ID: 1086158685

View in Genome Browser
Species Human (GRCh38)
Location 11:83696231-83696253
Sequence AGGGAGAACTAATATTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086158679_1086158685 17 Left 1086158679 11:83696191-83696213 CCTGATCTTAGATGGCAGCAGTG 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1086158685 11:83696231-83696253 AGGGAGAACTAATATTAGGAAGG 0: 1
1: 0
2: 2
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086158685 Original CRISPR AGGGAGAACTAATATTAGGA AGG Intronic
905452436 1:38065286-38065308 AGGGAGAAGTCGTAGTAGGAGGG + Intergenic
905660633 1:39720886-39720908 AGGGAAAATTAATATCAGGCTGG - Intronic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905980768 1:42224683-42224705 AAGAAAAAATAATATTAGGATGG + Intronic
908203156 1:61818603-61818625 ATTCAGAACTAATATTAGGTAGG + Intronic
910380004 1:86616037-86616059 AGGGAGAACTAACATAATCAAGG + Intergenic
910638225 1:89432402-89432424 AATGTGAATTAATATTAGGAAGG + Intergenic
911061118 1:93748603-93748625 AGTGAGAAATAATATTGAGAGGG - Intronic
915006996 1:152647586-152647608 AAAGAGAACAAATATTGGGAGGG - Intergenic
915952022 1:160195808-160195830 TGGGGGAACAAATATTAGGAAGG - Intronic
916551342 1:165852726-165852748 AGAAAGAACTTATATAAGGAAGG - Intronic
916753336 1:167743504-167743526 AGGAAGAATTAATATTGCGAAGG - Intronic
916874157 1:168950936-168950958 AGGAAGAAATATTATGAGGATGG + Intergenic
917678201 1:177340229-177340251 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
921714905 1:218407878-218407900 AGGATGAAGTAATATTTGGAGGG + Intronic
924313426 1:242771166-242771188 AGGGAGAAGGAATATTAGATAGG - Intergenic
924427709 1:243968443-243968465 AGGGAGAACTAAAATTTGCAAGG + Intergenic
924908854 1:248487312-248487334 AGGAAGAACTAGAATTTGGAGGG - Intergenic
924915253 1:248560750-248560772 AGGAAGAACTAGAATTTGGAGGG + Intergenic
1063799978 10:9564475-9564497 AGGAAGAACTAACATTTTGAAGG + Intergenic
1064651298 10:17512615-17512637 AGACAGAACTCATATCAGGAAGG - Intergenic
1064786670 10:18905244-18905266 ATGGATAACTCATTTTAGGAAGG + Intergenic
1065488271 10:26255416-26255438 AGGGAGAACTAATACAGGCAAGG + Intronic
1065602929 10:27388102-27388124 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
1066966269 10:42268846-42268868 AGGATGAACTAATTTTGGGAAGG + Intergenic
1068647700 10:59486545-59486567 ATGGATAACTAATTTTAAGAAGG - Intergenic
1070012216 10:72487103-72487125 AGGGAAAACTTGTTTTAGGAAGG + Intronic
1071437181 10:85658189-85658211 GGTGAAAACTAATATTAGCAGGG - Intronic
1072579222 10:96725464-96725486 GGGGAGAATGAATATTAGGTGGG - Intergenic
1078357872 11:10646367-10646389 AGGGAGGGCTAATGTTAGGAAGG - Intronic
1078453042 11:11454449-11454471 AGGGAGAAGGAAGATAAGGAGGG + Intronic
1078947387 11:16084860-16084882 AGGTAGATCTAAAATCAGGAGGG + Intronic
1080950660 11:37028932-37028954 AGAGAAAACTAACAATAGGAGGG - Intergenic
1082272509 11:50186649-50186671 AGGCTGAACTAATTTTGGGAAGG - Intergenic
1082785417 11:57313751-57313773 AGGGAGAACTCTTATCAGGCGGG + Exonic
1086158685 11:83696231-83696253 AGGGAGAACTAATATTAGGAAGG + Intronic
1087256052 11:95955328-95955350 TGAGAGCATTAATATTAGGATGG - Intergenic
1087276943 11:96170235-96170257 AGGGAGAAATAATAAAAGGCTGG - Intronic
1087870551 11:103288407-103288429 AGGCAGAACTAACCTTGGGAAGG + Intronic
1087980513 11:104607787-104607809 AGGAAGGAATAATAATAGGAGGG - Intergenic
1088820664 11:113453948-113453970 GGATGGAACTAATATTAGGAAGG + Intronic
1089419353 11:118319534-118319556 AGGGAGAGCTTATCTTAGCATGG - Intergenic
1089584653 11:119502639-119502661 AGGGAGCACTAATAGGAGAAGGG - Intergenic
1090532577 11:127606380-127606402 TGGGAGAAATAGTATTCGGATGG - Intergenic
1092893396 12:12990585-12990607 AGGCCGAACTAATTGTAGGAAGG + Intronic
1093441965 12:19209299-19209321 ATGGATAACTCATTTTAGGAAGG + Intronic
1094129238 12:27057065-27057087 ATGGATAACTCATTTTAGGAGGG - Intronic
1097370320 12:58770855-58770877 AGGGAGAATGAATATTAAAATGG + Intronic
1097607010 12:61768312-61768334 AGGTAGAACTAATAGTAGGTAGG + Intronic
1097975082 12:65676822-65676844 AGGGAGAAATAATAGAAGGACGG + Intergenic
1100913583 12:99392335-99392357 GAGGAGAACTAAAATTAGAATGG - Intronic
1102622986 12:114211501-114211523 AGGGAGAGCTGATATAAGGATGG + Intergenic
1106905764 13:34407509-34407531 AGGGAGCACTAATTGTAGGAAGG - Intergenic
1107651139 13:42546424-42546446 AGGGAGAATTAACATTAAGATGG + Intergenic
1110687550 13:78392979-78393001 AAAGAGGACTAATATTAGTAAGG + Intergenic
1110812992 13:79830827-79830849 AGGGAGCTCTAGAATTAGGAAGG - Intergenic
1111639772 13:90953112-90953134 TGGGAGTACCAATATAAGGAAGG - Intergenic
1112263944 13:97905155-97905177 AGGGAGAACTCATAAGAGTAAGG - Intergenic
1114354565 14:21893079-21893101 AGGGAGAACTGATTTCAGGCTGG + Intergenic
1114486427 14:23065111-23065133 AGGCAGAACTAAGATCATGATGG + Intronic
1114574860 14:23702992-23703014 AGGGAGGACTTGTAGTAGGAAGG + Intergenic
1115159588 14:30378398-30378420 GAGGAGAACTAGTCTTAGGATGG + Intergenic
1116075835 14:40109400-40109422 ATGGAGAACTAATTGTAGAAAGG - Intergenic
1117120539 14:52563742-52563764 AGGGAGAAAGAATATTGAGAAGG - Intronic
1117426768 14:55607714-55607736 AGAGGTAACTAATATTAGAAAGG + Intronic
1118495598 14:66305359-66305381 AGGCAGAACTGACAGTAGGAAGG - Intergenic
1118667560 14:68086685-68086707 AGGGAGAATTAATCTTAGGATGG + Intronic
1120717493 14:87855398-87855420 GGGGAGAACAAGTATAAGGAAGG + Intronic
1121379980 14:93456589-93456611 TGGGAAAAATAATCTTAGGAGGG - Intronic
1122218738 14:100221852-100221874 AGGGAGAAGGAATATTGGGGAGG + Intergenic
1124032855 15:26027136-26027158 AGGCAGAACTAACTTTGGGAAGG - Intergenic
1126612217 15:50541053-50541075 AGGGAGCATTCATATTTGGATGG + Exonic
1127496401 15:59516498-59516520 AGGGAGAACGGATATTATGGTGG + Intronic
1128666705 15:69543562-69543584 AGAGATAACTAATATTACGGGGG + Intergenic
1128686175 15:69687342-69687364 AGGGAGAAGGAAAGTTAGGAAGG + Intergenic
1129545576 15:76391509-76391531 AGGGAGAACTGATCTTAGCAAGG + Intronic
1132534152 16:468813-468835 AAGGAAAACTAATATGAGAATGG + Intronic
1136753769 16:32665872-32665894 TGGGAGAACTGTTATTAGGGTGG - Intergenic
1136814343 16:33204493-33204515 TGGGAGAACTGTTATTAGGGTGG + Intronic
1136820819 16:33314573-33314595 TGGGAGAACTGTTATTAGGGTGG + Intergenic
1136827382 16:33371112-33371134 TGGGAGAACTGTTATTAGGGTGG + Intergenic
1136832448 16:33469883-33469905 TGGGAGAACTGTTATTAGGGTGG + Intergenic
1138618462 16:58191749-58191771 AGGCAGAACCAATAGTAGAAAGG - Intronic
1141175715 16:81717619-81717641 AGGCCGAACTAACTTTAGGAAGG - Intergenic
1202992919 16_KI270728v1_random:27467-27489 TGGGAGAACTGTTATTAGGGTGG + Intergenic
1144148037 17:12416981-12417003 GGGAAGAATTGATATTAGGAAGG - Intergenic
1145028938 17:19489867-19489889 AGGGAGAACAAATCTTAGAATGG + Intergenic
1146554476 17:33811987-33812009 AGGGACATCTAATATTCAGAGGG - Intronic
1149095982 17:52841565-52841587 ATGGAGAACTAAGATTAGGATGG + Intergenic
1155503269 18:26507661-26507683 AGGGAGAAATACTGTTAGAAAGG - Intronic
1156413322 18:36858257-36858279 CAGGACAACTAATATTAGCAGGG - Intronic
1157020337 18:43773769-43773791 TGGAAGAACTAATATCAGTATGG - Intergenic
1157121027 18:44911287-44911309 AGAGAGAATTTATATTAGGTTGG + Intronic
1157768416 18:50323103-50323125 ATGGATAACTTATTTTAGGAAGG + Intergenic
1158270631 18:55711388-55711410 TGGGAGAACAAATATGAGAATGG - Intergenic
1159043552 18:63347136-63347158 GGGAAGAAGTAATAGTAGGATGG - Intronic
1164479473 19:28600299-28600321 AGTGAGTAGTAATCTTAGGACGG - Intergenic
1165301109 19:34969834-34969856 AGGGAGAACTATTATTACTGTGG + Intergenic
1167212256 19:48140439-48140461 AGGCAGAACTAACTTTGGGAAGG + Intronic
1167724851 19:51203876-51203898 TGGTAGAATTAATATTAAGATGG + Intergenic
925980233 2:9170682-9170704 AGGCAGAACTAACCTTGGGAAGG + Intergenic
927625594 2:24714000-24714022 AGGAAGAACAACTATCAGGAAGG + Intronic
928825072 2:35410292-35410314 AGGGAGATCAGATATTAGGGTGG + Intergenic
930763156 2:55058037-55058059 AAAGAGAACTAAAACTAGGATGG + Intronic
931418933 2:62107860-62107882 ATGGAGAGCTATTATGAGGAAGG - Intronic
933335777 2:80956890-80956912 AGGGAGAATTAATATGAAAATGG - Intergenic
933578781 2:84101258-84101280 TGGGGGAACAAATATTAGAAAGG + Intergenic
933738747 2:85516348-85516370 AGGGAGAACAAATATTATTGTGG - Intergenic
934313777 2:91896420-91896442 AGGATGAACTAATTTTGGGAAGG - Intergenic
937643938 2:124244624-124244646 AGGGAGAAGTGATTTGAGGAGGG + Intronic
938377430 2:130817840-130817862 GGAGAGAAATAAGATTAGGAAGG + Intergenic
941004490 2:160234037-160234059 ATGGATAACTCATTTTAGGAAGG + Intronic
942076131 2:172358742-172358764 CTGGAAAACTAATATGAGGAGGG + Intergenic
942664047 2:178297449-178297471 AAAAAGAACTAATATTAGGGTGG + Intronic
943067561 2:183105155-183105177 AAGGAGAGGTAATAGTAGGAAGG - Intergenic
944382034 2:199122118-199122140 TTGGAGAACAAATATTTGGATGG + Intergenic
944467276 2:200015279-200015301 AGGAAGAAATAAGATTAGAAAGG - Intergenic
945228743 2:207561183-207561205 GGAGAGAACTATTATTAGAAAGG + Intronic
945330504 2:208534427-208534449 CAAGAGAACTAATATTAGAAGGG + Intronic
946641622 2:221789829-221789851 AAGGAGAAATAGTTTTAGGATGG - Intergenic
947191067 2:227505390-227505412 AGGCAGAAAAAATATTTGGAAGG - Intronic
947216190 2:227752485-227752507 AGGCCGAACTAACTTTAGGAAGG + Intergenic
947853401 2:233306709-233306731 AGGCAGAAATAATAGTGGGAAGG + Intergenic
948161958 2:235832290-235832312 AAGGAGAACAATTATTAGGAGGG - Intronic
949029452 2:241785077-241785099 AGGGAGAATTATTATGAGGCTGG + Intronic
1170016398 20:11786860-11786882 AGGGAGAAACAATCCTAGGATGG - Intergenic
1173746981 20:45445132-45445154 AGGCAGAACTAACCTTAGGAAGG - Intergenic
1174716812 20:52767584-52767606 AAGGAGAACTAAAGTGAGGATGG - Intergenic
1175476239 20:59276693-59276715 AGGGAGAACAGATGTTGGGAAGG + Intergenic
1177680172 21:24357521-24357543 AGGAAGAATTAATATTAAAATGG - Intergenic
1178575346 21:33783164-33783186 AAGGAAAACAAATATTTGGAGGG - Intronic
1178579958 21:33830000-33830022 AGTGAGAACTCATATGACGAGGG + Intronic
1182822463 22:33229247-33229269 AGTGGAAACTAATATTTGGATGG - Intronic
949410229 3:3755470-3755492 ATTGAGAAATAATATTAGGTTGG - Intronic
949774583 3:7618259-7618281 ATGGAGAAATAATGTTAGGTAGG + Intronic
950573026 3:13813741-13813763 ATGGAGAACTAATATAGTGATGG + Intergenic
950598594 3:14009600-14009622 ATGGATAACTAATTTTAAGAAGG - Intronic
952474982 3:33699290-33699312 AGGTAGAAGAAATATTTGGAGGG + Intronic
953787720 3:45923215-45923237 AGGGAGAAATAAAAGAAGGAAGG - Intronic
954052670 3:47994404-47994426 AGGGTAAGTTAATATTAGGATGG - Intronic
954344097 3:49981610-49981632 CAGGAGAACTGATATTAGGTAGG - Intronic
956295711 3:67711365-67711387 AGGGAGAAATTATTTTAGGAAGG + Intergenic
957262303 3:77917933-77917955 AGAGATAACAAATATTGGGAAGG - Intergenic
957892046 3:86372468-86372490 AAGGAGAATTAAAAATAGGAGGG + Intergenic
959397605 3:105860637-105860659 AGGGAGAAGAAATATTAAGAAGG - Intronic
961517157 3:127445078-127445100 AGGGAGAACTGGTATTTGGTTGG - Intergenic
962137375 3:132749705-132749727 AGGCAAAACTAATATAAGGGGGG - Intergenic
962188244 3:133282665-133282687 AAGGAGAAATAAAATTATGATGG - Intronic
962998530 3:140654514-140654536 AGGGAGAAATAAGAGTAGAAAGG + Intergenic
963034383 3:141012918-141012940 AGGGAGAAAGGATATTAGGGTGG + Intergenic
964186676 3:153953733-153953755 AGTGTGAATTAATGTTAGGAAGG - Intergenic
964713755 3:159699531-159699553 AGGGAGAACCAAGATTATGCTGG + Intronic
965421223 3:168461329-168461351 AGGGACAGCTAATAATAGTATGG - Intergenic
967621159 3:191635881-191635903 TGGAAGAAGTAATATTAGGAAGG - Intergenic
977516779 4:98030527-98030549 AGGGAAAACTAAAATTCAGATGG + Intronic
978606636 4:110487332-110487354 AGGCCGAACTAATTTTGGGAAGG - Intronic
979028487 4:115608097-115608119 ATGGAAAACAGATATTAGGAAGG - Intergenic
980788850 4:137592247-137592269 AAGAAGAACTAACATTAGCAAGG + Intergenic
981410982 4:144431559-144431581 AAGGATAAGTAATAATAGGAGGG - Intergenic
981914760 4:150021824-150021846 AGGGAGAACAGATATCAGGGTGG + Intergenic
983546255 4:168967517-168967539 AGGGAGTTCTATTATTATGAAGG + Intronic
988729424 5:33955985-33956007 ATGGATAACTCATTTTAGGAAGG + Intronic
990317835 5:54600841-54600863 AGGGAGAGAGAGTATTAGGAAGG + Intergenic
990907616 5:60820670-60820692 TGGGAGAACGAATAATAGAAGGG - Intronic
991385901 5:66089543-66089565 AGGGATAACAAATAGTAAGATGG + Intergenic
992325069 5:75652391-75652413 AAGGGGAGCTATTATTAGGATGG - Intronic
992541102 5:77764828-77764850 ATGGAGAATTTATATTGGGATGG - Intronic
993272818 5:85817079-85817101 AGGTGGAACTAATCTTGGGAAGG + Intergenic
995842897 5:116461319-116461341 GGGGAGTACTAATAATGGGAGGG - Intronic
996929392 5:128868282-128868304 AGGGAGATGTAATATTATCATGG - Intronic
1000620108 5:163474992-163475014 TGGGAAAACTAAAATTAGGGGGG + Intronic
1001240542 5:170066427-170066449 AGGGAGACATAATGTTAGTAGGG + Intronic
1002353964 5:178608522-178608544 AGGGAGCACTCATATAGGGAAGG - Intronic
1002696589 5:181096130-181096152 GGGGAGAACTCATAATAGGGAGG + Intergenic
1002698033 5:181103243-181103265 GGGGAGAACTCATAATAGGGAGG - Intergenic
1003613524 6:7634717-7634739 AGAAAGAAATAATATTAGCAAGG - Intergenic
1004325171 6:14668174-14668196 AGTGAAATCTAATATTATGAGGG - Intergenic
1005475754 6:26205988-26206010 AGGGAGAAGTAATCCCAGGATGG - Intergenic
1008509085 6:52259580-52259602 TGGGAGAACTATTATCAGAATGG + Intergenic
1010186742 6:73153081-73153103 GGGGATAACTAAGATAAGGAAGG - Intronic
1010790461 6:80058192-80058214 GAGGAGAACTAAGAGTAGGAGGG + Intergenic
1010859687 6:80893919-80893941 TGGGAGAGGTAATAATAGGAAGG - Intergenic
1014997444 6:128167804-128167826 AAGTAGAAGTAATATTAAGAAGG - Intronic
1015268305 6:131312186-131312208 TGGTAGAACTAATCTTAGCAAGG + Intergenic
1015517982 6:134103124-134103146 AGTGAGAACAAAAATTAGGGAGG + Intergenic
1016028650 6:139314834-139314856 AGGGCGAACTAACTTTGGGAAGG + Intergenic
1016743265 6:147550917-147550939 ACTGAGAACTAATAATGGGAGGG - Intronic
1020634123 7:10675516-10675538 GGAGAAAACTAATATTAGAAAGG + Intergenic
1021073176 7:16268386-16268408 AGGTTGAACAAATATTGGGATGG - Intronic
1021396317 7:20152937-20152959 AGGAAAAACAAATATTATGAGGG - Intronic
1022131058 7:27405027-27405049 ATGGAGAACCAAAAATAGGAAGG + Intergenic
1022756027 7:33291424-33291446 TGGGAGAAATAACATAAGGAAGG - Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1024798038 7:53041841-53041863 ATGGAGAACTTATTTTAAGAAGG + Intergenic
1024906812 7:54392478-54392500 AGGGAGAATTATTATGAGGCTGG + Intergenic
1024967868 7:55040362-55040384 AGGGATAATTAATAGGAGGAAGG + Intronic
1025012443 7:55408320-55408342 AGGGAGAACACACAATAGGAGGG + Intronic
1025143559 7:56485044-56485066 AGGGACATCAATTATTAGGAAGG - Intergenic
1025624481 7:63207719-63207741 AGGCTGAACTAATTTTGGGAAGG - Intergenic
1026187256 7:68091564-68091586 AGGGAGAACCATTGTTAGTAGGG + Intergenic
1027206872 7:76107324-76107346 ACAGAGAACTAAGAATAGGATGG - Intergenic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1028229375 7:88287936-88287958 AGGCAGAACTAACCTTGGGAAGG - Intronic
1028509437 7:91607612-91607634 AGGGAGAAATCACATTAGGATGG - Intergenic
1032528260 7:132596732-132596754 AGGGAGAAATACCATTAAGAAGG + Intronic
1033177953 7:139143706-139143728 ATAGAGAACTAATAACAGGATGG - Intronic
1033327117 7:140389076-140389098 AGGCTGAACTAACTTTAGGAAGG + Intronic
1034210919 7:149361781-149361803 CAGGAGAACTAGAATTAGGAGGG + Intergenic
1037003814 8:13752054-13752076 AGGGAGAACTATTGTTCTGAGGG + Intergenic
1037645669 8:20790623-20790645 AGGGAGAAATAATATGAAGGAGG - Intergenic
1038091872 8:24263336-24263358 AAGGAGAGTTTATATTAGGATGG - Intergenic
1045500903 8:102743709-102743731 TGGGAGAAGTGATATTTGGATGG + Intergenic
1046175850 8:110574089-110574111 AATGAGAATTAATATTAGGTTGG + Intergenic
1046875293 8:119248448-119248470 AAGGAGAAGTAAGATTAGGTAGG + Intergenic
1047019943 8:120764848-120764870 AGAGAGAATTGATATTAGGGAGG - Intronic
1048519697 8:135142110-135142132 AGGGAGAAGGAATAGAAGGAAGG + Intergenic
1048802966 8:138211077-138211099 AGAGAGAGCTAACATTAGCACGG - Intronic
1050521593 9:6506538-6506560 AGGCACAACTAATATTTGGGAGG - Exonic
1051319182 9:15882035-15882057 AGGGAGAATGTATATTAGTAAGG - Intronic
1051772772 9:20596890-20596912 TGGGAGACTTAATATTACGATGG - Intronic
1052200948 9:25779166-25779188 ACTGAGAACTAACATGAGGAGGG - Intergenic
1055707783 9:79026112-79026134 AGGAAAAAATAATATTAGAAAGG + Intergenic
1058114679 9:101071307-101071329 AGGAAGAACAGATATTTGGAGGG + Intronic
1060046539 9:120346030-120346052 GGGCAGAAATAATATTGGGAAGG + Intergenic
1186280936 X:7992442-7992464 AGGGAGAAATAATGGCAGGAAGG - Intergenic
1187245872 X:17552527-17552549 AGGGAGAAAGAAGATGAGGAAGG + Intronic
1187693367 X:21894179-21894201 AAGGAGAAATAAGATTTGGATGG + Intergenic
1187956210 X:24521536-24521558 AGAGAGAAAGAATATTAAGATGG - Intronic
1188182983 X:27078098-27078120 AGGGAGTACAAATATTATGTGGG + Intergenic
1188285917 X:28325260-28325282 AGGGAGAACATTTATTAGGTAGG - Intergenic
1189587059 X:42472900-42472922 AGGAAGAACTAAAAATAGGAAGG + Intergenic
1191086885 X:56577825-56577847 TGGGAGAACCAATATTAAAATGG - Intergenic
1191605197 X:63054029-63054051 AGGGAGAATTAATTTTGGGCAGG + Intergenic
1194931760 X:99896901-99896923 ATAGATAACTCATATTAGGAAGG - Intergenic
1195270772 X:103228352-103228374 ACGGATAACTCATTTTAGGAAGG + Intergenic
1196943269 X:120798637-120798659 AGGGAGAAGCAATGTCAGGATGG + Intergenic
1197165272 X:123370245-123370267 AGGGAGAAGGAAAAGTAGGATGG - Intronic
1201630625 Y:16068448-16068470 AGGCTGAACTAACTTTAGGAAGG + Intergenic
1201887851 Y:18905887-18905909 AAGCAGAACTAATATTTGCAAGG + Intergenic