741-30091763 GGTACAGTAAAGAAAGATCTGGG + Intergenic
1080740445 11:35059044-35059066 AGTATAATAAAAAAAAAAGAGGG + Intergenic
1081378182 11:42384601-42384623 AGGATAATAAAGAAAAAACAAGG + Intergenic
1082099668 11:48162165-48162187 TGTATAATTAAAAAATAACATGG - Intronic
1083011926 11:59409822-59409844 GGTTTTATAAAGTAGGAACAAGG - Intergenic
1084999685 11:73020428-73020450 GGTATAGTATATAAAGAATATGG - Intronic
1085133883 11:74067171-74067193 GAAATAATAAAGAAAGAAACTGG + Intronic
1085138652 11:74119401-74119423 TGTAAAATAAAGAGAGAAGATGG + Intronic
1086046935 11:82543881-82543903 AGTTCAACAAAGAAAGAACAGGG + Intergenic
1086152688 11:83629647-83629669 GGTATAATAAAGAAAGAACAAGG - Intronic
1087029379 11:93686843-93686865 GTTATAATTCACAAAGAACAAGG - Intronic
1087685468 11:101258195-101258217 GGTAGATGAAAGGAAGAACAGGG - Intergenic
1088004047 11:104919441-104919463 GGTTTATTAAAGAAAAAAAATGG + Intergenic
1088060905 11:105648592-105648614 GGAAAAAAAAAGAAAGAACTAGG + Intronic
1088130445 11:106482914-106482936 GTTATAATAAACAAATAAGAAGG - Intergenic
1088404294 11:109455803-109455825 TGTAGAAGGAAGAAAGAACATGG + Intergenic
1088407129 11:109494420-109494442 AGTATAATAAAAAAAAAAGAAGG - Intergenic
1088441738 11:109878367-109878389 AGTATAATAAAAAAAAAAGAAGG - Intergenic
1089059650 11:115616288-115616310 TGTTTAAAAAAGAAAGAAAAAGG + Intergenic
1090083294 11:123628833-123628855 GGTAACATAAAAGAAGAACATGG - Intergenic
1091211046 11:133861422-133861444 AATATAATAAATAAAGAACGAGG - Intergenic
1093267296 12:17018240-17018262 TGTATAAAAATGACAGAACATGG - Intergenic
1093669149 12:21851762-21851784 GGTATAAATAAGAAAAAATAAGG + Intronic
1093898518 12:24603909-24603931 GGTATAATAAAATAAGAAATAGG - Intergenic
1094616945 12:32044446-32044468 GTTTTAAGAAACAAAGAACAGGG + Intergenic
1094825070 12:34263608-34263630 GGATTAAAAAAGAAAGAAAAAGG - Intergenic
1095221082 12:39616309-39616331 GGAATAACAAAGAAAGATAAGGG - Intronic
1095696885 12:45153994-45154016 GGTATGAAAAAGGAAGCACAGGG + Intergenic
1098094528 12:66940552-66940574 TGTATTAAAATGAAAGAACATGG + Intergenic
1098577369 12:72058388-72058410 GGAATAATAATGAATGACCATGG - Intronic
1098816570 12:75172520-75172542 GCTATAAGAATGAAAGTACAGGG - Intronic
1098890362 12:76004251-76004273 GGTGTACTAAAGAAAAAACAAGG - Intergenic
1098957079 12:76698652-76698674 GGTATAATGAAGAAAAATAAAGG - Intergenic
1100065807 12:90642341-90642363 TGTATAATAAAGAAATAAAGAGG + Intergenic
1100122791 12:91388376-91388398 GGTATAAGAAAGAAAAGAAATGG - Intergenic
1100291434 12:93218420-93218442 GAGAAAATAAAGAAACAACATGG + Intergenic
1100921953 12:99498314-99498336 GGTAGAATGCATAAAGAACAAGG - Intronic
1101079620 12:101169913-101169935 GAGATGATAAAGAAAGTACAAGG + Intronic
1101641716 12:106590112-106590134 GGAGTAATAAAGACAGAGCATGG + Intronic
1103103590 12:118203078-118203100 GTTATAATAAGAATAGAACAAGG - Intronic
1103502494 12:121413998-121414020 TGTATTATAAAGAAAGGAGAAGG - Intronic
1105398753 13:20068611-20068633 GGTATAATAAAAGAAGAGGAGGG - Intronic
1106565125 13:30878025-30878047 TGTATAGTAAAGAAAAAACCTGG - Intergenic
1108136585 13:47369499-47369521 AGAATGAAAAAGAAAGAACAAGG + Intergenic
1108546677 13:51502123-51502145 GGTAGAAAAAAGAGAGAAGAAGG - Intergenic
1108619257 13:52165212-52165234 AGTATGATAAACAAAGAAAATGG + Intergenic
1108833032 13:54502655-54502677 GTTATAAGAAACAAAGAAGAAGG - Intergenic
1109490740 13:63096861-63096883 GTAATAATAAAGCAAGCACAAGG - Intergenic
1109529162 13:63618283-63618305 GTTATAATACACTAAGAACAAGG + Intergenic
1110411844 13:75212972-75212994 TGAATAACAAATAAAGAACAAGG - Intergenic
1110708412 13:78622639-78622661 GATATAATTAAGAAAGGAAAGGG - Intronic
1111087568 13:83396029-83396051 GGTCTGATAATGAAAAAACAAGG + Intergenic
1112260615 13:97874788-97874810 GGTAAAATAAATAAACAATAGGG + Intergenic
1112701231 13:102011325-102011347 GGTATAATCAAGTAAGAAAAGGG - Intronic
1112958704 13:105093906-105093928 AGATTAATAAAGAAAGAAAAAGG - Intergenic
1113275864 13:108729055-108729077 GGTATATTAAGGAAAGACAAAGG + Intronic
1114728170 14:24961485-24961507 GCTATAGAAAAGAATGAACATGG + Intronic
1115452058 14:33559140-33559162 GAAAGAATAAAGAAAGAAAAAGG - Intronic
1115478733 14:33841157-33841179 GGTAGAATAAGAAAAGAAGAGGG - Intergenic
1115908675 14:38231024-38231046 GCTATGATAAAGATAAAACAAGG + Intergenic
1116874166 14:50094816-50094838 AGTATAAAAAAAAAAGAAAATGG - Intergenic
1117499121 14:56334632-56334654 AGTAAAATAAAGGCAGAACAAGG - Intergenic
1118256951 14:64213766-64213788 AGGATAAGAAAGAAAGAACCTGG + Intronic
1118371507 14:65141226-65141248 TAAATAATAAAAAAAGAACATGG - Intergenic
1118802331 14:69201980-69202002 GGTATTATTAAGAGAAAACATGG - Intronic
1119148986 14:72341036-72341058 GGAATAAAAAATATAGAACATGG + Intronic
1120331681 14:83101206-83101228 GGAATATTTAAGAAAGAGCAAGG - Intergenic
1120419855 14:84270192-84270214 GGGATGCTAAAGAAAAAACATGG + Intergenic
1122116303 14:99529017-99529039 AGGAAAATAAAAAAAGAACAAGG + Intronic
1122607093 14:102953987-102954009 GGTATCATTAAGAAAACACAGGG + Intronic
1123189818 14:106558240-106558262 GGTAGAAGAAAGAAAGGAAAAGG - Intergenic
1123480317 15:20625100-20625122 GGTATAATTAATAAACAACTGGG - Intergenic
1123482115 15:20641632-20641654 GGTATAATTAATAAACAACTGGG - Intergenic
1123635901 15:22358736-22358758 GGTATAATTAATAAACAACTGGG + Intergenic
1123637690 15:22375265-22375287 GGTATAATTAATAAACAACTGGG + Intergenic
1123796093 15:23771968-23771990 TTTTTAATAAAGAAAGCACAAGG - Intergenic
1124163668 15:27298685-27298707 GGTATAATTAAGAAAAATAAAGG - Intronic
1124472374 15:29999925-29999947 GTAATAATAAAGAAATAACGTGG + Intergenic
1125287039 15:38105003-38105025 GGAAGAATAAAGAAAAAAAAAGG - Intergenic
1126097394 15:45099312-45099334 GGTATAATAGAAAAAGAAATAGG - Intronic
1126664830 15:51066936-51066958 AGAATTCTAAAGAAAGAACATGG + Intronic
1127341182 15:58045823-58045845 AGTATAATTAAAAAAGAATATGG + Intronic
1127649115 15:60988953-60988975 GGCAGAATAAAGAAAGAAAAGGG + Intronic
1130625869 15:85514015-85514037 GTTATAAGAAAGAAAAAAAAAGG - Intronic
1131222088 15:90593282-90593304 GGTATATTAAAGAAAGAAACTGG - Intronic
1131844238 15:96471787-96471809 GGTCTCATAAAGAAATAAAAAGG - Intergenic
1132199146 15:99936379-99936401 CTTATAATAATGACAGAACAAGG - Intergenic
1133700100 16:8300711-8300733 GGTATATTAAAAAAAAAAAAAGG - Intergenic
1134212610 16:12290328-12290350 GGGTTCATAAAAAAAGAACAGGG - Intronic
1134393534 16:13841608-13841630 AGTATAATAAAAAAAAAAAAAGG - Intergenic
1134879135 16:17729106-17729128 TGTATAAAAAATAAAGAACGTGG + Intergenic
1135882553 16:26272653-26272675 GGTTTAACACAGAAAGAAGAAGG - Intergenic
1137517743 16:49163140-49163162 CTTATTATAAAGAAAGAAAAGGG - Intergenic
1138407568 16:56809823-56809845 GGTCTAAGAAATAAGGAACAGGG - Intronic
1140933908 16:79653258-79653280 GATATAATAAAAAAAAAAAAAGG + Intergenic
1143873885 17:9977348-9977370 GGTAGAATGAAGACAGTACAGGG - Intronic
1143970880 17:10794744-10794766 GGTGTGATAAAGACAGAGCAAGG - Intergenic
1144450488 17:15373647-15373669 GGTCTCATAAAGAAAGAATTAGG - Intergenic
1146449047 17:32957502-32957524 GTTATAAAAAAGAAAAAAAAAGG - Intergenic
1147276683 17:39323747-39323769 AGTATACTAAAGACATAACAAGG - Intronic
1147890769 17:43715115-43715137 GGAAAAAAAAAAAAAGAACATGG - Intergenic
1149307432 17:55362737-55362759 GGAAGAATATAGAAAGAAAAGGG + Intergenic
1149770552 17:59317503-59317525 GGTATAATAAAGAAATGAGTTGG + Intergenic
1150903681 17:69313872-69313894 GGTAAAAGAAAGGAAGAACTTGG - Intronic
1153166353 18:2265972-2265994 AGTATAAGAAAGAAATAAAAGGG - Intergenic
1153173062 18:2338698-2338720 GAGATTCTAAAGAAAGAACATGG + Intergenic
1153276631 18:3374101-3374123 GGAAGAATAAAGAAGGAACCTGG - Intergenic
1154114254 18:11597186-11597208 GGTAAAATAGAAAAAGCACATGG + Intergenic
1155591683 18:27434743-27434765 GGTTTAATGAAGAAAGATCATGG - Intergenic
1156655999 18:39287248-39287270 GCTATAATAATGAAAAAAAAAGG - Intergenic
1156696806 18:39777273-39777295 GGTAGAATAATGAAATAAAAAGG + Intergenic
1157839890 18:50947081-50947103 AATATGTTAAAGAAAGAACATGG + Exonic
1158496572 18:57960356-57960378 GGGATGATGAAGACAGAACAGGG + Intergenic
1158927267 18:62280562-62280584 TGTATATTAAAGTAAGTACAAGG - Intronic
1159030958 18:63231355-63231377 GATGTAATAAAGCAAGAAAAAGG + Intronic
1159278013 18:66246224-66246246 GATATTACAAAGAAAGAACAAGG - Intergenic
1159669899 18:71210486-71210508 TGTATAAGAAAAAAGGAACAAGG - Intergenic
1161200752 19:3013519-3013541 GGTTTAAAAAAAAAAGCACAGGG + Intronic
1161930065 19:7333493-7333515 AGTAGAATAAAGAAAGTAGAGGG + Intergenic
1162215482 19:9130288-9130310 GGTACAGAAAAGAAAGAACTGGG + Intergenic
1162242276 19:9364867-9364889 GGTATAAGTAAGCAAGAAGAGGG + Intronic
1163176265 19:15565963-15565985 TGAAAAATAAAGACAGAACATGG - Intergenic
1164665193 19:30026490-30026512 ATTATACTAAAGAAGGAACAAGG - Intergenic
1165462764 19:35953791-35953813 AGAAAAAAAAAGAAAGAACATGG + Intergenic
1166427723 19:42694393-42694415 GCTATAATTAAAACAGAACATGG - Intronic
1167884766 19:52491858-52491880 GGTAAAACAAACAAAAAACAAGG + Intronic
1167927928 19:52836936-52836958 GGTGACATAAAGAAAGAAAATGG + Intronic
925010037 2:477275-477297 GGTATTTGAAAGGAAGAACAAGG + Intergenic
925518104 2:4707441-4707463 GGGAGAATAAAGAAAGAAATGGG + Intergenic
926429781 2:12774015-12774037 GGTGTGAGAAAGAAAGCACACGG + Intergenic
926471679 2:13267494-13267516 AGTTTGTTAAAGAAAGAACAGGG + Intergenic
926655015 2:15393246-15393268 GGTAAAATAATGAAAAGACAGGG + Intronic
926708854 2:15859124-15859146 GATATAAGAAAGAATGAATAAGG - Intergenic
929268475 2:39945432-39945454 GATATAAAAAAGAAAAAGCATGG - Intergenic
929422085 2:41802300-41802322 GAGACAAAAAAGAAAGAACAAGG - Intergenic
929424443 2:41829862-41829884 GGGATTACAAAGAAAGGACATGG - Intergenic
929718316 2:44336905-44336927 GGTATAAATAAGAAATAACAAGG - Intronic
929921518 2:46175075-46175097 GGAATAAGAAAGGAAAAACAAGG - Intronic
930373417 2:50533636-50533658 GGTTTAAAAAAGTAGGAACACGG - Intronic
931535728 2:63273601-63273623 GGTACAATAAACAAAGTAAAGGG + Intronic
931741322 2:65248009-65248031 GGTATATTAAAGAATAAGCAAGG + Intronic
931898156 2:66756840-66756862 GGTATGATACATAAAGAACTGGG + Intergenic
931924395 2:67055423-67055445 TGTATAAGAAAGAAAGAAAATGG + Intergenic
933281955 2:80341584-80341606 GCTATAATCAAAAAAGAAGATGG + Intronic
933455981 2:82519888-82519910 GGAAGAATAAATAAAGATCAGGG + Intergenic
933476373 2:82797002-82797024 GCTTTAATAAAGAATGAGCAGGG - Intergenic
933875657 2:86619019-86619041 GATACAATAAAGAAAGGCCATGG + Intronic
934622304 2:95821033-95821055 AGTATAATAAAAAAAAAAGATGG - Intergenic
935566482 2:104613954-104613976 AGAAAAATAAAGAAAGAAAAAGG + Intergenic
937170536 2:119861691-119861713 GTTAAAATAAAAAAAGAAAATGG - Intronic
937497136 2:122432627-122432649 TGTAGAACAAAGAAAAAACAGGG + Intergenic
939066721 2:137492270-137492292 GGTATAAGATGGAAAGAAAAAGG - Intronic
939354457 2:141083359-141083381 GGTAAAATGAAGAAGGAACAGGG + Intronic
939383002 2:141460361-141460383 GATATAATTAAAAAATAACAAGG + Intronic
939979912 2:148767616-148767638 TGTCTAATAAACCAAGAACAAGG + Intronic
940504293 2:154533305-154533327 GAAAGCATAAAGAAAGAACAAGG - Intergenic
941257918 2:163257030-163257052 GTTATAAAAGAGAAAGAAAATGG - Intergenic
941613250 2:167687616-167687638 GATATTAAAAATAAAGAACATGG + Intergenic
942490115 2:176481597-176481619 GGTCCAATGAAGAAAGAAAAGGG + Intergenic
942539173 2:176997457-176997479 GGTATACTAAAGACACAACAGGG - Intergenic
942800678 2:179872150-179872172 GGAAGTATAAAGAAAGAAAAAGG - Intergenic
942961855 2:181838948-181838970 GTTGTCATAAATAAAGAACAAGG + Intergenic
943010957 2:182448592-182448614 GATATAATGTGGAAAGAACAGGG - Intronic
944346509 2:198672457-198672479 TGAATAATAAAGGAAGCACAAGG - Intergenic
944658165 2:201897664-201897686 CTAATAAAAAAGAAAGAACAGGG + Intergenic
945384006 2:209175214-209175236 GATAAAATAAAGAAGGAAAATGG + Intergenic
945513178 2:210727900-210727922 ATAATAATAAAAAAAGAACAAGG - Intergenic
945648680 2:212534374-212534396 GGGAAAAGAAAGAAAGAAAAAGG + Intronic
945691341 2:213040664-213040686 GGTATAATAAAGAAAGTAAAAGG + Intronic
945823269 2:214689785-214689807 AGTATAATAAAAAAAAAAAAAGG + Intergenic
945973037 2:216248985-216249007 GCTATAATAAAAAAACAACATGG + Intergenic
946452519 2:219793128-219793150 GAAAGAATAAAGAAAGAAAATGG - Intergenic
946723994 2:222642971-222642993 GAAATAATAAGTAAAGAACAAGG - Exonic
946817064 2:223590005-223590027 GGTATAATGAAAAAAGTACAAGG + Intergenic
946967185 2:225048861-225048883 GGAAAAATAAAGTAAGTACAAGG - Intergenic
947885181 2:233563718-233563740 GGTATAATTTGGAAAGAATAAGG - Intronic
1168867437 20:1099928-1099950 GGTATAATAAAAAAAAAAGAGGG - Intergenic
1169427628 20:5509111-5509133 GGTACAATAAGGAAACAAAATGG + Intergenic
1169761905 20:9104644-9104666 GGTATACTAAAGAAGGAATAGGG - Intronic
1170306721 20:14946507-14946529 AGTAAAAAAAAGAAAGAAAAAGG - Intronic
1170528832 20:17268647-17268669 GGAAAAATAAAGCAAGATCATGG + Intronic
1170854298 20:20036479-20036501 AGTCTACTACAGAAAGAACAAGG + Intronic
1171088397 20:22261149-22261171 GGAGAAATAAAGACAGAACAAGG + Intergenic
1172971809 20:38879111-38879133 GGTAGAATCAGTAAAGAACAGGG + Intronic
1173237321 20:41258499-41258521 TGAATGATAAGGAAAGAACAAGG - Intronic
1173721740 20:45264525-45264547 GACATATTAAAAAAAGAACATGG + Intergenic
1174506096 20:51018507-51018529 AGCATAAGACAGAAAGAACAGGG - Intronic
1176753862 21:10711282-10711304 GGTATAATAATGGAAGAAAACGG - Intergenic
1176875562 21:14123527-14123549 TCTATAATGAAGAAAGAAAAAGG + Intronic
1176915019 21:14615309-14615331 GGAATAAAAAAGAAAAAAAAAGG + Intronic
1177256785 21:18673637-18673659 ATAATGATAAAGAAAGAACATGG - Intergenic
1177815987 21:25977316-25977338 GGTAAAATGAAGAAAGATCAAGG + Intronic
1178083176 21:29086733-29086755 AGATTAATGAAGAAAGAACAGGG - Intronic
1179041357 21:37804952-37804974 GCTATAAAAAGGAATGAACATGG + Intronic
1179915716 21:44476856-44476878 AGGATAATAAGGAAATAACAGGG + Intergenic
1182155792 22:28071726-28071748 AGTATAATAAAAAAAAAAAAAGG + Intronic
1182205865 22:28625737-28625759 CTTAGAAAAAAGAAAGAACAAGG + Intronic
949219554 3:1614724-1614746 GGTATAGAAAAGAAAGAGTAGGG + Intergenic
950227470 3:11247646-11247668 GGTCTAAGAAACAAAGAACAGGG + Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950560664 3:13719789-13719811 GGAATATTAAAGAAATAAAATGG - Intergenic
950602822 3:14049911-14049933 GGTATCAGAAGGAAAGAACTTGG + Intronic
951075790 3:18390706-18390728 AGTAAAATAAAGAATGAAGATGG - Intronic
951682126 3:25305785-25305807 GGTATAAAAAATAAGGAAAAGGG + Intronic
951693592 3:25422539-25422561 GGTTTAATAGTGGAAGAACAGGG + Intronic
952191106 3:31024471-31024493 GGTATATTAAAGAAGAAAAATGG - Intergenic
952441194 3:33331094-33331116 GCTATAATAATGGAAGTACAGGG + Intronic
952441758 3:33337623-33337645 GGCAAAAGAAAGAAAGAAAAGGG + Intronic
952798392 3:37263974-37263996 GGCATAAGAAGGAAATAACAAGG + Intronic
953767615 3:45755972-45755994 CATTTAAAAAAGAAAGAACATGG - Exonic
953977249 3:47391298-47391320 GGTCTAATATGGAAAGAACATGG + Intronic
954910026 3:54096862-54096884 GGAAGAAAAAAGAAAGAAAAAGG - Intergenic
955631410 3:60979423-60979445 GGTTTAATAAAGAGGGAAAAAGG + Intronic
955719280 3:61864553-61864575 CGTTTATTAAAGAAAGATCAAGG - Intronic
955840227 3:63104857-63104879 GATATAATGAAGAAAGTACCTGG + Intergenic
956573182 3:70719876-70719898 TGGCTAATAAAGAAGGAACAGGG - Intergenic
956619972 3:71212056-71212078 TATTTAACAAAGAAAGAACATGG - Intronic
956898840 3:73692792-73692814 GGAATAAGAAGGATAGAACAGGG + Intergenic
957245024 3:77705653-77705675 GGGACAATGAAGAAAGAACAAGG - Intergenic
957797058 3:85022888-85022910 GTTATAATAAAATAAGAAAAAGG - Intronic
957868307 3:86053223-86053245 GATATAATAAAAAATGAACTAGG - Intronic
958039411 3:88208154-88208176 ACTATAATAAGGAAAGAAAAGGG - Intergenic
959520647 3:107319675-107319697 GATATAATCATGAAATAACAGGG + Intergenic
959793018 3:110387378-110387400 GAAAAAAGAAAGAAAGAACAAGG + Intergenic
960175803 3:114516340-114516362 GGAAACATAAAGAAAGTACAAGG - Intronic
961411383 3:126723622-126723644 GGAACCATTAAGAAAGAACAAGG - Intronic
962675732 3:137756724-137756746 AGTATAATAAAAAAAAAAAAAGG + Intergenic
962924692 3:139980945-139980967 GTTACAAGAAAGAAAGAAGAAGG - Intronic
963730285 3:148964702-148964724 GGTACAATAAAAACAGAGCAAGG + Intergenic
963952570 3:151219039-151219061 GGTAACATAATTAAAGAACATGG + Intronic
963987091 3:151608847-151608869 GATATAATGGAGAAAGAAAATGG + Intergenic
964381962 3:156106338-156106360 GGAATAATAGTGAAAGAGCATGG + Intronic
964466120 3:156995437-156995459 GAGAGAATAAAGAAAGTACAAGG - Intronic
965037129 3:163453818-163453840 TGTATAATAAGGAAGAAACAGGG - Intergenic
965045004 3:163565503-163565525 GGTATAAAAAAATAAGAAGAAGG - Intergenic
965644237 3:170863232-170863254 GGTATAATCAAGGAACAACAAGG - Intergenic
965865660 3:173201528-173201550 GGTATTATTAATTAAGAACATGG - Intergenic
967259050 3:187623849-187623871 GGTAGGATAAACAAAGAAAAAGG + Intergenic
969380379 4:6792207-6792229 GGCATATTAAAAAAAGAACATGG - Intronic
970732244 4:19119916-19119938 GGTAAAATTGAGAAAAAACAAGG + Intergenic
970981705 4:22106552-22106574 AGTATAATAAAAAAAAAAGAAGG - Intergenic
971540463 4:27810027-27810049 GGTATAATAAAGTAAGAGAGAGG + Intergenic
971991322 4:33898812-33898834 GGTATGATAAACATAGAACCTGG + Intergenic
972127354 4:35785321-35785343 GATTTAAAAAAAAAAGAACAAGG - Intergenic
974200884 4:58638912-58638934 GTGATAATAAAGGAAGAAAAAGG + Intergenic
974332848 4:60502775-60502797 GGAAGAAAAAAGAAAGAAAAAGG - Intergenic
974799975 4:66804218-66804240 GGTATAATAAAGGAATAATTGGG - Intergenic
974890623 4:67878001-67878023 AGTATAATAAAAAATGAAAACGG + Intronic
975415698 4:74101733-74101755 GGTATATTAAGAAAAGAAAAAGG - Intergenic
975675969 4:76828232-76828254 AGTATAATAAAAAAAAAAAAAGG - Intergenic
975713733 4:77186246-77186268 AGAATAATAAAGGAAGAATAGGG - Intronic
976433777 4:84993371-84993393 AGTATAAAAAAAAAAGAATATGG + Intergenic
976525003 4:86076418-86076440 GTTATTATAAAGAAAAATCATGG - Intronic
976692610 4:87884823-87884845 GGAAAAATAAAGCAGGAACAGGG + Intergenic
976862210 4:89678889-89678911 ATTATACTAAAGAAAGTACATGG + Intergenic
976993796 4:91404244-91404266 GATACAATAAAAAAAGAAAAGGG - Intronic
977285435 4:95100183-95100205 GGTATAAACAAGAAAAAAGATGG - Intronic
978074117 4:104507766-104507788 GATATAAAACAGAAAGAAAAAGG - Intergenic
978326209 4:107559849-107559871 GATATAAAAAAGAAAGTAAAGGG - Intergenic
978490532 4:109306741-109306763 AGTTTAATAAAGAAAGCACCTGG + Intergenic
978554297 4:109961843-109961865 GTTCTAATTAATAAAGAACAAGG - Exonic
979212119 4:118117548-118117570 GATATAATAAGAAAAGATCAAGG + Intronic
979289827 4:118967231-118967253 GGTAGAGGAAAGAAAGAAGAGGG - Intronic
979373916 4:119921746-119921768 GGTATAAAAAAGAAAGCTTAAGG - Intergenic
979428023 4:120592141-120592163 GGTATGAGAGAGAAAGAAGAAGG - Intergenic
979455312 4:120921016-120921038 GGTAATATAAGGAAACAACAAGG + Intronic
980013863 4:127625999-127626021 TTTATATTACAGAAAGAACAGGG - Intronic
981186903 4:141815053-141815075 AGTATAATAAAGAAAGAAAGAGG - Intergenic
981589172 4:146338693-146338715 GGTATCAGAAATAAAGAACTGGG - Intronic
981903726 4:149895482-149895504 GGCATCATCAAGGAAGAACAAGG + Intergenic
982394392 4:154900131-154900153 GGCACAAAATAGAAAGAACAGGG - Intergenic
983516212 4:168659324-168659346 GGTATAATAATGAAAATAAAGGG - Intronic
983615933 4:169704984-169705006 TGCATAATACAAAAAGAACATGG + Intronic
983674397 4:170275371-170275393 GGTATGATAAATAAATACCATGG - Intergenic
984012834 4:174391156-174391178 GCTATACAAAAGAAAGAACAGGG - Intergenic
984380062 4:178981698-178981720 GATATAATACAGAAATAAGATGG - Intergenic
984419163 4:179497467-179497489 GATTTAATAAAGAAAAAAAATGG + Intergenic
985605892 5:857922-857944 GGTGTCATAAAGACAGGACAGGG - Intronic
986697452 5:10370635-10370657 GTTAAAAAAAAGAAAGAAAATGG - Intronic
987888512 5:23844005-23844027 GGGATACAAAAGAAAGAATAAGG + Intergenic
988205355 5:28126615-28126637 GGTACACTAAGGAAAGAACCCGG + Intergenic
988314599 5:29608029-29608051 CATATAATAAAGAAAAAACTTGG + Intergenic
988364485 5:30278263-30278285 AGTATAATAAAAAAAAAAAAAGG + Intergenic
988422332 5:31021917-31021939 AGTATAATAAAAAAAGAAAATGG - Intergenic
988493960 5:31728801-31728823 GGTATAATAAAAATACCACATGG - Intronic
988576067 5:32425991-32426013 GGGATAATAAATAGAGACCAAGG - Intronic
988650906 5:33149799-33149821 GCTATAAAAGAGAAAGAGCATGG - Intergenic
988857026 5:35237458-35237480 AGTATAATAAAAAAAAAAAAAGG + Intergenic
988964479 5:36402632-36402654 GGTATGAGAGAGAAAGAACAAGG - Intergenic
988967633 5:36436175-36436197 GGTAAAATAAAGAAAGGAATTGG - Intergenic
988979323 5:36550181-36550203 AGTATAATACTGAATGAACATGG - Intergenic
989267435 5:39493244-39493266 GGTTTAATAAACATAAAACAAGG + Intergenic
989386382 5:40858648-40858670 TTTATAATAAAGAGGGAACATGG - Intronic
991156069 5:63437356-63437378 GGTATATAAAAGCAAGGACAGGG - Intergenic
991408758 5:66326753-66326775 GGTAAATTAAAGAAAAAAAAAGG - Intergenic
992142918 5:73817562-73817584 GGTAGAATAAAGAAGGAGAAGGG + Intronic
992655526 5:78906058-78906080 GGTAGAGTTAAGAAAGAAAAGGG + Intronic
993362480 5:86994962-86994984 AGACTAATAAAGAAAGAAGAGGG - Intergenic
993699291 5:91099335-91099357 GGGAGGAAAAAGAAAGAACAAGG - Intronic
994527962 5:100930087-100930109 GGTATAATAAAAAAAAAAAAAGG - Intergenic
995450966 5:112300205-112300227 AATATAATTAAGAAAAAACAAGG - Intronic
995559044 5:113361270-113361292 GGTACAATAAAGACTGAAGATGG - Intronic
995596038 5:113748688-113748710 GGTTTTATAAAGTAGGAACAAGG - Intergenic
995904170 5:117103643-117103665 GTTAAAAGAAAGAAAGAAAAAGG - Intergenic
996278691 5:121700263-121700285 TTTATAATAAAGACAGGACAGGG - Intergenic
996315265 5:122153892-122153914 GGTTTAATGGACAAAGAACATGG - Intronic
997023869 5:130034912-130034934 GAAATATTAAAGAAGGAACAGGG + Intronic
998473612 5:142402628-142402650 GGCATAATAAAATAAAAACAAGG - Intergenic
998543440 5:143005158-143005180 GATATACTATAGAAAGAGCAGGG + Intronic
998666486 5:144304181-144304203 GATAGAATAAAAAAAGACCAGGG + Intronic
998752227 5:145335061-145335083 GGTATAAGAAAGAAAGATAAAGG - Intergenic
1000277116 5:159747835-159747857 GGGAAAAGAAAGAAAGAACTGGG - Intergenic
1000489878 5:161898716-161898738 ATTATAATATAGAAAGAAAATGG + Exonic
1000831924 5:166112606-166112628 ACTATAATAAAGAAAGAAAGGGG + Intergenic
1003839242 6:10103195-10103217 GGTATACTCAAGAAAGATCTAGG - Intronic
1004052244 6:12096753-12096775 AGTATAATTAAGAAAATACAAGG + Intronic
1004473423 6:15949071-15949093 GGTAGAATAAAGATGAAACAAGG + Intergenic
1004573023 6:16866161-16866183 GGCAAAAGAAAGAAAGAAAAGGG - Intergenic
1004673528 6:17819863-17819885 GGTTTAAAAAAGAAAGGACAGGG + Intronic
1004871584 6:19910163-19910185 GCTATGATAAGGGAAGAACAAGG + Intergenic
1005401455 6:25438661-25438683 GGTATAATGAAGAACAAAGATGG + Intronic
1005731744 6:28704093-28704115 CAAATAAAAAAGAAAGAACAGGG - Intergenic
1008804294 6:55408950-55408972 TCAATAATAGAGAAAGAACATGG + Intergenic
1008868331 6:56242064-56242086 GGAATATTAAAGATAAAACAGGG - Intronic
1009295112 6:61937268-61937290 AGTATAATAAAAAAAGAAAAAGG - Intronic
1009317822 6:62244480-62244502 GACATAATAAAGAAAGCACATGG + Intronic
1009717111 6:67412109-67412131 GGGCTAATAAAGATAGAAAAAGG - Intergenic
1009978913 6:70702932-70702954 GCTATAAGAAAGACTGAACATGG - Intronic
1010368230 6:75077526-75077548 GGTATCAAAGGGAAAGAACATGG + Intergenic
1010589245 6:77693729-77693751 AGGAAAATAAAGGAAGAACATGG + Intronic
1010778445 6:79913714-79913736 GCTATAACAAGGAAAGAACTGGG + Intergenic
1011925545 6:92640315-92640337 AGTATAATAAAAAAAGAAAAAGG - Intergenic
1011945427 6:92895473-92895495 GGTAGAATAAAGAAAGAGAGAGG - Intergenic
1012388627 6:98710574-98710596 GGTATTATAAGGAAAGTTCAGGG - Intergenic
1012465567 6:99513496-99513518 GGTATAACTAATAAAGTACAGGG + Intronic
1012722431 6:102762723-102762745 TCTATTATAAAGAAGGAACATGG + Intergenic
1013290675 6:108716765-108716787 GGTGTAAAAAAAAAAGAAGAGGG - Intergenic
1014120467 6:117719945-117719967 GGTGCAATAAAAAAAGAAAAAGG - Intergenic
1014743480 6:125172297-125172319 TGTCTAAGAAAGAAAGAAAAAGG - Intronic
1014974107 6:127857207-127857229 GGTGTAATAAAGGAAATACAGGG + Intronic
1015107126 6:129550021-129550043 AGTTTAATAAATAAACAACAAGG + Intergenic
1015327411 6:131938556-131938578 GGTATAACAAATACTGAACAAGG + Intergenic
1015737311 6:136414529-136414551 GGCATTTTAAAGAAAGAACTCGG + Intronic
1016684769 6:146868591-146868613 AGTAAAATAAAGAAATAAGATGG + Intergenic
1017243124 6:152193616-152193638 GATATAAATAAGAAACAACATGG - Intronic
1018093408 6:160364065-160364087 TGTATAATAGAGGGAGAACATGG + Intronic
1018325294 6:162661256-162661278 TGTCTAAAAAAAAAAGAACAAGG + Intronic
1018365746 6:163117841-163117863 GGTAGAAGAAAGCAAGATCATGG + Intronic
1019790395 7:3008827-3008849 GGAAAAAAAAAGAAAGAAAAAGG + Intronic
1020025475 7:4896827-4896849 AGAAAAATAAAGAAAGAAAATGG - Intergenic
1020380664 7:7542045-7542067 TGCATCATAAAGAAAGAAGATGG + Intergenic
1020478554 7:8628585-8628607 TGTATAAAAAAAAAAGAACTGGG + Intronic
1021265903 7:18522326-18522348 GTTTTAACAAAGAAAGGACAGGG + Intronic
1021970576 7:25961822-25961844 GCTAAAATAATGAAAGAAGAGGG + Intergenic
1022554411 7:31278017-31278039 AGTATAATAAATAAAAAACAAGG + Intergenic
1022893997 7:34730712-34730734 GCTATAATAAAAAATGAAGAGGG - Intronic
1023214407 7:37846838-37846860 AGTATAATAAAAAAAAAAAAAGG + Intronic
1023420631 7:39975779-39975801 GGTATAATAAAGATGGAAGGCGG + Intronic
1023636057 7:42211763-42211785 GGTATAATAAAGAGAAGAGATGG - Intronic
1025654020 7:63500592-63500614 GGTATGAAAAAGAAAAAAAAAGG - Intergenic
1026632353 7:72048428-72048450 GACATGATAAAGAAATAACAGGG + Intronic
1027231211 7:76273720-76273742 ACTAAAATAAAGAAAGAAAAGGG - Intronic
1027741203 7:82008173-82008195 GGCATAAAAAATAAAGAATAAGG - Intronic
1027965919 7:85007511-85007533 AGTATAAAAAAGAAAAAAAATGG - Intronic
1028422798 7:90652078-90652100 GGAAAAATAAAGAAAGATGAGGG - Intronic
1028831341 7:95329553-95329575 GGAATAATAAAGAAGCAGCATGG - Intergenic
1030502195 7:110373661-110373683 GGAATAATGTAGACAGAACAGGG - Intergenic
1031204016 7:118730284-118730306 AGTATAATAAAAAAAAAACAGGG + Intergenic
1031390162 7:121203833-121203855 AGAAGAATAAAGAAAGAAAAAGG + Intronic
1031604643 7:123753891-123753913 GGTCTAATACAGAAAGATAAAGG - Intergenic
1031880632 7:127194510-127194532 TGCATAATAATGAAAGGACAAGG + Intronic
1032906702 7:136375659-136375681 GAAATAATGTAGAAAGAACATGG + Intergenic
1032998877 7:137480893-137480915 GGTAGAATAAAGAGAGAACTAGG - Intronic
1033871997 7:145764782-145764804 GGCATTGCAAAGAAAGAACAAGG + Intergenic
1034835550 7:154348864-154348886 GGCAGAATAAAGAAGGAAGATGG - Intronic
1035560158 8:598289-598311 ACTAAAATAAAGAAAGAAGATGG + Intergenic
1035599736 8:890600-890622 GGTAGAATCAAGAAAGCGCAAGG - Intergenic
1035962886 8:4157418-4157440 GGGAAAATAGAGAAAGAAAAAGG - Intronic
1037481192 8:19307501-19307523 GGAAATATAAAGAAAAAACAAGG - Intergenic
1037956278 8:23062650-23062672 GGTTTAATTAAAAAAGAAGAAGG - Intronic
1038663535 8:29517791-29517813 GGTAAAATGAATAAAGAAGAAGG + Intergenic
1039491675 8:37952496-37952518 GGAATAATAAAGAAAAACAAAGG + Intergenic
1039662865 8:39485976-39485998 TTTATAATAAAGACAGAACGGGG - Intergenic
1040652710 8:49466695-49466717 GATAAAATAAATAAAAAACAAGG - Intergenic
1042119600 8:65471496-65471518 GTTGTAAAAAAGAAAAAACATGG - Intergenic
1042566021 8:70112917-70112939 GTTTTAACAAAGAAAAAACAAGG + Exonic
1042680303 8:71376294-71376316 TGAACAAGAAAGAAAGAACAGGG + Intergenic
1043431779 8:80202036-80202058 AGGAAAAAAAAGAAAGAACAGGG + Intronic
1043956482 8:86365898-86365920 GGCACAATAAAGACAGAACCTGG + Intronic
1044234168 8:89811024-89811046 GGAAGAAAAAAGAAAGAAAAGGG - Intergenic
1044982275 8:97728865-97728887 GGAACAATATAGAAAGAACCCGG - Intergenic
1045155503 8:99464946-99464968 AGAATAAGAAAAAAAGAACAAGG - Intronic
1045765773 8:105666280-105666302 GATATAATCAAGAAAGTACTTGG + Intronic
1045963313 8:107994881-107994903 GTTATAATAAAGGAATGACATGG - Intronic
1045993357 8:108335693-108335715 ATTATAGTAAAGAAAGAACATGG - Intronic
1046025246 8:108714229-108714251 GGTCTAAAAGAGAAATAACAAGG + Intronic
1046564085 8:115876351-115876373 GATGTCAGAAAGAAAGAACACGG + Intergenic
1047019797 8:120762737-120762759 GGTATAAACAAGAATAAACAAGG - Intronic
1048264236 8:132971409-132971431 GGGAAAATAAAGAAATAACAGGG - Intronic
1049862164 8:144906876-144906898 GGAAAAAGAAAGAAAGAAAAAGG - Intergenic
1050000527 9:1072614-1072636 GGTAAAATAAACAAAGGGCAGGG + Intergenic
1050058369 9:1679248-1679270 GCTAAAAAAAAAAAAGAACATGG - Intergenic
1050076416 9:1870253-1870275 GGAATAATAAAGGAACAACTTGG - Intergenic
1050924639 9:11248620-11248642 GGTAAAAAAAAAAAAAAACAGGG + Intergenic
1051185854 9:14460510-14460532 AGTATAATAAAAAAAAAAGAGGG + Intergenic
1051418209 9:16864880-16864902 GGTACAATAAAGAAGGAGCTTGG + Intronic
1051580290 9:18665663-18665685 GGGAAAGTAAAGAAAGAAGATGG - Intronic
1051622769 9:19068866-19068888 GGGATAATAGAGAAAAAAAAAGG + Intronic
1051730345 9:20135863-20135885 AACATAATAAAGAAAGAGCAAGG + Intergenic
1051836381 9:21342821-21342843 GGTAAAAAAAAAAAAAAACAAGG - Intergenic
1051871903 9:21747660-21747682 GGTATAAAAAAGTGAGAGCATGG + Intergenic
1051955222 9:22684714-22684736 TGTAGAATAGAGAAAAAACATGG + Intergenic
1052312935 9:27087893-27087915 GGTAGAAAGAATAAAGAACATGG + Intergenic
1052483702 9:29067024-29067046 GGGAGAATAGAGAAAGAATAAGG + Intergenic
1052629676 9:31021146-31021168 GGTAAAAAAAAAAATGAACAAGG + Intergenic
1053798029 9:41743852-41743874 GGTATAAAAAAAAAAAAAAAAGG - Intergenic
1054750798 9:68904178-68904200 AGTGTAATGATGAAAGAACATGG - Intronic
1055231255 9:74068742-74068764 GGAAGAAGAAACAAAGAACAAGG + Intergenic
1055614799 9:78060351-78060373 AGTATAATAAAAAAAGAAAAAGG + Intergenic
1057104016 9:92393737-92393759 GGTATAAAAAACAAAGACTAAGG - Intronic
1057290696 9:93805053-93805075 TTTTTAATAAAGAAAGAAAATGG + Intergenic
1057319822 9:94002325-94002347 GGTATGTACAAGAAAGAACAGGG + Intergenic
1058838724 9:108884637-108884659 GGTTCAATAAAGAAATCACAAGG + Intronic
1059303401 9:113333979-113334001 GGAAAAAGAAAGAAAGAAGAAGG - Intronic
1059877704 9:118653992-118654014 TGTAAAATAAATAAAGGACATGG + Intergenic
1059979269 9:119751823-119751845 GATATGATAAAGGAACAACAAGG - Intergenic
1060231416 9:121828001-121828023 GTTATAATAAATAAAAAATAAGG - Intronic
1060791968 9:126491566-126491588 AGAAAAATAAAGAAATAACAAGG - Intronic
1061115533 9:128608516-128608538 GGAATAATGAACAAACAACAAGG + Intronic
1061561472 9:131406877-131406899 GATATTATAAAGAAACAGCAGGG - Intronic
1185518521 X:718971-718993 GGTATAATAAGAAAAGAATTGGG - Intergenic
1186129786 X:6454124-6454146 TAGATATTAAAGAAAGAACATGG - Intergenic
1186169306 X:6860136-6860158 GTAATAATAATTAAAGAACATGG - Intergenic
1186292239 X:8112942-8112964 GGTCTAGTATGGAAAGAACAAGG + Intergenic
1186824648 X:13327587-13327609 GATCTAATCAAGAAAGTACAAGG + Intergenic
1187565472 X:20445253-20445275 GTTATAATAAAGAAAGGGCAGGG - Intergenic
1187804385 X:23102415-23102437 GGACTAATGAAGAAAGAAAAAGG - Intergenic
1188213750 X:27453440-27453462 AGTATAATAAAAAAAAAAGAAGG - Intergenic
1188787977 X:34372349-34372371 GAAAAAATAAAGATAGAACAGGG - Intergenic
1189698257 X:43688215-43688237 GGTATATTCAAGAAATAGCAAGG - Intronic
1189748708 X:44196373-44196395 AATATAAGTAAGAAAGAACAGGG - Intronic
1190386281 X:49884892-49884914 AGAATAAGTAAGAAAGAACATGG + Intergenic
1190397268 X:49997866-49997888 GGTAAAAGAAAGAGAGAACTAGG - Intronic
1191737294 X:64400234-64400256 GGTATATTTAAGAAACAGCAAGG - Intergenic
1192336039 X:70220675-70220697 GTTAAAATAACCAAAGAACAGGG - Intergenic
1193008551 X:76648670-76648692 GGGAGAATAAAGAAATTACAAGG + Intergenic
1193381850 X:80825032-80825054 GATATAATAAAAAATGAAAAAGG - Intergenic
1193507089 X:82357932-82357954 AGTATAATAAAAAAAGAAAATGG + Intergenic
1193689954 X:84629514-84629536 GGTAATATAAAAAAAGTACAAGG + Intergenic
1194275356 X:91873798-91873820 AATATAATATAAAAAGAACAAGG - Intronic
1194524272 X:94958436-94958458 AAAAGAATAAAGAAAGAACAAGG - Intergenic
1194826769 X:98574814-98574836 AGTATAATAAAAAAAAAAAAAGG - Intergenic
1194942355 X:100026595-100026617 AGTACAATCAAGAAATAACAAGG + Intergenic
1195474673 X:105272275-105272297 AGTATAATAAAAAAAAAAGAAGG + Intronic
1195619047 X:106934991-106935013 AGTATAATAAAAAAAAATCAAGG + Intronic
1195790977 X:108585795-108585817 GGTTTAATCAATAAAGAACATGG + Intronic
1195951509 X:110279228-110279250 GGCAGAATAAAGAAAGAATCTGG - Intronic
1196421906 X:115531284-115531306 GATATAATAGAAAAAGAACCTGG - Intergenic
1196501270 X:116385614-116385636 GGTAGAATAATGCCAGAACACGG - Intergenic
1196885330 X:120239287-120239309 GGAAAAAGAAAGAAAGAAGAAGG + Intergenic
1197325947 X:125093732-125093754 AGTACAATAAAAAAAGAACTGGG - Intergenic
1198210716 X:134513107-134513129 TGTATATTAAAGAGAGACCAGGG + Intronic
1198930833 X:141857782-141857804 AGTATTATAAAGAAAAACCAAGG - Intronic
1198985378 X:142446190-142446212 GGAGTAAAAAAGAAAGAAAATGG - Intergenic
1199177177 X:144803000-144803022 GGTATAAAGAAGATAAAACAAGG - Intergenic
1200592602 Y:5095195-5095217 AATATAATATAAAAAGAACAAGG - Intronic
1201503969 Y:14677429-14677451 GGTATACAAAAGAAAGCAAAAGG - Intronic
1201704271 Y:16918185-16918207 AGTATAATAAAAAAAAAAAAAGG + Intergenic
1201887706 Y:18903984-18904006 GGTACAAAAAAGAAAGAGAAAGG + Intergenic
1202282205 Y:23201223-23201245 AGTATAATTATGAAACAACAGGG - Intergenic
1202283686 Y:23217296-23217318 AGTATAATTATGAAACAACAGGG + Intergenic
1202433877 Y:24815608-24815630 AGTATAATTATGAAACAACAGGG - Intergenic
1202435362 Y:24831682-24831704 AGTATAATTATGAAACAACAGGG + Intergenic