ID: 1086153732

View in Genome Browser
Species Human (GRCh38)
Location 11:83642373-83642395
Sequence TTCTATCTGAAAACAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 489}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086153732_1086153737 24 Left 1086153732 11:83642373-83642395 CCCTTCTCTGTTTTCAGATAGAA 0: 1
1: 0
2: 3
3: 30
4: 489
Right 1086153737 11:83642420-83642442 ACAATCTCTTGCAGCTTGGATGG 0: 1
1: 0
2: 0
3: 33
4: 354
1086153732_1086153736 20 Left 1086153732 11:83642373-83642395 CCCTTCTCTGTTTTCAGATAGAA 0: 1
1: 0
2: 3
3: 30
4: 489
Right 1086153736 11:83642416-83642438 TAGAACAATCTCTTGCAGCTTGG 0: 1
1: 1
2: 0
3: 21
4: 824

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086153732 Original CRISPR TTCTATCTGAAAACAGAGAA GGG (reversed) Intronic
900358569 1:2276606-2276628 TTTTATTTGTAAACAGAAAATGG + Intronic
901728191 1:11258938-11258960 TTCTGTCTGATAACAGTGATTGG - Intronic
902713141 1:18254330-18254352 CTCTATCTGAATACAGCGAATGG + Intronic
903130295 1:21274853-21274875 TTACACATGAAAACAGAGAAAGG + Intronic
904701278 1:32359787-32359809 TTTTATGTGGAAACTGAGAAGGG + Intronic
904979229 1:34482918-34482940 TTCTCTTTGACAACAGGGAAAGG - Intergenic
905587276 1:39130453-39130475 ATTTATCTGAAAACAGAGAAAGG - Intronic
905623886 1:39474080-39474102 TTTTATTTTAAAACAGAGATGGG - Intronic
905718442 1:40174389-40174411 CTCTATTTGAAAACATATAAAGG - Intronic
905941641 1:41867817-41867839 TTCTATCTGAAGGCAGAGCCTGG + Intronic
907061208 1:51427540-51427562 TGCTATTGGAACACAGAGAATGG + Intronic
907227462 1:52961493-52961515 TTCTATCTGAAAACTAAGAGGGG - Exonic
907259126 1:53203819-53203841 TACTATCTGGAAACAGAATATGG + Intronic
907652723 1:56311184-56311206 TTCTAGCTGAAATGAGAAAAAGG - Intergenic
908321040 1:62979145-62979167 TTTTTCCTGAAAAGAGAGAAGGG - Intergenic
909955277 1:81771587-81771609 TTCTTGCTGAAAACACAGTAAGG - Intronic
911799232 1:102112765-102112787 TTCATTCTGAAACCACAGAAGGG - Intergenic
911949106 1:104149446-104149468 TTCAGTGTGAAAACAGTGAAGGG + Intergenic
913287971 1:117244665-117244687 TTCTATCTAAAAAGGGTGAATGG + Intergenic
916474582 1:165156615-165156637 TCCAATATGAAACCAGAGAAAGG + Intergenic
916795532 1:168163622-168163644 TGCTATGAGAATACAGAGAAAGG - Intergenic
917724898 1:177819081-177819103 TTCTCTCTGCAGACAGACAATGG + Intergenic
918258309 1:182770397-182770419 GTCAATCTGCAATCAGAGAAGGG + Intergenic
918911970 1:190584837-190584859 TACTGTCTGAAAGCAGAGTAGGG - Intergenic
918927329 1:190805458-190805480 TTCTGCCAGAAAACAGAAAAAGG - Intergenic
918995051 1:191747462-191747484 TTCTAGGTCAAAGCAGAGAAAGG + Intergenic
919961037 1:202468924-202468946 TTCTGTCTCAAAAAAAAGAAAGG + Intronic
920258292 1:204671595-204671617 CTCTATCTGGACTCAGAGAAGGG + Intronic
921875371 1:220189550-220189572 TTCTATCTGAAAATAAAGAAAGG + Intronic
922227877 1:223661327-223661349 TACTATCAAAAAACAGAAAATGG + Intronic
922779228 1:228238135-228238157 TGCTATCTGAACACTCAGAAAGG - Intronic
924355291 1:243167423-243167445 TTCTACTTGAAAAAAAAGAAAGG - Intronic
924446100 1:244133009-244133031 TTGGCTTTGAAAACAGAGAAAGG + Intergenic
924582832 1:245336261-245336283 TTCTTTCTGAGAACAGTGGATGG - Intronic
1063035922 10:2286529-2286551 TTCTAGCTGAAAAAAGAAATGGG - Intergenic
1063673084 10:8115645-8115667 TTCTTTCTGAAAATATAGAGAGG - Intergenic
1063913067 10:10852396-10852418 TTATTTATTAAAACAGAGAATGG + Intergenic
1064272147 10:13875184-13875206 GTCTTTATGAAAACAAAGAAGGG + Intronic
1064741679 10:18440801-18440823 GTGTGTCTGAATACAGAGAAAGG + Intronic
1065300449 10:24316365-24316387 TTCAATTTTAAAACTGAGAAAGG + Intronic
1066086219 10:31974360-31974382 CTCTGTCTGAAAACAAAGATAGG + Intergenic
1066334737 10:34464082-34464104 GTCTAGCTGAAAACAAAGTATGG - Intronic
1066621595 10:37359095-37359117 TTCTATTTTAAAACAGAGTTGGG - Intronic
1067056457 10:43055245-43055267 TACATTCTGAAAAAAGAGAAGGG - Intergenic
1067480378 10:46592863-46592885 TTCTATTCAAAAACTGAGAAAGG - Intronic
1067614359 10:47748936-47748958 TTCTATTCAAAAACTGAGAAAGG + Intergenic
1068382215 10:56271014-56271036 TTATATCTCACAACAGAGATTGG + Intergenic
1068713595 10:60161230-60161252 TTCTATGTGCTAACAGAAAATGG + Intronic
1070360622 10:75685023-75685045 TCCAATCTGAAAACTGAAAAGGG - Intronic
1071204231 10:83255084-83255106 TTCTGTCTCAAAACAAAGAGAGG - Intergenic
1071629765 10:87208912-87208934 TTCTATTCAAAAACTGAGAAAGG + Intergenic
1073261762 10:102195942-102195964 CTCTATCTCAAAAAAAAGAAAGG - Intergenic
1073282567 10:102365421-102365443 TTCAATCAGAAACCAAAGAAGGG + Exonic
1073962426 10:108948230-108948252 TATTATCTGCAAACAGAGATTGG + Intergenic
1074173210 10:110966337-110966359 TCCTATCTGAAGACATGGAATGG - Intronic
1074407391 10:113191124-113191146 TTCTATTTGGAAACAGGGAGGGG + Intergenic
1075240640 10:120775373-120775395 TTCTATCTCAAAAAAAAAAAAGG - Intergenic
1075441839 10:122485968-122485990 TTCCTTCTGAAAACAGAGCCTGG - Intronic
1076147379 10:128134732-128134754 TTGTCTCTGAAAAAAAAGAAAGG - Intergenic
1079692917 11:23441874-23441896 TTCTATCTGAAAACATGAATTGG + Intergenic
1081179918 11:39972525-39972547 TTCTTTCTAAAAACAGCAAAGGG - Intergenic
1081201743 11:40224888-40224910 TTCTGTCTGACAGCAGAGGATGG - Intronic
1082224409 11:49686619-49686641 TTATATCTGTAAATACAGAATGG - Intergenic
1082247014 11:49935774-49935796 TTCCTTCTGAAATCAGAGATTGG + Intergenic
1082274060 11:50202422-50202444 CTGGATTTGAAAACAGAGAAAGG - Intergenic
1082563615 11:54648805-54648827 TTCCTTCTGAAATCAGAGATTGG - Intergenic
1083468558 11:62866050-62866072 TACTATGTGAGACCAGAGAATGG - Intronic
1083992730 11:66257069-66257091 TTCTTTCTGAAGACAGAGCTAGG + Intergenic
1085362266 11:75900606-75900628 GTCTACCTTAAAACAGAGATGGG - Intronic
1086046006 11:82532846-82532868 TTTTAACTTATAACAGAGAAGGG - Intergenic
1086153732 11:83642373-83642395 TTCTATCTGAAAACAGAGAAGGG - Intronic
1086624636 11:88932590-88932612 TTATATCTGTAAATACAGAATGG + Intronic
1086762723 11:90653228-90653250 TTCTATCTCAATACAGGCAAAGG + Intergenic
1087118400 11:94546639-94546661 TTCTGTCTGTAAACACAGACTGG - Exonic
1087415955 11:97855710-97855732 TTCTATCTGCTCACAGAGACTGG + Intergenic
1087453982 11:98360075-98360097 GTGTATGTGAAAACAGAGAGAGG + Intergenic
1087949374 11:104201667-104201689 TGCTATGGGAGAACAGAGAAGGG + Intergenic
1088035680 11:105311240-105311262 TTCTATTTAAAAACAGTGAGAGG - Intergenic
1088036493 11:105323128-105323150 TTCTATCTTAAATAAGATAATGG + Intergenic
1088579924 11:111305399-111305421 TGCTTTCTGGGAACAGAGAAGGG - Intronic
1088779459 11:113120439-113120461 TTATATCTGAATACAGCTAAAGG - Intronic
1089818062 11:121194266-121194288 TTCTCTTTGTAAAAAGAGAAGGG - Intergenic
1090768583 11:129898150-129898172 TACTAGCAGAAGACAGAGAAAGG - Intergenic
1091174276 11:133545776-133545798 TTCACTCTGAGATCAGAGAACGG - Intergenic
1092068098 12:5609207-5609229 TTCTGTCAGAAAGCAGGGAACGG + Intronic
1093100274 12:15019928-15019950 TTCTATATGAAATCACAGCAAGG + Intergenic
1093167356 12:15819921-15819943 TTCTATCTGATGACAGAGATTGG - Intronic
1093550260 12:20401505-20401527 TTCTCTCTCAAGACAGAGATAGG + Intronic
1093699664 12:22204674-22204696 TTCAAAGTGAAAACACAGAAAGG - Intronic
1094014716 12:25850080-25850102 ATCTTTCTCAAAACAGAGCATGG + Intergenic
1094471804 12:30808749-30808771 TCCTCTCTTAAAAGAGAGAAAGG - Intergenic
1095167108 12:38986855-38986877 TTCAATCAGAAGACAGAGAGTGG + Intergenic
1095507723 12:42915261-42915283 TTGAATCTGAAAATATAGAATGG - Intergenic
1095612100 12:44141489-44141511 TACTATCTAAAAATAGAGACAGG - Intronic
1095884128 12:47170736-47170758 TTCTATTGAAAAACAGAGACTGG - Intronic
1098037370 12:66317963-66317985 TCATATCAGAAAACAGAGTAAGG - Intronic
1098082696 12:66806753-66806775 TTATTTCTGAAAACAGAGTTTGG - Intergenic
1098731914 12:74046562-74046584 TTGTATCTGAATACAGAGATAGG + Intergenic
1098947780 12:76607538-76607560 TTCTAGCAGAATACAAAGAATGG - Intergenic
1099491915 12:83299249-83299271 TTCTACCTGAAGAAAGAGAAGGG + Intergenic
1099944867 12:89233204-89233226 TGCTCTCTGAAAGCAGAGACTGG - Intergenic
1100189788 12:92177989-92178011 TTCTATTTTAAAACAGAGATAGG - Intergenic
1100447931 12:94678477-94678499 CTCTATCTGCAAAAAGAGACTGG + Intergenic
1100917194 12:99437560-99437582 TTCTATCATGAAACAGGGAAAGG + Intronic
1101220635 12:102635564-102635586 TGCTATAGGAAAACTGAGAAGGG - Intergenic
1101235469 12:102784720-102784742 TTGTATCTGAAAAAAAAAAAAGG + Intergenic
1101368760 12:104103789-104103811 TGCTAACTGTAAACAAAGAAAGG - Exonic
1101412344 12:104480041-104480063 TTCTAAAGGAAGACAGAGAATGG + Intronic
1101497721 12:105271319-105271341 CTCTATCAGAAACTAGAGAAGGG - Intronic
1101651022 12:106677207-106677229 TTCACTAGGAAAACAGAGAAAGG + Intronic
1101884204 12:108647893-108647915 TTCTATCTGACCAGAGAGAGGGG + Intronic
1101896327 12:108759768-108759790 TTCTATCTAAAAATAAAAAAAGG + Intergenic
1102313690 12:111868023-111868045 TTCTATTTCAAATCAGTGAAAGG + Intronic
1102450562 12:113038758-113038780 TTCTGTCTCAAAAAAAAGAAGGG + Intergenic
1103642082 12:122359660-122359682 TTCTACCTGAACATAGAGGAAGG + Intronic
1104974685 12:132547136-132547158 TGCTTACTGAAAACGGAGAACGG + Intronic
1104974689 12:132547186-132547208 TGCTTACTGAAAACGGAGAACGG + Intronic
1104974693 12:132547236-132547258 TGCTTACTGAAAACGGAGAACGG + Intronic
1104974697 12:132547286-132547308 TGCTTACTGAAAACGGAGAACGG + Intronic
1105250396 13:18693954-18693976 TTCAATCAGAAAACACAGCATGG - Intergenic
1105718859 13:23094192-23094214 TTATATCTGGAGACAGAGGAGGG + Intergenic
1106083189 13:26517411-26517433 TGCTGCCTGCAAACAGAGAAGGG - Intergenic
1106956976 13:34950218-34950240 TTCTTTCTGAAGAAAGAAAAAGG + Intronic
1107711903 13:43158858-43158880 TAATATCTGAAAATACAGAATGG - Intergenic
1109558003 13:64006097-64006119 TTCTTTCTTAAAGAAGAGAAAGG + Intergenic
1109716563 13:66228802-66228824 TTCTAAGTGAAAGCAGAGAGAGG + Intergenic
1109983913 13:69949923-69949945 TTCTCTCTGACAAGAGAGAGAGG - Intronic
1110522439 13:76496478-76496500 TTCTATCCAAAAACAGGAAATGG + Intergenic
1110745352 13:79047190-79047212 TCCTAACTGTAAATAGAGAAGGG + Intergenic
1110874886 13:80496613-80496635 TGCTATCTGGAAACATAAAATGG + Intergenic
1111702221 13:91705094-91705116 TTAAAAATGAAAACAGAGAAGGG - Intronic
1113232333 13:108226550-108226572 TTTTATCTGAAGAGGGAGAAAGG + Intronic
1114637778 14:24197894-24197916 TTCTATTTGAATACAGAATAGGG - Intronic
1114684754 14:24518090-24518112 CTCTAACTGAAAACACATAAGGG - Intergenic
1115202010 14:30863803-30863825 TTTTGTATGAAAAGAGAGAAGGG - Intergenic
1115409038 14:33051630-33051652 GGCTATCAGAAAACAGAGAACGG + Intronic
1115590516 14:34860001-34860023 TTTTATCTAAAAACTAAGAATGG - Intronic
1115805133 14:37042462-37042484 TTCTATTTTAAAAAAGAAAATGG - Intronic
1116527477 14:45924263-45924285 TTCTTTCACAAAACATAGAAGGG - Intergenic
1116629347 14:47310152-47310174 TTCTAGGTGAAAACAAATAAAGG - Intronic
1117256109 14:53979637-53979659 TTCTATCTGGCAACATACAATGG - Intergenic
1117339005 14:54777974-54777996 TTCTGCGTGAAAACAGAGGATGG - Intronic
1117353198 14:54901240-54901262 TTCTTTCAAAAAACAGTGAACGG + Intronic
1118042588 14:61933267-61933289 ATCTTTGTGAAAACAGACAATGG - Intergenic
1118095155 14:62528153-62528175 TTTTAGATTAAAACAGAGAAGGG + Intergenic
1118586883 14:67361611-67361633 TTCTTTCTCAAAACAGTGCATGG - Intronic
1119244344 14:73090716-73090738 TTCTATCTGTAATCAGAGATGGG - Intronic
1119463862 14:74836860-74836882 TTCTATGTAAACACAGAAAAGGG + Intronic
1120002671 14:79320648-79320670 TTCTATCAGAGAAAAGAAAAAGG + Intronic
1120024077 14:79562760-79562782 GTCTATCTGAAAACTAAGCAAGG - Intronic
1120257060 14:82134033-82134055 TTGAATCTGCAAAAAGAGAAAGG - Intergenic
1120571470 14:86122534-86122556 TTATATATGAAAAAAGAAAATGG + Intergenic
1121178236 14:91906919-91906941 GTCTAGTTGAAAACAGACAAGGG + Intronic
1122202539 14:100131257-100131279 TTCTGTCTGAGAACAGGAAAAGG + Intronic
1124523639 15:30427501-30427523 CTCCATCTCAAAACAGAGACCGG - Intergenic
1124535028 15:30538714-30538736 CTCCATCTCAAAACAGAGACCGG + Intergenic
1125068318 15:35519536-35519558 TTCTAAATGAAAACTCAGAATGG + Intronic
1125889036 15:43252070-43252092 TCCTTTCTGAGCACAGAGAATGG - Intronic
1126055418 15:44725609-44725631 TCCTATCTCAAAAAAAAGAAAGG - Intergenic
1126403964 15:48304020-48304042 TTCTAACTGAAAACATATATGGG + Exonic
1126763531 15:51991379-51991401 TTCTATCTCATAGAAGAGAAAGG - Intronic
1127501108 15:59554956-59554978 TGCTATGTGAAATCAGAGAGGGG - Intergenic
1127621664 15:60740048-60740070 TTCTATTAGAAAGGAGAGAAAGG + Intronic
1128170973 15:65512725-65512747 TTTAAACTGAACACAGAGAAGGG - Intronic
1128480341 15:68032148-68032170 TTCTATCTGAAGACAGGCCAGGG - Intergenic
1128523693 15:68392629-68392651 ATCTATCAGAAAACAGCCAATGG + Intronic
1131637963 15:94257884-94257906 TTCCATCTTAAAAAAGAAAATGG - Intronic
1132745982 16:1436516-1436538 CTCTATCTGAACACAGAGCCGGG + Exonic
1132953610 16:2578944-2578966 TTCTTTTTTAAAACAGAGATGGG + Intronic
1132960741 16:2621223-2621245 TTCTTTTTTAAAACAGAGATGGG - Intergenic
1133462909 16:6002639-6002661 TCCTTTCTGGAAACACAGAACGG - Intergenic
1133471336 16:6078865-6078887 CTCTATCTGAAAACTGTGCATGG + Intronic
1134465236 16:14470327-14470349 TTAAATTTGAAAACATAGAAAGG - Intronic
1135068058 16:19327759-19327781 TCCAATCTAAAAACAGAGATTGG - Intergenic
1135143939 16:19945310-19945332 TTGTTTCTGAAAGAAGAGAAGGG + Intergenic
1135783311 16:25325466-25325488 TTCTTTATGAAAACAGATGATGG + Intergenic
1135835164 16:25818860-25818882 TGATATCTGAAGACAGAGGATGG + Intronic
1135843990 16:25901708-25901730 TTCTGTGTGAGAACAGAGAAAGG - Intronic
1135939489 16:26809200-26809222 TTCTCTCTGAAAATAAAGGATGG + Intergenic
1136032431 16:27513540-27513562 TTAGATCTGAAGACAGAGGAAGG + Intronic
1136068772 16:27775827-27775849 TTTTCTCTGAAAACACAGGAAGG + Intronic
1137703398 16:50515863-50515885 TTCAATCAAAAAACATAGAATGG - Intergenic
1137882175 16:52061375-52061397 TTCTATGTGCACATAGAGAATGG + Intronic
1138961311 16:62033812-62033834 ATCCCTCTGAAAACAGAGAGGGG - Intronic
1141405255 16:83786892-83786914 TACTTTCTGAAGAAAGAGAAAGG - Intronic
1141768418 16:86073856-86073878 TTCAATGTGATAACAGACAAGGG + Intergenic
1141936830 16:87245567-87245589 TTCTTTTTTAACACAGAGAAAGG + Intronic
1142382768 16:89743040-89743062 TTCCATCAGAGGACAGAGAAGGG + Intronic
1142838600 17:2608851-2608873 TTCGAGCTGAATAAAGAGAATGG + Intronic
1142945000 17:3418762-3418784 TTGTATCTGAAATCAGAAGATGG - Intergenic
1143033406 17:3980775-3980797 TTCTCACTGAGAACAAAGAAAGG + Intergenic
1143704737 17:8688813-8688835 TTCTGTCTCAAAAAAGAAAAAGG - Intergenic
1143866709 17:9928833-9928855 TTCTCTCTACAAACACAGAAGGG - Intronic
1144113437 17:12062340-12062362 TCCTGTCTGAAAAAAGACAAAGG - Intronic
1144455194 17:15412871-15412893 TGCTGGCTGAAAACAGGGAAGGG - Intergenic
1145179994 17:20740023-20740045 TTCTATCTCAAAAAATAGTATGG - Intergenic
1146222067 17:31032806-31032828 TTCTGTGTGAAAACAGAAGAGGG - Intergenic
1146481031 17:33205140-33205162 GGCTAACTGAAAACAGAGAGAGG - Intronic
1146608819 17:34286751-34286773 TTGTGTCTCAAAACAGAGGATGG + Intronic
1147029852 17:37623971-37623993 TTCTATAAGAAACCAGAGGAGGG + Intronic
1147287511 17:39414252-39414274 TTGAATCCGAAAGCAGAGAAGGG + Intronic
1147497276 17:40928606-40928628 TCCTATTTAATAACAGAGAAAGG + Exonic
1147855224 17:43474761-43474783 TTGTATCAGGAAAAAGAGAAGGG + Intergenic
1148402539 17:47379166-47379188 CTCTTTTTAAAAACAGAGAATGG + Exonic
1148696985 17:49566656-49566678 TACTATTTTAAAACAGAGAGAGG + Intergenic
1149023076 17:51992525-51992547 TTATGCCTGAAATCAGAGAATGG - Intronic
1149135085 17:53354535-53354557 TTCTACCACAAAAAAGAGAAAGG + Intergenic
1149839712 17:59949713-59949735 TTCTATCTTAAAAAATAGTATGG - Exonic
1150792129 17:68207250-68207272 TTCTGTGTGAAAACAGAAGAGGG - Intergenic
1154438450 18:14364972-14364994 TTCAATCAGAAAACACAGCATGG + Intergenic
1154944180 18:21145304-21145326 TTATATTTGATACCAGAGAAGGG - Intergenic
1154954984 18:21244314-21244336 GTGTATCTGAAAACACTGAAAGG + Intronic
1155108733 18:22692917-22692939 TTCAATATTAAAACAGAGATTGG - Intergenic
1155449244 18:25946280-25946302 TTCTCTCTGAAAGCAAAGTATGG - Intergenic
1155592660 18:27445773-27445795 TGCTAACTGAAAATGGAGAAAGG - Intergenic
1156049723 18:32917869-32917891 TTCTTTCTTAAAAAAGAAAAAGG + Intergenic
1156049881 18:32919772-32919794 TTATATCTGGAAAGAGAAAAAGG + Intergenic
1156120873 18:33841402-33841424 CTGTATCTGAAATCAGAGAGGGG - Intergenic
1156405764 18:36781264-36781286 CTGTCTCTGAAAACAGGGAAAGG + Intronic
1156598198 18:38572330-38572352 ATTTACCTGAAAACTGAGAATGG - Intergenic
1157026372 18:43849097-43849119 ATCTAACTGAAAATAGAAAAGGG + Intergenic
1157170776 18:45403127-45403149 AGCTATCTGAAAGCCGAGAAGGG - Intronic
1157396283 18:47344393-47344415 TTCTATCTGTGAACACAGGATGG + Intergenic
1157429016 18:47608178-47608200 TTCTGTCTGGGAACAGAGAAGGG + Intergenic
1157488034 18:48103154-48103176 ATCTATCTGAAAAAAGTGATGGG + Intronic
1158359596 18:56656852-56656874 TTTTATCTGAGAACATGGAATGG + Intronic
1158778004 18:60610666-60610688 ATCTATTTGATAACAGATAAGGG + Intergenic
1159145480 18:64448576-64448598 TTTTATCTCTAAAGAGAGAAAGG + Intergenic
1159774453 18:72586712-72586734 ATCTAGCTGAAAAGAGAAAAAGG + Intronic
1160359502 18:78260397-78260419 TTCAATATGAAAACATAAAATGG + Intergenic
1160431418 18:78815597-78815619 TTCTAGCTGAACAGAGAGGAAGG + Intergenic
1162074752 19:8178256-8178278 TTTGATCTGATAACAGAAAATGG - Intronic
1162695424 19:12470052-12470074 TTCTTTCTGAAATTGGAGAAAGG - Intronic
1164409101 19:27983025-27983047 TTCTCTTTGAAAACATAAAAGGG - Intergenic
1165546331 19:36539842-36539864 TTCTTTCAGGAAACAGACAAGGG + Intronic
1167156504 19:47742277-47742299 TTCTATCAAAAAAGAAAGAAAGG - Exonic
1167487695 19:49772806-49772828 TTCTTTCTGGAAACAAAAAAAGG + Intronic
1168634645 19:57986444-57986466 TTCTATCTCAAAAAACAAAATGG + Intronic
925624092 2:5825064-5825086 TTCTATCTGATAAATGACAAAGG + Intergenic
925712205 2:6752439-6752461 TAAAATCAGAAAACAGAGAAGGG + Intergenic
925749600 2:7075732-7075754 TTCTATATGGCAACAGAAAATGG + Intergenic
926561099 2:14418428-14418450 TTCACTAGGAAAACAGAGAAGGG + Intergenic
927106109 2:19828166-19828188 CTCTTTCAGAAAATAGAGAAAGG + Intergenic
928036164 2:27825580-27825602 TTGTATCTGAAACCAGGGACAGG + Intronic
929253019 2:39779727-39779749 TTCTTTGTGAAAACAGACCAGGG - Intergenic
929745880 2:44657924-44657946 TTTTATATAAAAACAGAGTATGG - Intronic
932468841 2:71940676-71940698 CTCTATTTGAAAACTGTGAAAGG + Intergenic
932938086 2:76129911-76129933 CTCTGTCTCAAAAAAGAGAAGGG + Intergenic
933694639 2:85208575-85208597 TTCACTCTGAAAACATGGAATGG - Intronic
934018158 2:87912567-87912589 TCCTATCTGAAGATAAAGAAAGG - Intergenic
937087745 2:119182455-119182477 TACTATCTGTAAGAAGAGAAAGG + Intergenic
939203396 2:139068387-139068409 TTCTTTGTAAAAACAAAGAAGGG + Intergenic
939706839 2:145465377-145465399 TTCCATGTGAAATCAGATAATGG + Intergenic
939934023 2:148267278-148267300 TTTTAAATTAAAACAGAGAAAGG + Intronic
940275759 2:151938977-151938999 TTATATCTGCAGATAGAGAAAGG - Intronic
940458084 2:153927201-153927223 TTCTATCTGCAAAGAAAGAAAGG + Intronic
941133590 2:161685306-161685328 CTCTATCTGTAAAGTGAGAATGG - Intronic
941433507 2:165439490-165439512 TTTAATCTGAAAACTAAGAAAGG - Intergenic
942367408 2:175241775-175241797 CTCTATATGACAACGGAGAAGGG + Intergenic
942613158 2:177762766-177762788 TTCTATTTGAAAACAAAGCGAGG - Intronic
943532983 2:189110322-189110344 TTCTATCTTGTCACAGAGAATGG + Exonic
944966111 2:204935788-204935810 TGATATTTCAAAACAGAGAAGGG - Intronic
945805660 2:214487081-214487103 TTCCATGTGAAGACAGAGGAAGG + Intronic
945904785 2:215579357-215579379 TTGTATTTGATTACAGAGAAAGG + Intergenic
946288788 2:218727252-218727274 GTCTATCTGAAAATACACAAAGG - Exonic
946879428 2:224162234-224162256 TCCTATAAGCAAACAGAGAAGGG - Intergenic
947074758 2:226330435-226330457 TTCTTTCTTAAAATAGAGAAGGG + Intergenic
947679547 2:232017565-232017587 TCCTATGTGAAACAAGAGAAGGG - Intronic
947949254 2:234133734-234133756 TTCTAGCTGAAAACAGGCCAGGG + Intergenic
948616888 2:239204843-239204865 TGGTGTCTGAAAACAGAGGAAGG - Intronic
1169456912 20:5760160-5760182 GTCGAACAGAAAACAGAGAAGGG + Intronic
1169634336 20:7671141-7671163 TTCTTTCTGAAAATGGAGACAGG + Intergenic
1173007893 20:39155175-39155197 TTCTATCTTAAAAACGAGGATGG - Intergenic
1173588772 20:44207837-44207859 TTTTATATTTAAACAGAGAAAGG + Intronic
1173657679 20:44711642-44711664 TTCTGTCTGATAACTGAGGATGG - Intergenic
1173796076 20:45860958-45860980 TTCTATTAGAAAACAGTGATGGG + Intronic
1174954455 20:55081665-55081687 TTCTATATTAAAACAAGGAAAGG - Intergenic
1176457226 21:6924500-6924522 TTCAATCAGAAAACACAGCATGG - Intergenic
1176835399 21:13789584-13789606 TTCAATCAGAAAACACAGCATGG - Intergenic
1176897174 21:14394241-14394263 TTCTTTCTGAAAGCAGAGTTTGG + Intergenic
1177624146 21:23637074-23637096 TTGTATATGAAAATAGATAAGGG + Intergenic
1178665676 21:34544279-34544301 TTCTTTCTGAAGTCGGAGAAAGG + Intronic
1179003599 21:37487322-37487344 TTCCTTCTGAAAACAGAAATAGG + Intronic
1179205923 21:39278306-39278328 ACCTATCCGAAAAAAGAGAAAGG + Intronic
1179205939 21:39278543-39278565 TACTACCAGAAATCAGAGAAAGG + Intronic
1180242467 21:46519425-46519447 TTCTCTCATAAAACAGAGAGGGG - Intronic
1180718540 22:17889310-17889332 TTTTAGCTGAAAACAGAGAAAGG - Intronic
1182850080 22:33466210-33466232 TTCAAGCTGGAAACACAGAAAGG - Intronic
1184030965 22:41894498-41894520 TTGGATCAGAAAACAGAAAATGG - Intronic
1184171859 22:42764768-42764790 TTCCTTCTGAAGGCAGAGAACGG + Intergenic
949233317 3:1777106-1777128 TTCAATCTGAGAAAAAAGAAAGG - Intergenic
949362976 3:3251451-3251473 TTGTATCTGAGAACAGAGTGAGG + Intergenic
949502929 3:4699348-4699370 CTCTATCTCAAAACAAAAAAAGG + Intronic
949900228 3:8808170-8808192 TTCCATTTAAAAACAGTGAATGG + Intronic
951179415 3:19641569-19641591 TAATAACTGAGAACAGAGAAGGG + Intergenic
951304407 3:21040685-21040707 TTTTATCTGAAATGAGTGAAGGG - Intergenic
951644662 3:24875807-24875829 TTCTATCCTGAAACAGGGAAAGG - Intergenic
951825759 3:26866355-26866377 TTCCTGCTGAGAACAGAGAAAGG + Intergenic
952445649 3:33378319-33378341 TTCTGTCTGATGACTGAGAATGG - Intronic
953819028 3:46188346-46188368 TTCTTTGTGAAAAGAAAGAAAGG - Intronic
954273445 3:49527076-49527098 TTTTAACAGAAAATAGAGAAGGG - Intronic
954471404 3:50699087-50699109 TTCTATGTGATAGTAGAGAAGGG + Intronic
954635287 3:52067888-52067910 TTCCATCTGAAAAATGGGAAGGG - Intergenic
954964288 3:54596840-54596862 TTTTATCTGAGATCAGAAAATGG - Intronic
955963541 3:64365032-64365054 TTCCATTTTAAAACAAAGAAAGG - Intronic
956646331 3:71460745-71460767 TTCTAACCTAAAACAAAGAAAGG + Intronic
957785735 3:84879905-84879927 TTCAATCTGGTAACACAGAAAGG + Intergenic
958126642 3:89365133-89365155 CTCTGTCTGAGAATAGAGAAAGG + Intronic
959691826 3:109206052-109206074 TGCTACCTAAAAAAAGAGAATGG - Intergenic
959776348 3:110168729-110168751 GTCTAGCTGAAAAAAAAGAAAGG + Intergenic
960241060 3:115342389-115342411 TTCTGTGGGAACACAGAGAAGGG + Intergenic
962962052 3:140320278-140320300 CTCTACCTGAAAACTGAAAATGG - Intronic
962974626 3:140435128-140435150 TACTATCTGACAGCAGAGGAAGG - Intronic
963029970 3:140960440-140960462 TTCTATGTGGAAAGTGAGAAAGG - Intronic
963466845 3:145692852-145692874 TTATCTTTGAAAACACAGAAGGG + Intergenic
964106345 3:153044088-153044110 CTCTCTCTGAAAACAGAGTCTGG - Intergenic
965110442 3:164414364-164414386 TCCTGTCAGAAAACAGACAATGG - Intergenic
965167527 3:165214774-165214796 TTCTATGGAAATACAGAGAAGGG - Intergenic
965307263 3:167082181-167082203 TTGTATCTGAAAGCTAAGAATGG - Intergenic
966632215 3:182089754-182089776 TTTTATCAGAAATAAGAGAAAGG + Intergenic
966699930 3:182837776-182837798 TTGTTTCTGAAAGGAGAGAAAGG + Intronic
966884929 3:184372146-184372168 TTGAGTCAGAAAACAGAGAAAGG - Exonic
967083525 3:186072491-186072513 CTCTTTCTGAAAAAGGAGAATGG - Intronic
967366510 3:188692567-188692589 TGCTATCAGAGCACAGAGAAAGG - Intronic
967463714 3:189777653-189777675 TTCTATGGGAACAGAGAGAAAGG - Intronic
967740648 3:192998978-192999000 GTCTAACTGAAAACAAAGAGAGG - Intergenic
967862369 3:194161575-194161597 ATCTATGTAAAAACAGGGAAAGG - Intergenic
967901983 3:194464152-194464174 CTCCATCTCAAAAAAGAGAAGGG + Intronic
968319602 3:197753585-197753607 TTCAATCTAAAAAAAGAAAACGG - Intronic
969137131 4:5038616-5038638 ATCTATCTAAATACAGAAAAGGG + Intergenic
969322895 4:6423859-6423881 TTCTAACTTAAAACACACAAGGG - Intronic
970104367 4:12564086-12564108 TTCTATCTTCAAACAAAGCAAGG + Intergenic
970230199 4:13901946-13901968 TTTTAGCTGAAAAATGAGAATGG + Intergenic
970735921 4:19167753-19167775 TTTTATCTGAAAATGGAGAGAGG + Intergenic
971206075 4:24570589-24570611 TTCTATCTAATAGCAGAAAATGG + Intronic
971933900 4:33121692-33121714 TTGTATCTGAAAACTGTAAATGG - Intergenic
972127005 4:35780516-35780538 TTCAATCTGCCAAGAGAGAAAGG + Intergenic
972611897 4:40663335-40663357 TTCACTCTGAACACAAAGAACGG - Intergenic
972650029 4:41007938-41007960 TTCTTTGGGAATACAGAGAAAGG + Intronic
972995287 4:44871318-44871340 TTTTATGTGAAAGCCGAGAATGG - Intergenic
973168014 4:47102011-47102033 TTCTAATTAAAAACAGAGAGTGG - Intronic
974483019 4:62470355-62470377 CTCTGTCTGAAAAAAGAGAAGGG - Intergenic
975032625 4:69640268-69640290 TTCTTTGAGAAAACTGAGAATGG - Intronic
975824939 4:78309486-78309508 TCCTATCTGGAAAATGAGAATGG - Intronic
975929187 4:79497666-79497688 TTTTATCTAACAAAAGAGAATGG + Intergenic
976560991 4:86500551-86500573 TTCTTCCTGAGCACAGAGAAAGG - Intronic
976663706 4:87567381-87567403 TTCTAGCTGAAAACAGTCCAGGG + Intergenic
976741698 4:88363504-88363526 TTCTATTTAAAAAAAAAGAAAGG - Intergenic
977208542 4:94191532-94191554 TTCTATCTCAAAAAAAAAAAAGG + Intergenic
978066203 4:104405815-104405837 TTCTATCTTAAATCAGAAACTGG + Intergenic
978520072 4:109606306-109606328 TTCAATCAGAAGACAGAGAGTGG - Intronic
979246509 4:118512212-118512234 TTCTACTTGAAAAAAAAGAAAGG + Intergenic
979573687 4:122260529-122260551 TTCAATCTGATAAGTGAGAATGG - Intronic
980103934 4:128568980-128569002 CTGGATCTGACAACAGAGAATGG - Intergenic
981028653 4:140101478-140101500 TTCTATCTGTCAACAGATATTGG + Intronic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981423088 4:144573594-144573616 TTCTATCTGGAAAAATTGAATGG - Intergenic
982183451 4:152772337-152772359 TTCTATCTGTAAAAAAAAAAAGG + Intronic
982962896 4:161862793-161862815 TTCTTTCAGAAAAGAGACAAGGG - Intronic
982979316 4:162112031-162112053 TTATATCCAAAAACATAGAAAGG - Intronic
983359554 4:166710472-166710494 TTCTGTCAAAAAACATAGAATGG - Intergenic
985335366 4:188887143-188887165 TTCTATCAGAAAACAGAACTAGG - Intergenic
985359809 4:189161460-189161482 TTAAATCAGAAAAGAGAGAAGGG - Intergenic
985618907 5:942595-942617 TTCTAGAAGAAAACAGAGGAAGG - Intergenic
985945558 5:3179610-3179632 TGCTGTTTCAAAACAGAGAAGGG + Intergenic
986600664 5:9469407-9469429 GGCTACCAGAAAACAGAGAAAGG + Intronic
987189645 5:15462860-15462882 GTCTATCTGAAAATATACAAAGG - Intergenic
987370498 5:17188376-17188398 TTCTATCAAAAAAAAGAGAAAGG + Intronic
987516765 5:18920083-18920105 TTTTACCTCAAAACAGAAAATGG - Intergenic
987642559 5:20631501-20631523 TTGTATCTGAAAAAAAAGGAAGG + Intergenic
987698542 5:21364533-21364555 TTCTTCCAGGAAACAGAGAAGGG + Intergenic
987925626 5:24337133-24337155 TGAAATCTGAAAACAAAGAAAGG - Intergenic
987966579 5:24884889-24884911 TTCTATCTGAATACAGTAGAGGG + Intergenic
988556772 5:32243594-32243616 TGTTATCTGAAAAAAGAAAAAGG + Exonic
988754108 5:34227003-34227025 TTCTTCCAGGAAACAGAGAAGGG - Intergenic
989430563 5:41350217-41350239 TTCAATGAGAAAACAGAGGACGG - Intronic
989779881 5:45251343-45251365 TTTTCTATGAAAAGAGAGAATGG - Intergenic
990065232 5:51704826-51704848 TTCTTTATAAAAACAGAGAGAGG - Intergenic
990080848 5:51911791-51911813 TTTTATCTGAGGACTGAGAATGG + Intergenic
990114512 5:52371408-52371430 TTCTCTCTAAAAACAAATAAAGG + Intergenic
991741886 5:69687850-69687872 TTCTTCCAGGAAACAGAGAAGGG - Intergenic
991755805 5:69867358-69867380 TTCTTCCAGGAAACAGAGAAGGG + Intergenic
991793460 5:70267589-70267611 TTCTTCCAGGAAACAGAGAAGGG - Intergenic
991821272 5:70563153-70563175 TTCTTCCAGGAAACAGAGAAGGG - Intergenic
991835132 5:70742506-70742528 TTCTTCCAGGAAACAGAGAAGGG + Intergenic
991885837 5:71267122-71267144 TTCTTCCAGGAAACAGAGAAGGG - Intergenic
991988169 5:72310995-72311017 TTCTATTTAAAAAAAGAGATTGG + Intronic
992376242 5:76190462-76190484 TTCTTGCTGAAGACAGAGCAGGG + Intronic
993004096 5:82412429-82412451 TTGTTTCTGAAATCAGATAATGG + Intergenic
993930379 5:93931492-93931514 TTCTTTGTTAAAACATAGAATGG + Intronic
994089210 5:95794003-95794025 TTCTCTCTGAAAGCAGAAAAAGG + Exonic
995262032 5:110115442-110115464 GTCTATCTAAATATAGAGAAGGG - Intergenic
995348303 5:111146399-111146421 TTCTTTCTGGAAAAAGACAAAGG - Intergenic
996218269 5:120894736-120894758 TTCTATCTTAAACCTCAGAAAGG - Intergenic
996803859 5:127432989-127433011 TTCTCTGTGAAAACAAAGAATGG + Intronic
997534428 5:134607141-134607163 TTCTATTTTAGAACAAAGAATGG + Intronic
998440165 5:142153561-142153583 TTATATTTGATAATAGAGAAGGG + Exonic
998446766 5:142204785-142204807 TTTTAACAGAAAAAAGAGAAGGG - Intergenic
998725948 5:145015102-145015124 TGCTAGCTCAATACAGAGAAGGG - Intergenic
998909229 5:146940366-146940388 TTATATATGGACACAGAGAAAGG + Intronic
999276133 5:150331287-150331309 TCTTATCTGTAAACAGAGTAGGG - Intronic
1000248967 5:159475346-159475368 ATCTATCTCAACAAAGAGAAGGG + Intergenic
1001529469 5:172452234-172452256 TTCTATGTTAAAACATAGATTGG - Intronic
1003033342 6:2621647-2621669 TTCTATCTTAAAACATATGAAGG - Intergenic
1003275204 6:4644698-4644720 TTCCTTCAGAAAACAGAGAGAGG + Intergenic
1004704343 6:18109869-18109891 TTCTATCAGAAAATAAAGGAGGG + Intergenic
1005552288 6:26933845-26933867 TTCTTCCAGGAAACAGAGAAGGG - Intergenic
1007222455 6:40289878-40289900 TTCTCCCTGGAATCAGAGAAGGG + Intergenic
1008367922 6:50704402-50704424 CTCTATCTAAAAACAAAGACTGG + Intergenic
1008765945 6:54915351-54915373 TTCTAACGGACAACAGAGAAAGG - Intronic
1008884692 6:56419489-56419511 TTCTATTTGAAAATTGAAAATGG - Intergenic
1009317912 6:62245870-62245892 TACAATATGAAAACATAGAATGG - Intronic
1009351286 6:62682731-62682753 GTCTATCTGTAAACAATGAATGG - Intergenic
1009802054 6:68551085-68551107 TTCAATCAAAAAACATAGAAGGG + Intergenic
1010579021 6:77571107-77571129 TTATATCTCAAAACAGAAAGAGG + Intergenic
1011612116 6:89162771-89162793 CTCTATCTTAAAACAAAAAAAGG - Exonic
1011812092 6:91144445-91144467 TTCTTTCTGAAAGCAGTGAATGG + Intergenic
1012113660 6:95265832-95265854 TTCTATCTGTGATCAAAGAAAGG - Intergenic
1012980338 6:105822909-105822931 CTGTATCTGAAACCAGAGACTGG - Intergenic
1013707471 6:112855053-112855075 TTCTAAAAGAAAACATAGAAAGG + Intergenic
1013749735 6:113390843-113390865 TTCTATTTGAAAACATAGTGGGG - Intergenic
1015496981 6:133892476-133892498 ATATAACTGAAAACAAAGAATGG + Exonic
1015914153 6:138198340-138198362 TTCTATTTCAAAACAAAGATTGG - Intronic
1016287828 6:142492958-142492980 TTCTATTAGAAAGCAGACAAAGG + Intergenic
1017167109 6:151419068-151419090 TTCTGTCTCAAAAAAGAAAAAGG - Intronic
1017400076 6:154050687-154050709 TACTATCTGAAAGCACAAAAGGG + Intronic
1018455299 6:163946362-163946384 TTCTACCAGAAAACAGAAAGTGG - Intergenic
1018617050 6:165696468-165696490 TTAAATCTGACAACAGAGAGGGG - Intronic
1019832860 7:3350193-3350215 GTCTATCAGAAAACATAGGATGG + Intronic
1020412916 7:7913032-7913054 TTCTATCAGAACACATAAAAAGG + Intronic
1020605990 7:10337564-10337586 TTCTGTATCAAAACAGAAAATGG - Intergenic
1020825591 7:13023992-13024014 GTCTATCTGAAAGGAGAGAATGG + Intergenic
1021089188 7:16462224-16462246 TTATATTTTAAAACAGAAAAGGG - Exonic
1022361296 7:29661325-29661347 AACAATCTGAAAACAGAGATTGG - Intergenic
1022551581 7:31245009-31245031 TCATATTTGAAAACAGAGAAAGG - Intergenic
1024489514 7:49962801-49962823 TTCTAGAAGAAAACAGAAAAAGG + Intronic
1025625627 7:63218732-63218754 CTGGATTTGAAAACAGAGAAGGG - Intergenic
1025656487 7:63524439-63524461 CTGGATTTGAAAACAGAGAAGGG + Intergenic
1026189518 7:68112084-68112106 CTGGATTTGAAAACAGAGAAAGG - Intergenic
1026437590 7:70413311-70413333 CTCTATCCTAAAACAGAGGAGGG + Intronic
1027063454 7:75104127-75104149 TTCCATCTAAAAACAAAAAAAGG - Intronic
1027725934 7:81806116-81806138 TTCTGTCTCAAAAAAGAAAAAGG + Intergenic
1027751599 7:82154706-82154728 TACAATCTGAAAACAGAATATGG - Intronic
1027957761 7:84903449-84903471 TTCTATATTATAACAGACAAAGG + Intergenic
1028401042 7:90425748-90425770 TTTTATCTAAAAAGATAGAATGG - Intronic
1029366657 7:100120727-100120749 TTCTATCAGAATACAGCCAACGG + Intronic
1029556191 7:101270983-101271005 ATTTATCTGAAGAAAGAGAAAGG + Intergenic
1030575002 7:111274674-111274696 TTATATCTCAAAAGAGAGAAGGG + Intronic
1030930546 7:115519066-115519088 TTCTAACTAAAGATAGAGAAGGG - Intergenic
1031736780 7:125374489-125374511 TTCTAACTAAAAAAAGAGATGGG - Intergenic
1031793707 7:126143291-126143313 ATCACTATGAAAACAGAGAAGGG - Intergenic
1031829061 7:126603618-126603640 TTCTAACAGAATATAGAGAAAGG + Intronic
1031926553 7:127643985-127644007 TTCTGTCTTGAAAGAGAGAATGG + Intergenic
1032060640 7:128722142-128722164 TTCTTTCAGAAAATAGAGGAGGG - Intronic
1032287566 7:130552971-130552993 TGCTATGTGAATACACAGAAAGG + Intronic
1032915296 7:136482881-136482903 ATCTTTCTTAAATCAGAGAAAGG + Intergenic
1033025856 7:137771548-137771570 TTCTCTCTTAAACAAGAGAAAGG + Intronic
1033103205 7:138494560-138494582 TTCTTTTTTAAAACACAGAAGGG - Intronic
1034291474 7:149935825-149935847 TTCTATTTGAGAAAAGAGAAAGG + Intergenic
1034464658 7:151219615-151219637 TTCTATCTGCAAACAAAAACTGG + Intronic
1036028516 8:4938719-4938741 TTCGATCTGAAATCTGAGAATGG + Intronic
1036760343 8:11504314-11504336 TTCCATCTCAAAATAAAGAAAGG + Intronic
1037438339 8:18888476-18888498 TTCCATCTGAAAAAAAAAAACGG + Intronic
1039047014 8:33459755-33459777 TTCAATTTGAAATCAGTGAAGGG + Intronic
1039904513 8:41776252-41776274 TTTTTTCTGAATAGAGAGAATGG - Intronic
1041007124 8:53506377-53506399 TTCTATCTGTAGAGAAAGAAAGG - Intergenic
1041258333 8:55998329-55998351 TGCAATCTGAAAACAGAAATAGG - Exonic
1041579685 8:59444509-59444531 TCCAATCAGAAAATAGAGAAAGG - Intergenic
1041833613 8:62185267-62185289 TTCTTTCTGAAAACATGAAATGG - Intergenic
1042086709 8:65117250-65117272 TCCTTTCTGAAAACAGAGACTGG + Intergenic
1042276346 8:67008925-67008947 TTTTAACTCCAAACAGAGAAAGG - Intronic
1042982968 8:74551216-74551238 TTCTATCTGGAAAGAAAGCATGG - Intergenic
1043091966 8:75915700-75915722 TTATATTTGACAGCAGAGAAGGG - Intergenic
1043321348 8:78990535-78990557 TCTTACTTGAAAACAGAGAATGG - Intergenic
1045827023 8:106410050-106410072 CTCAATCTGAAAACTGACAATGG + Intronic
1046169269 8:110484048-110484070 TGCTCTCTCAAAAGAGAGAACGG - Intergenic
1047225059 8:122949315-122949337 CTCTATCTGAAAAGAAAAAAAGG + Intronic
1047800052 8:128299663-128299685 TGCTATGGGAACACAGAGAAGGG - Intergenic
1048687704 8:136923181-136923203 TACTCTCTGACAACAGAGAGAGG - Intergenic
1048918944 8:139210393-139210415 TTCTTTCTGAATGCAGACAATGG - Intergenic
1050150559 9:2615740-2615762 TTCTATCTCACGACAGAGCAAGG - Intergenic
1052002803 9:23307283-23307305 TTCTCTCTGAACACAGAGGCAGG + Intergenic
1052380850 9:27769180-27769202 TTCTCTCTGAGCACAGAGATGGG - Intergenic
1052881355 9:33602643-33602665 TTCTTTCTGAAGCCAGGGAAGGG - Intergenic
1053802616 9:41773947-41773969 GTCTATCAGCAAAAAGAGAAGGG + Intergenic
1054142622 9:61541123-61541145 GTCTATCAGCAAAAAGAGAAGGG - Intergenic
1054190922 9:61985293-61985315 GTCTATCAGCAAAAAGAGAAGGG + Intergenic
1054462372 9:65472273-65472295 ATCTATCAGCAAAAAGAGAAGGG - Intergenic
1054647447 9:67602424-67602446 GTCTATCAGCAAAAAGAGAAGGG - Intergenic
1054986327 9:71266128-71266150 TACAATATGAAAACAGAGAATGG - Intronic
1055715180 9:79109646-79109668 ATCTATCATAACACAGAGAAAGG - Intergenic
1055995629 9:82156396-82156418 TTCTATCTGAAAATTGTTAAAGG + Intergenic
1056248606 9:84724603-84724625 TTCTATCAGAAAAAAGACAGAGG - Intronic
1056365042 9:85896330-85896352 ATCTATCTAAAAACAAATAAAGG + Intergenic
1056737712 9:89223991-89224013 TTCTTCCTGAAGACAGAGAGAGG - Intergenic
1059130175 9:111739632-111739654 TTCTACCTGAAAAAAAGGAATGG - Intronic
1060098784 9:120818936-120818958 TTTTATCTAAGAACAGAGGAAGG + Intronic
1062403796 9:136383912-136383934 CTTTATCTGAAACCAGACAATGG - Intronic
1062496666 9:136835095-136835117 CTCTATTTAAAAAAAGAGAAGGG + Intronic
1186180643 X:6969523-6969545 TTGTGTCTGAAAACTGTGAAGGG + Intergenic
1186378968 X:9036723-9036745 TTGTATTTGAGAAGAGAGAAAGG + Intronic
1186395000 X:9199087-9199109 TTCTGCCTGAAAACATAAAAGGG + Intergenic
1186940113 X:14497484-14497506 TTCTCCTTGAAGACAGAGAAGGG + Intergenic
1186966522 X:14792306-14792328 TTTGATCTGAAAAAAGAGCAAGG + Intergenic
1187123492 X:16431828-16431850 TTCCATCTGAAATCAGATATGGG - Intergenic
1187131878 X:16511137-16511159 TCCCATTTGAAAAAAGAGAAGGG + Intergenic
1187194510 X:17070154-17070176 TCATACCTGAAAAGAGAGAAAGG - Intronic
1188418631 X:29969837-29969859 CTCTGTCTTAAAACAGAAAAAGG + Intergenic
1190451876 X:50590251-50590273 TTCTGTCTCAAAAAAAAGAAAGG - Intergenic
1193542012 X:82783463-82783485 TTCTTTCAGAAAACTGAAAAAGG - Intergenic
1194223279 X:91223387-91223409 TCATTTCTGAAAACAGAGAATGG + Intergenic
1194737620 X:97531325-97531347 TTCTATTAGAAAACAAAGAAAGG - Intronic
1195601483 X:106753642-106753664 TTCAATCAAAAAACATAGAATGG + Intronic
1195762136 X:108257947-108257969 TTCTATATGAAAATAGGGAAGGG + Intronic
1195848147 X:109251077-109251099 ATGTATCTGCAAACAGAGACAGG + Intergenic
1196081906 X:111641615-111641637 TCCTATCTCAAAACAAAAAAAGG - Intergenic
1196218750 X:113087384-113087406 TTCAATCTGAAAAATGAGAGTGG + Intergenic
1196377069 X:115045069-115045091 TTCTACCTGTTAACAGAGAATGG + Intergenic
1198253160 X:134901640-134901662 CTCTATCTCAAAAAAAAGAAAGG + Intronic
1198603717 X:138313573-138313595 TTCTTTCTAAAAACAGTGAAAGG + Intergenic
1199126370 X:144126439-144126461 TCCTATCTGAAGATAAAGAAAGG + Intergenic
1200559752 Y:4686776-4686798 TCATTTCTGAAAACACAGAATGG + Intergenic
1200851802 Y:7891240-7891262 ATCCATCTGCAAAGAGAGAAAGG - Intergenic