ID: 1086163449

View in Genome Browser
Species Human (GRCh38)
Location 11:83749377-83749399
Sequence CAGGATTTGCATCTTTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 859
Summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 795}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086163449_1086163453 17 Left 1086163449 11:83749377-83749399 CCAAGAAAAAGATGCAAATCCTG 0: 1
1: 0
2: 3
3: 60
4: 795
Right 1086163453 11:83749417-83749439 AAACAGCAACCACAAGGCCTAGG 0: 1
1: 0
2: 4
3: 14
4: 283
1086163449_1086163454 25 Left 1086163449 11:83749377-83749399 CCAAGAAAAAGATGCAAATCCTG 0: 1
1: 0
2: 3
3: 60
4: 795
Right 1086163454 11:83749425-83749447 ACCACAAGGCCTAGGAATAAAGG 0: 1
1: 0
2: 0
3: 13
4: 137
1086163449_1086163456 26 Left 1086163449 11:83749377-83749399 CCAAGAAAAAGATGCAAATCCTG 0: 1
1: 0
2: 3
3: 60
4: 795
Right 1086163456 11:83749426-83749448 CCACAAGGCCTAGGAATAAAGGG 0: 1
1: 0
2: 2
3: 27
4: 189
1086163449_1086163452 11 Left 1086163449 11:83749377-83749399 CCAAGAAAAAGATGCAAATCCTG 0: 1
1: 0
2: 3
3: 60
4: 795
Right 1086163452 11:83749411-83749433 GTCTAGAAACAGCAACCACAAGG 0: 1
1: 0
2: 1
3: 14
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086163449 Original CRISPR CAGGATTTGCATCTTTTTCT TGG (reversed) Intronic
900871053 1:5303539-5303561 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
902169248 1:14597820-14597842 CAGGCTTTGCATTTTTCACTGGG - Intergenic
904155315 1:28478224-28478246 CAGGATTTCTTTCTTTTTCATGG + Intronic
904989135 1:34577355-34577377 CAGAATTTCCTTCTTTTTCAAGG + Intergenic
905580277 1:39078942-39078964 CAGGATTTTCTTCTTTTTAAAGG + Intergenic
905859848 1:41342864-41342886 CAGGCTGTGCTTCCTTTTCTGGG - Intergenic
905921298 1:41720863-41720885 CAGGATTTCCTTCTTTTTTAAGG - Intronic
906734565 1:48113142-48113164 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
907022524 1:51082333-51082355 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
907713103 1:56902815-56902837 CAGGATTTTCTTCTTTTTAAAGG + Intronic
908180575 1:61600800-61600822 CAGAATTTGCTTCCTTTTCAAGG - Intergenic
908371192 1:63479769-63479791 CAGGATTTCCCTCTTTTTAAAGG + Intronic
909385427 1:75050001-75050023 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
909406378 1:75294695-75294717 CAGGATTTTCTTCTTTTTTAAGG - Intronic
909532605 1:76698861-76698883 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
909607814 1:77524107-77524129 CAGAATTTCCTTCCTTTTCTGGG + Intronic
909667872 1:78155631-78155653 CAGTATATGCATCTTTTTCATGG - Intergenic
909823524 1:80096927-80096949 CAGGATATTCATTTTTCTCTAGG + Intergenic
910387399 1:86700389-86700411 CAGGATTTCCTTCTTTTTAGAGG - Intergenic
910486629 1:87721930-87721952 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
910633016 1:89376123-89376145 CAGGATTTCCTTCTTTTTGAAGG + Intronic
910873185 1:91853587-91853609 CAGGATTTCCTTCTTTTTTAAGG - Intronic
911183362 1:94880357-94880379 CAGGATTTCCTTCTTTTTTAAGG - Intronic
911214265 1:95175361-95175383 CAGGATTTTCTTCTTTTTAAAGG + Intronic
911606065 1:99906704-99906726 CAGGATTCCCTTCTTTTTCAAGG + Intronic
911630884 1:100182069-100182091 CAGGATTTCTTTCTTTTTCAAGG + Intergenic
911683993 1:100752665-100752687 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
911753619 1:101527217-101527239 CAAGATTTGCTTCTTTTTAGGGG + Intergenic
912053960 1:105570786-105570808 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
912126049 1:106539448-106539470 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
912148788 1:106830444-106830466 CAGGATTTCCTTCTTTTTTATGG - Intergenic
912307775 1:108588031-108588053 CAGGATTTCCTTCTTTTTTAAGG + Intronic
912394845 1:109334353-109334375 CAGGATTTCCTTCTTTTTTAAGG - Intronic
912553294 1:110498303-110498325 CAGGATTACCAGCTTTTTTTAGG - Intergenic
912662630 1:111546594-111546616 CAGAATTTTCATCCTTTTCAAGG + Intronic
913344103 1:117790785-117790807 CAGAATTTCCATCTTTTTAAAGG + Intergenic
913460050 1:119075680-119075702 TAGAATTTTCATCTTTTTCTAGG + Intronic
913596626 1:120385033-120385055 CAGAGTTTGCTTTTTTTTCTTGG - Intergenic
914090644 1:144493949-144493971 CAGAGTTTGCTTTTTTTTCTTGG + Intergenic
914429432 1:147607159-147607181 CAGGATTTCCTTCTTTTTAAAGG + Intronic
914833873 1:151191180-151191202 CAGGATTTTCTTCTTTTTAATGG - Intronic
915761953 1:158323018-158323040 GAGCATTTACATCTTTTTCCAGG + Intergenic
916011355 1:160708886-160708908 CAGCATTTGCCTATTTCTCTTGG + Intronic
916848251 1:168675522-168675544 CAACATTTCCATCTTCTTCTAGG + Intergenic
916867410 1:168875367-168875389 CAGGAGTTGCATTTTTTTGGTGG - Intergenic
916873586 1:168943972-168943994 CAGGTTTTGTATCTTTTGCAGGG - Intergenic
918360658 1:183753994-183754016 GAGAATTTGCATTTGTTTCTGGG + Intronic
919059608 1:192614901-192614923 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
919150745 1:193694904-193694926 CTGGATTTCCTTCTTTTTATAGG - Intergenic
919222416 1:194646338-194646360 TAGGATTTTCATCTTTTTTAAGG + Intergenic
919228335 1:194738381-194738403 CTGGATTTACCTCTTTTCCTGGG - Intergenic
919255918 1:195124904-195124926 CAGGATTTGAATCTTCATATTGG - Intergenic
919256080 1:195127282-195127304 CAGGATTGCAATCTATTTCTAGG - Intergenic
919381993 1:196871282-196871304 CAAGATTTGTGCCTTTTTCTTGG - Intronic
920268824 1:204747404-204747426 CAGGCTCTGGATCTTTTTCTTGG + Intergenic
920349057 1:205325558-205325580 CAGGATTTGCATCCCTTTCTTGG - Intergenic
920852755 1:209639806-209639828 CAAGACTTGCATCTATTTGTGGG - Intronic
921158976 1:212459733-212459755 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
921489661 1:215759604-215759626 CAGGATTTGTACATTTCTCTGGG - Intronic
921652687 1:217697316-217697338 CAAGATTTTCATCACTTTCTTGG + Intronic
922699841 1:227752557-227752579 CAGGATTTCCTTCTTTTTTGTGG + Intronic
923301924 1:232649288-232649310 CGGTATTTGCAGCTCTTTCTAGG + Intergenic
923438953 1:233997079-233997101 CAGGATTTCCGTCTTTTTTCAGG + Intronic
923635230 1:235689312-235689334 CAGGATTTCCATCTTTTTAAAGG - Intronic
923642212 1:235775690-235775712 CAGGATTTGGCTCTCTTCCTAGG - Intronic
924450077 1:244170301-244170323 CAGGATTTCCATCTTTTTCAAGG + Intergenic
1063000924 10:1921695-1921717 AAGCACTTGCATCTCTTTCTGGG + Intergenic
1063452722 10:6162211-6162233 CAGAATTTCCATCTTTTTGGAGG + Intronic
1063522323 10:6752142-6752164 CAAGGTCTGCATATTTTTCTAGG + Intergenic
1064299172 10:14107017-14107039 CATGATTTCAATCTTTTTCATGG - Intronic
1064510839 10:16089350-16089372 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1064739340 10:18416280-18416302 CAGAATTTCCTTCTTTTTCAAGG + Intronic
1065266700 10:23983809-23983831 CAGGACTTGGATCCTGTTCTTGG - Intronic
1065443184 10:25772654-25772676 CTGGATTTTCATCTTTACCTTGG + Intergenic
1065607407 10:27432471-27432493 CAGTATTTTTTTCTTTTTCTGGG - Intergenic
1065741579 10:28801914-28801936 GAGGAATTGCATCTCTTCCTTGG + Intergenic
1066348261 10:34611108-34611130 CATGATTTTCATCTATTTTTGGG - Intronic
1067410785 10:46062691-46062713 AAGGATGTGCATCTTTGTGTAGG + Intergenic
1068247092 10:54387392-54387414 CAGAATTTCCTTCTTTTTCAAGG - Intronic
1068877622 10:62013752-62013774 CAGAATTTGCTTCTTTTTTAAGG + Intronic
1069185070 10:65412194-65412216 GAGATTTTGCATCTTGTTCTGGG + Intergenic
1069524447 10:69155406-69155428 CTGGAATTGCATCTGTTTTTAGG + Intronic
1069589703 10:69634219-69634241 CAGGTTTCTCATCCTTTTCTTGG + Intergenic
1070220880 10:74442829-74442851 CAGGATTTCCTTCTTTTTTAAGG - Intronic
1070840072 10:79479469-79479491 CAGGATTTCCTTCTTTTTTATGG - Intergenic
1071092669 10:81937101-81937123 CAGGATTTTCTTCTTTTTTAAGG + Intronic
1071261317 10:83921827-83921849 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1071938429 10:90557516-90557538 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1071943117 10:90610308-90610330 CAGCCTTTCCATCTTTGTCTGGG - Intergenic
1072021098 10:91402601-91402623 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1072229336 10:93400558-93400580 CAGGATTTGCTGCTTTTCTTGGG - Intronic
1072234211 10:93439089-93439111 CAGGATTTGCACGATTTTCGTGG + Intronic
1072321269 10:94252470-94252492 GAGGATTTTCTTCTTTTTCTTGG - Exonic
1072878022 10:99194687-99194709 CAGGTTTTGGATTTTTTTCATGG - Intronic
1072879570 10:99212476-99212498 CAGGATTTCCTTCTTTTTCAAGG - Intronic
1072912094 10:99511542-99511564 CAGGATTTCCTTCTTTTTTATGG - Intergenic
1074180458 10:111058526-111058548 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1074340114 10:112620166-112620188 TAGAATTTGCATCTTATTGTTGG + Intronic
1074642823 10:115407556-115407578 CAGGATTTCCTTCTTTTTAATGG + Intronic
1075052677 10:119194528-119194550 CAGGATTTGCATCTTTGTGTGGG + Intergenic
1075165921 10:120068273-120068295 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
1075195116 10:120349712-120349734 CAATATTGGCATCTTTCTCTAGG - Intergenic
1075200737 10:120401815-120401837 CTGTATTTGCATCATTTCCTTGG + Intergenic
1075672910 10:124276224-124276246 CAGGATTACAATATTTTTCTAGG - Intergenic
1078919407 11:15815314-15815336 CAATATTTGAATCTTTTCCTTGG + Intergenic
1079254556 11:18816899-18816921 CAGGATTTGGCTCTTTTTGATGG + Intergenic
1081005114 11:37726553-37726575 CAGGATTTTCTTCTTTTTAAAGG - Intergenic
1081711259 11:45217448-45217470 CAGAATTTGCATCTTGTCCTAGG - Intronic
1082092719 11:48102926-48102948 CAGGATTTGTATTTTAGTCTTGG + Intronic
1082225035 11:49695255-49695277 CAGGATTGCCTTCTTTTTCAAGG + Intergenic
1082737188 11:56869554-56869576 TTTGATTTGCATCTTTTACTGGG - Intergenic
1083041872 11:59696221-59696243 CAGGATTTTCTTCTTTTTAAAGG + Intergenic
1083977799 11:66138025-66138047 CAGAATTTGCATTTTATGCTGGG - Intronic
1084078321 11:66799768-66799790 CAGGATTTCCTTCTTTTTAAAGG + Intronic
1084103562 11:66965925-66965947 CAGGATCTGTAGCTTTGTCTGGG + Intergenic
1084357077 11:68646587-68646609 CAGGATATATTTCTTTTTCTTGG + Intergenic
1084749492 11:71194852-71194874 CAGGATTTGCTTCTTCCTCATGG - Intronic
1084815940 11:71646770-71646792 CAGGATTTTCTTCTTTTTGAAGG + Intergenic
1085956301 11:81400318-81400340 CAGGATTTGACTCTAGTTCTAGG - Intergenic
1086163449 11:83749377-83749399 CAGGATTTGCATCTTTTTCTTGG - Intronic
1086624072 11:88924469-88924491 CAGGATTGCCTTCTTTTTCAAGG - Intronic
1087051892 11:93894526-93894548 CAGAATTTTCTTCTTTTTCAAGG - Intergenic
1087578348 11:100019517-100019539 CAGGATTTCCTTCTTTTTCAAGG + Intronic
1087797165 11:102466835-102466857 CCGGATTTGAATCTGTTTCAAGG + Intronic
1088532421 11:110825529-110825551 TAGAATTTGCAGCTTTTACTTGG - Intergenic
1088745888 11:112804480-112804502 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1089188924 11:116640407-116640429 CAGGATTTCCCTCTTTTTCAAGG + Intergenic
1089264360 11:117247995-117248017 GAGGATTTGTGTCCTTTTCTGGG + Intronic
1090761828 11:129844116-129844138 CAGGATTTCCTTCTTTTTTAAGG - Intronic
1091191472 11:133699015-133699037 CAGCATTTCAATATTTTTCTTGG - Intergenic
1091716257 12:2778488-2778510 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1092320600 12:7469969-7469991 CAGGATTTCCCTCTTTTTAAAGG - Intronic
1092427072 12:8383276-8383298 CAGGATTTACTTCTTTTTGAAGG - Intergenic
1093177811 12:15932993-15933015 CAGGATTTCCTTCTTTTTCAAGG + Intronic
1093846138 12:23973458-23973480 CAGAATTTCCATCTTTTTAAAGG + Intergenic
1094210018 12:27879224-27879246 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1094311717 12:29091527-29091549 CAGGATTTTCTTCTTTTTAAAGG - Intergenic
1094697749 12:32838143-32838165 CACGATTTCATTCTTTTTCTTGG - Intronic
1095680132 12:44964630-44964652 CAGGATTTCTATTTCTTTCTGGG - Intergenic
1095709456 12:45272972-45272994 CAGGATTTCCTTCTTTTTTAAGG - Intronic
1095854678 12:46847190-46847212 CAGGATTCTCTTCTTTTTCAAGG + Intergenic
1096948617 12:55439656-55439678 CAGCATTTTCTTCTTTTTCAAGG - Intergenic
1097074307 12:56381297-56381319 CAGGACTAGCACCTTTGTCTTGG - Intergenic
1097594169 12:61607076-61607098 CAGGAATTTGATTTTTTTCTAGG + Intergenic
1097763676 12:63498456-63498478 CAGGATTTCCTTCTTTTTCAAGG + Intergenic
1097956507 12:65491975-65491997 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1097971999 12:65643310-65643332 CAGGATTTTCTTCTTTTTAAAGG + Intergenic
1098054026 12:66484493-66484515 CAGGATTTCATTCTTTTTCATGG - Intronic
1098188142 12:67920431-67920453 CATTATTTGCATTTTTATCTTGG - Intergenic
1099259630 12:80361306-80361328 CAGGACTTTCTTCTTTTTCAAGG + Intronic
1099418160 12:82420027-82420049 CAGGACTTGCTTCTTTTTAAAGG - Intronic
1099623816 12:85040913-85040935 CAGTATATACATCTTTTTTTGGG + Intronic
1099941258 12:89191875-89191897 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1100127471 12:91446052-91446074 CAGGATATGCTTCTTTTTTAAGG - Intergenic
1100544889 12:95592231-95592253 AAGGCTTTGCATCCTCTTCTGGG + Intergenic
1100841412 12:98615824-98615846 CAGGATTTCCTTCTTTTTAAAGG + Intronic
1100864948 12:98847433-98847455 CAGGATTTCCTTCTTTTTCATGG + Intronic
1100929843 12:99594537-99594559 CAGGATTTACTTCTTTTTAAAGG - Intronic
1101067380 12:101036514-101036536 CAGGATTTTCTTCTTTTTTATGG - Intronic
1101097064 12:101353154-101353176 CAAGATTTTCATCTTATTCTTGG + Intronic
1101102709 12:101409546-101409568 CAGGATTTTCTTCTTTTTAAAGG + Intergenic
1101285802 12:103310956-103310978 CAGGCTTTCCATCTTGTTCTTGG - Intronic
1101338269 12:103816590-103816612 CATGATTTCTATTTTTTTCTTGG + Intronic
1102087173 12:110151979-110152001 CAGGATTTCCTTCTTTTTTAAGG + Intronic
1102656789 12:114488750-114488772 AAGGATTTGAACCTTTCTCTGGG + Intergenic
1102715292 12:114965842-114965864 CAGGATTTTCTTCTTTTGCAAGG + Intergenic
1102801621 12:115739844-115739866 CAGGATTTTCTTCTTTTTAAAGG - Intergenic
1102825705 12:115946269-115946291 CAGAATTTCCCTCCTTTTCTAGG - Intergenic
1102906574 12:116680596-116680618 CAGGATTTCCCTCTTTTTCAAGG - Intergenic
1103114896 12:118318889-118318911 CAGGATTTCCTTCTTTTTGAAGG - Intronic
1104130347 12:125887588-125887610 CAGGATATGCATATTTTTAAAGG - Intergenic
1104294297 12:127497830-127497852 CAGGATTTTCTTCTTTTTAAAGG - Intergenic
1105481275 13:20778676-20778698 CAAGATTTGCATCACCTTCTGGG - Exonic
1105515760 13:21089497-21089519 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1105545787 13:21349917-21349939 CAGGATTTCCTTCTTTTTAGAGG + Intergenic
1105688195 13:22807253-22807275 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1105819252 13:24064950-24064972 CAGGCTTTCCATGTTTTTCATGG - Intronic
1105928244 13:25027584-25027606 CAGGATTTCCTTCTTTTTTCAGG + Intergenic
1105942646 13:25163503-25163525 CAGGATTTCCTTCTTTTTTCAGG - Intronic
1106539580 13:30677988-30678010 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1106622381 13:31383171-31383193 CAGGATTTCCCTCTTTTTTAAGG + Intergenic
1106624627 13:31407896-31407918 CAGGATTTTCATTTTCTGCTTGG - Intergenic
1106689703 13:32101291-32101313 CAGGATTTCCTTCTTTTTTAAGG + Intronic
1107323473 13:39214115-39214137 CAGGATTTTCTTCTTTTTAAAGG + Intergenic
1107431049 13:40340593-40340615 CCGGAGTTGCATCTGTGTCTAGG - Intergenic
1107894695 13:44949620-44949642 CAGGATGTGCATCCTTTATTTGG - Intronic
1108300633 13:49071200-49071222 CAGGATTTTGTTCTTTTTCATGG + Intronic
1108419201 13:50231729-50231751 CAGGATTTCCTTCTTTTTTATGG + Intronic
1108444083 13:50488901-50488923 CAGGATTTTCTTCTTTTTTAAGG + Intronic
1109443973 13:62408571-62408593 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1109611952 13:64777177-64777199 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1110078752 13:71284863-71284885 CAGCTTTTGTTTCTTTTTCTGGG + Intergenic
1110441191 13:75527670-75527692 CAGGATTTCCTTCTTTTTTATGG - Intronic
1110538354 13:76678854-76678876 CAGGGTTTCCTTCTTTTTCAAGG - Intergenic
1110689072 13:78410889-78410911 CAGTAATTGCAGTTTTTTCTAGG - Intergenic
1112147178 13:96712737-96712759 CAGAATTTGCATCAGATTCTTGG - Intronic
1112412777 13:99178356-99178378 CAGGATTTCCTTCCTTTTCAAGG + Intergenic
1112441880 13:99430295-99430317 CAGGATTTCCCTCTTTTTGAAGG + Intergenic
1113125780 13:106977581-106977603 CAGGATTTGTTAATTTTTCTAGG - Intergenic
1113223308 13:108130057-108130079 GAGAATTTGTTTCTTTTTCTAGG - Intergenic
1113251110 13:108453566-108453588 CAGGATTTCCTTCTTTTTTATGG - Intergenic
1113439407 13:110316053-110316075 AAAGATTTGCATTTTTTCCTAGG + Intronic
1113490825 13:110690406-110690428 ATACATTTGCATCTTTTTCTTGG + Intronic
1114147218 14:19992094-19992116 CAGGATTTTATTCTTTTTCATGG - Intergenic
1114274793 14:21133032-21133054 CAGGATTTCCTTCTTTTTAATGG - Intergenic
1114374949 14:22134613-22134635 CAGGATATTCTTCTTTTTCAAGG + Intergenic
1115364559 14:32543369-32543391 CAGGATTTCCTTCTTTTTGAAGG + Intronic
1115675401 14:35667968-35667990 CAGGATTTTGTTCTTTTTCATGG - Intronic
1115775397 14:36709349-36709371 CTGCATTTGCATTCTTTTCTGGG + Intronic
1115791528 14:36884309-36884331 CAGGATTTCCTTCTTTTTCAGGG + Intronic
1115804241 14:37033288-37033310 CAGGATTTTAATCTTTTTAAAGG + Intronic
1115899787 14:38132596-38132618 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1116230625 14:42210857-42210879 CAGGATTTCATTCTTTTTCATGG + Intergenic
1116355405 14:43922304-43922326 CAGGATTTCCTGCTTTTTCATGG - Intergenic
1116506804 14:45692931-45692953 CAATATTCACATCTTTTTCTAGG + Intergenic
1116644157 14:47505011-47505033 CAGGATTTCATTCTTTTTCATGG - Intronic
1116683999 14:48014718-48014740 CAGGATTTGAATATTTTGCTTGG - Intergenic
1117869475 14:60185402-60185424 CAGGATCTGAAGCTGTTTCTGGG - Intergenic
1118814948 14:69304795-69304817 CAGGATTTCCTTCTTTCTCAAGG + Intronic
1118961168 14:70534485-70534507 CAGGATTTCCTTCCTTTTTTGGG - Intronic
1119047158 14:71329098-71329120 CAGGATTTCTATCTTTTTAAAGG + Intronic
1119094972 14:71821493-71821515 CATGATTTCCATCTATTTCATGG + Intergenic
1120116494 14:80624248-80624270 CAGGATTTCATTCTTTTTCATGG + Intronic
1120181697 14:81349894-81349916 CAGGATTTCCTTCTTTTTTTTGG - Intronic
1120236315 14:81895406-81895428 CAGGATTTTCTTCTTTTTGGAGG + Intergenic
1120537779 14:85718080-85718102 TAGCATTTCCATTTTTTTCTTGG - Intergenic
1120773147 14:88403546-88403568 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1120838725 14:89064098-89064120 CAATTTTTGTATCTTTTTCTTGG - Intergenic
1120937976 14:89917415-89917437 CAGGATTTCCTTCTTTTTTAAGG + Intronic
1121173933 14:91876416-91876438 TAGGACTTGCATCTTTTTGGGGG - Intronic
1121521269 14:94587616-94587638 CAGGATCTGCATCTTTGTGCTGG - Exonic
1121833975 14:97075798-97075820 CAGGATTTCCTTCTTTTTAGAGG + Intergenic
1122002905 14:98678386-98678408 CAAGATTTCCTTCTTTTTCAAGG + Intergenic
1122050035 14:99051321-99051343 CAGGATTTCCTTCTTTTTAATGG - Intergenic
1122092716 14:99350683-99350705 CAGGGTTTGAGTCTGTTTCTCGG + Intergenic
1202829216 14_GL000009v2_random:8134-8156 CTGCATTTGTATCTTTATCTTGG + Intergenic
1202900928 14_GL000194v1_random:37986-38008 CTGCATTTGTATCTTTATCTTGG + Intergenic
1123708071 15:22964998-22965020 CAGGATTTCCTTCTTTTTAAAGG + Intronic
1123985974 15:25646427-25646449 CAGGATTTCCTTCTTTTTACAGG - Intergenic
1124173716 15:27402666-27402688 GAGGATTTGCATTTCATTCTGGG - Intronic
1124198403 15:27655128-27655150 CAGGATTTCCTTCTTTTTGAAGG - Intergenic
1124448272 15:29759792-29759814 CAGGATTTCCTTCTTTTTAAAGG + Intronic
1124615458 15:31238555-31238577 CAGGATTTGCTTCTTTTTTATGG + Intergenic
1124866582 15:33498037-33498059 CAGGATTTTAATCTTTTTTATGG + Intronic
1124878457 15:33619189-33619211 CAGCACTTGTATCATTTTCTGGG - Intronic
1124984925 15:34598314-34598336 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1125415025 15:39443448-39443470 CAGAATTTGCATCTAGATCTAGG - Intergenic
1125673726 15:41491567-41491589 AAGGAATTGCCCCTTTTTCTTGG + Intergenic
1125813155 15:42559437-42559459 CTGGAATTTCAACTTTTTCTTGG + Intronic
1126208561 15:46074105-46074127 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1126721186 15:51581884-51581906 CAGGTTTTGTTTCTTTTTTTTGG - Intronic
1126880816 15:53094899-53094921 CAGGATTTCCTTCTTTTTTGAGG + Intergenic
1126990610 15:54371760-54371782 CAGGATTTCCCTCTTTTTTAAGG - Intronic
1127291222 15:57573247-57573269 CCGGAATGGCATCTTTTTCAGGG - Intergenic
1128536631 15:68496193-68496215 CAGGATTTCCTTCCTTTTCATGG - Intergenic
1129283390 15:74503770-74503792 CAGGATTTCCTTCCTTTTCAAGG + Intergenic
1129532889 15:76283122-76283144 CTGGTTTTTCATCTTTTTTTTGG - Intronic
1129586270 15:76869910-76869932 CAGGATTTTATTCTTTTTCATGG - Intronic
1130079800 15:80722887-80722909 CAGGATTTCCATCTTTCTAAGGG + Intronic
1130540150 15:84816658-84816680 CATGATTTGATTATTTTTCTGGG + Exonic
1131291765 15:91112606-91112628 CAGGATTTGCCTGTATTTCTTGG + Intronic
1131624829 15:94106492-94106514 CAGGATTTCCATTTCTTTCTTGG + Intergenic
1132157535 15:99506601-99506623 CATGATTTCCTTCTTTTTCATGG - Intergenic
1132217487 15:100076410-100076432 CACAATTTTCATCTTTTCCTTGG + Intronic
1133160203 16:3906569-3906591 CAGAATTTCCATCCTTTTCAAGG - Intergenic
1133371183 16:5247089-5247111 CAGGATTTCCTTCTTTTTGAAGG + Intergenic
1133377197 16:5297089-5297111 CAGGATTTTCTTCTTTTTAAAGG + Intergenic
1133429965 16:5728275-5728297 CAGGATTTCCTTCTTTTTATAGG - Intergenic
1133727763 16:8553392-8553414 AAGGACTTGAATCTTTTTTTGGG + Intergenic
1134208366 16:12255703-12255725 CAGGATTTTCTTCTTTTTTAAGG + Intronic
1134305287 16:13026396-13026418 CAGGATTCCCCTCTTTTTCAAGG + Intronic
1135077348 16:19404919-19404941 CAGGATCTCCAACTTTATCTTGG - Intergenic
1136669575 16:31844229-31844251 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1137257463 16:46788442-46788464 CAGGATTTTCTTCTTTTTAAAGG - Intronic
1137810466 16:51347971-51347993 CAGGATTTCCTTCTTTTTAAGGG - Intergenic
1139331133 16:66191218-66191240 CAGGATTTACTTCTTTTTAATGG - Intergenic
1140184606 16:72756356-72756378 CAGAATTTCCATCTTTTTTAAGG + Intergenic
1140641360 16:76977273-76977295 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1140772128 16:78214634-78214656 CAGGCTTAGCAACTTTTTCAGGG - Intronic
1141290006 16:82709272-82709294 CAGAATTTTTTTCTTTTTCTTGG - Intronic
1141485451 16:84336440-84336462 CAGGTTTTGGATTTTTTTCATGG - Intergenic
1141858828 16:86703033-86703055 CAGGATTTCCGTCTTTTTTAAGG - Intergenic
1142431427 16:90030263-90030285 CATCATTTGCATATTTTTTTTGG + Intronic
1203142182 16_KI270728v1_random:1775125-1775147 CAAGATTTTCTTCTTTTTCAAGG + Intergenic
1143916783 17:10299770-10299792 CAGGATTTCCTTCTTTTTTATGG + Intronic
1145120240 17:20252690-20252712 CAGGATTTCCTTCTTTTTTAAGG + Intronic
1145283154 17:21483034-21483056 CAGGATTTCCTTCTTTTTTAGGG - Intergenic
1145394330 17:22482766-22482788 CAGGATTTCCTTCTTTTTTAGGG + Intergenic
1145725461 17:27117251-27117273 CAGAATTTCCTTCTTTTTCAAGG + Intergenic
1146464796 17:33077920-33077942 AAGCTGTTGCATCTTTTTCTTGG - Intronic
1146508489 17:33425852-33425874 CAGGATGTGCATATTTTGCTAGG + Intronic
1146689338 17:34862416-34862438 GAGGATGTGCCTCTTCTTCTAGG - Intergenic
1147399240 17:40169509-40169531 GAGGATTTCCCTCATTTTCTGGG + Intronic
1148399730 17:47346373-47346395 CAGGATTTTCTTCTTTTTAAAGG + Intronic
1148956496 17:51358139-51358161 CAGAATTTTCTTCTTTTTCAAGG + Intergenic
1149397049 17:56255509-56255531 CTGCATTTCCATCTTTTCCTTGG + Intronic
1149703079 17:58671670-58671692 CTGGATTTGTTTCTTTCTCTGGG + Intronic
1149966971 17:61174487-61174509 CAGGATTTCCTTCTTTTTTAAGG + Intronic
1150198603 17:63328450-63328472 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1150968989 17:70005099-70005121 CATTATTTTCAACTTTTTCTTGG - Intergenic
1150994135 17:70296648-70296670 CAGGATTTCCTGCTTTTTCATGG - Intergenic
1152289609 17:79432122-79432144 CAGGATTTCCTTCCTTTTCAAGG + Intronic
1152326352 17:79641618-79641640 CAGGATTTTCTTCTTTTTAAAGG - Intergenic
1153053473 18:922829-922851 CATGATTTTCTTCTTTTTCATGG + Intergenic
1153167405 18:2278424-2278446 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
1153302603 18:3604383-3604405 CTGGAGTTACATGTTTTTCTTGG + Intronic
1153558678 18:6346993-6347015 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1154030833 18:10752773-10752795 CAGGATCAGCATCTTTTGCATGG - Exonic
1154078760 18:11233554-11233576 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
1154381594 18:13856109-13856131 CAGGATTTCATTCTTTTTCATGG - Intergenic
1154393543 18:13965818-13965840 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1155115281 18:22759646-22759668 CAGGATTTCCTTCTTTTTCATGG - Intergenic
1155935784 18:31752219-31752241 CAGAATTTGCTTCTTTTTTGAGG - Intergenic
1156141111 18:34112523-34112545 CAGGATTTCCTTCTTTTTTGGGG - Intronic
1156210134 18:34930559-34930581 TAGGATTTCCTTCTTTTTCAAGG - Intergenic
1156396950 18:36707347-36707369 CAGGTTGTGCATCTTCTACTGGG - Intronic
1156738779 18:40298457-40298479 CAGGATTTCATTCTTTTTCACGG + Intergenic
1159166777 18:64712823-64712845 AAGTATTTTCTTCTTTTTCTGGG + Intergenic
1159540835 18:69773503-69773525 CAGGATTTCTATCTTTTTTGAGG - Intronic
1159683438 18:71385302-71385324 CAGGATTTCCTTCTTTTTTATGG - Intergenic
1159703832 18:71662327-71662349 CAGGATTTGCTTCTTTTGTAAGG + Intergenic
1159818859 18:73114191-73114213 CAGCATTTGCAGCTCTATCTAGG - Intergenic
1159884795 18:73893730-73893752 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1160094140 18:75855345-75855367 CAGGATTTCTATTTTTTTCTTGG - Intergenic
1160422879 18:78759936-78759958 CAGGATTTCCTTCTTTTTTGAGG + Intergenic
1161245742 19:3250801-3250823 CAGAATTTCCTTCCTTTTCTTGG + Intronic
1161948757 19:7455448-7455470 CAGGATTTGCATCTATGTGCAGG + Intronic
1163016621 19:14459714-14459736 CAGGTTTTGTATCTCTTTCCTGG - Intronic
1163068971 19:14822028-14822050 CAGGATTTCCTTCTTTTTAAAGG + Intronic
1163196143 19:15721955-15721977 GAGGATTTCCTTCTTTTTCAAGG + Intergenic
1163209597 19:15830695-15830717 CTGGATTTTCATCTTTACCTTGG - Intergenic
1164904814 19:31958831-31958853 CAGGATTTCCATTTCTTTCAAGG + Intergenic
1165135941 19:33668722-33668744 AAGGCTTTTCATCTTTTCCTGGG + Intronic
1165259860 19:34603700-34603722 CAGTATTTGAATATTTTTCTTGG + Intronic
1165273278 19:34728544-34728566 CAGTATTTGAATGTTTTTCTTGG - Intergenic
1165560274 19:36673144-36673166 CAGACTTTGCATCCTCTTCTGGG + Intergenic
1166610213 19:44185091-44185113 CAGGATTTTCTTCTTTTTAAAGG + Intergenic
1167399988 19:49258969-49258991 CAAGATTTCCTTCTATTTCTAGG - Intergenic
1167812389 19:51845797-51845819 CAGGATTTCCTTCTTTTTTGTGG + Intergenic
1167846426 19:52168717-52168739 CAGGATTTTCTTCTTTTTGATGG - Intronic
1168053818 19:53849697-53849719 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1168362266 19:55751989-55752011 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
925475684 2:4211632-4211654 CAGGATTTTCTTCTTTTTTAGGG + Intergenic
925605325 2:5654402-5654424 CAGAGTTTGCTTTTTTTTCTCGG - Intergenic
926679661 2:15653962-15653984 CAGGAGTTGCAGCCTTCTCTGGG + Intergenic
926857599 2:17273646-17273668 CAGGTTTGGCTTCCTTTTCTTGG - Intergenic
927174483 2:20395980-20396002 GAGAATTTCCATATTTTTCTGGG + Intergenic
927429058 2:23011511-23011533 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
927445552 2:23157948-23157970 CAGCAAATGCATCTTCTTCTGGG + Intergenic
927609262 2:24521560-24521582 CAGGATTTTCTTCTTTTTAAAGG + Intronic
928717913 2:34084326-34084348 CAGAATTTTCTTCTTTTTCATGG + Intergenic
929026526 2:37609681-37609703 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
929097243 2:38275064-38275086 AAACATTTGCATTTTTTTCTTGG - Intergenic
929230278 2:39552525-39552547 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
930527858 2:52553310-52553332 CAGGATTTCATTCTTTTTCATGG - Intergenic
930772728 2:55143914-55143936 CAGGATTTTCTTCTTTTTCAAGG - Intergenic
931524701 2:63140123-63140145 AAGTATTTGCATTTATTTCTGGG + Intronic
931541111 2:63329913-63329935 CAGGATTTCCTTCTTTTTAAAGG + Intronic
931710275 2:64983790-64983812 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
932011828 2:67985944-67985966 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
932627990 2:73314193-73314215 CAGGCTTTACATCATTCTCTGGG + Intergenic
932871377 2:75402442-75402464 CAGGATTTCATTCTTTTTCGAGG + Intergenic
933195866 2:79388846-79388868 CAGGTATTCCATATTTTTCTTGG + Intronic
933414769 2:81972701-81972723 CAGAATTTCCTTCTTTTTCAAGG + Intergenic
933558799 2:83865963-83865985 CAGCAGTTGCATTTTTTGCTAGG + Intergenic
933804104 2:85985602-85985624 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
935188776 2:100758832-100758854 CAGAATTTGCTTCTTTTTTAAGG - Intergenic
935477635 2:103543341-103543363 CAGGATTTTCTTCTTTTTAAAGG + Intergenic
935928092 2:108092367-108092389 CAGGTTTTGGATTTTTTTCCTGG + Intergenic
936162941 2:110098538-110098560 CAGAATTTCCTTCTTTTTCAAGG + Intronic
937625381 2:124037499-124037521 CAGAATTTCCTTCTTTTTCAAGG - Intronic
937817324 2:126266004-126266026 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
937984098 2:127630860-127630882 CAGGGTGTGCAGCTTTTCCTTGG - Exonic
938190192 2:129272793-129272815 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
938316874 2:130335816-130335838 CAGGAATTCTATCTTGTTCTTGG - Intergenic
939294182 2:140237336-140237358 CAGGATTTCCTTCTTTTTTATGG + Intronic
939598660 2:144160992-144161014 GAGGATTTCCAGCATTTTCTTGG - Intronic
940086085 2:149860703-149860725 CATTATTTGCAGCTATTTCTAGG - Intergenic
940380038 2:153004257-153004279 CATGATTTGGATTTTTATCTAGG - Intergenic
940451064 2:153837576-153837598 CAGTATTTCATTCTTTTTCTAGG + Intergenic
940500869 2:154492115-154492137 CAGGATTTTCTTCTTTTTAAAGG + Intergenic
940580903 2:155578786-155578808 CAGGATTTTATTCTTTTTCAGGG - Intergenic
941062401 2:160862660-160862682 CAGGATTTGTGTGCTTTTCTTGG - Intergenic
941522697 2:166567326-166567348 CAGGATTTCCTTCTTTTTTTAGG - Intergenic
941707883 2:168678997-168679019 CAGGATTTCATTCTTTTTCATGG - Intronic
941949122 2:171134908-171134930 CAGGATTTCCTTCTTTTTTAAGG - Intronic
941975021 2:171394253-171394275 CATGAATTGCCTCTCTTTCTAGG - Intronic
942266548 2:174233018-174233040 CAGGATTTCCTTCTTTTTAAGGG - Intronic
942650683 2:178164262-178164284 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
942762742 2:179419002-179419024 CAGGATTTTCTTCTTTTTAAAGG - Intergenic
942849704 2:180469734-180469756 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
943082412 2:183271166-183271188 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
943552693 2:189359762-189359784 CAGGATTTCTATTTTTTTCATGG + Intergenic
944007098 2:194922604-194922626 CAGGATTTCCTTCTTTTTCAAGG - Intergenic
944759395 2:202798100-202798122 CAGGATTTCCTTCTTTTTGAAGG + Intronic
945443949 2:209913780-209913802 CATGATTTCCATCTTTTCCCAGG + Exonic
945639324 2:212403550-212403572 CAGGATTTACTTCTTTTTTAAGG - Intronic
945994734 2:216426424-216426446 CATTATGTGCATTTTTTTCTGGG - Intronic
946456978 2:219834662-219834684 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
947055906 2:226103489-226103511 CAGGATTTCCTTCTTTTTTGTGG - Intergenic
948761442 2:240194363-240194385 CAGAATTTCCATCCTTTTGTAGG + Intergenic
1169508687 20:6241006-6241028 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1170406798 20:16046577-16046599 CAGGATTAGTCTGTTTTTCTTGG + Intronic
1171115964 20:22525013-22525035 TAGGATTTATATTTTTTTCTGGG + Intergenic
1171726934 20:28632240-28632262 AAGGATTTCCTTCTTTTTCAAGG - Intergenic
1171893449 20:30738594-30738616 CTGCATTTGTATCTTTATCTTGG - Intergenic
1171950809 20:31420076-31420098 CAGGATTTTCTTCTTTTTTATGG - Intergenic
1173888551 20:46483667-46483689 CCATATTTGCATCTGTTTCTGGG + Intergenic
1173930731 20:46816041-46816063 CAGTATCTGCATCTTTACCTGGG - Intergenic
1174226196 20:49002577-49002599 CAGAATTTCCATCCTTTTCAAGG + Intronic
1174681778 20:52415623-52415645 CAGAATCTGCATTTTTTTCCAGG + Intergenic
1174862884 20:54108682-54108704 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1175117648 20:56694411-56694433 CAGCACTTGCATTTTTCTCTGGG - Intergenic
1175127119 20:56760652-56760674 CAACATTTGCATTTTTTACTAGG + Intergenic
1175617866 20:60418007-60418029 CAGCATTTGTATCTTCTTGTTGG + Intergenic
1176608400 21:8852974-8852996 CTGCATTTGTATCTTTATCTTGG + Intergenic
1176620302 21:9052764-9052786 CTGCATTTGTATCTTTATCTTGG + Intergenic
1176946273 21:14985820-14985842 CTGGGTTTTCATCTTTATCTAGG - Intronic
1176977466 21:15338449-15338471 CGGGATTTGCTTCTTTTTAAAGG - Intergenic
1176997372 21:15571220-15571242 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1177194959 21:17894432-17894454 CAGTATGTGCATCTTATTGTGGG + Intergenic
1177205713 21:18008673-18008695 CAGAATTTCCTTCTTTTTCAAGG + Intronic
1177352068 21:19956205-19956227 CAGGATTTTATTCTTTTTCATGG + Intergenic
1177490607 21:21821026-21821048 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1177689029 21:24479609-24479631 CAGGATTTTCTTCTTTTTTGAGG - Intergenic
1177727588 21:24989436-24989458 TATGACTTTCATCTTTTTCTGGG - Intergenic
1177808673 21:25901270-25901292 CAGGATTTGTCTCTGTTTCCAGG - Intronic
1178794851 21:35734480-35734502 CAGGATTTTATTCTTTTTCGTGG - Intronic
1179181157 21:39046425-39046447 CAGCATTTCCTTCTTTTTCAAGG + Intergenic
1179482946 21:41689690-41689712 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1180358483 22:11862778-11862800 CTGCATTTGTATCTTTATCTTGG + Intergenic
1180379779 22:12129552-12129574 CTGCATTTGTATCTTTATCTTGG - Intergenic
1183025248 22:35060448-35060470 CTGGATTTCCTTCTTTTTCAAGG - Intergenic
1183164341 22:36136133-36136155 CAGGATCTGCATTGTTTCCTGGG + Intergenic
1184571902 22:45330565-45330587 GAGGATGTGTTTCTTTTTCTTGG + Intronic
1184928109 22:47658509-47658531 CAGAATCTGCATCTTTCTCCTGG + Intergenic
949159597 3:864551-864573 CAGGATTTCCTTCTTTTTCAAGG + Intergenic
949263106 3:2125288-2125310 CAGGATTTCCTTCTTTTTCAAGG + Intronic
949544237 3:5058717-5058739 CAGGCTTAGCATATTTTTCAGGG + Intergenic
949603333 3:5625872-5625894 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
949809325 3:7989171-7989193 CAGGGTCTGCTTCTTTTTCCAGG + Intergenic
949864602 3:8537180-8537202 CAAGACTTGCATATTTTCCTGGG - Exonic
951099275 3:18667940-18667962 CAGGGCTTGCATTTTTTTCATGG + Intergenic
951137126 3:19117707-19117729 CAGGATTTGCATGCTGTTATGGG - Intergenic
951213131 3:19997679-19997701 CAGAATTTCCTTCTTTTTCATGG - Intronic
951242117 3:20298890-20298912 CAGGATTTTCATCTTTTTAAAGG + Intergenic
951641778 3:24844543-24844565 CAGCAATTTCATCTTTCTCTGGG - Intergenic
951848479 3:27111264-27111286 CAGCATTTTCATCTTTTGGTTGG + Intronic
952475735 3:33708404-33708426 CAGGATTTCCTTCTTTTTTAAGG + Intronic
952898041 3:38092213-38092235 CAGGATTTCCTTCTTTTGCAGGG - Intronic
954099666 3:48359781-48359803 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
954856070 3:53644643-53644665 CAGGATTTCCTTCTTTTTAAAGG + Intronic
955212584 3:56955667-56955689 CAGGATGTGCATGCTGTTCTAGG - Intronic
955886703 3:63606881-63606903 CAGGATTGGTATCTATTTCATGG + Intronic
956341587 3:68230444-68230466 CAGGATTTCATTCTTTTTCATGG + Intronic
956511467 3:69998188-69998210 CAGGACTGACATATTTTTCTGGG + Intergenic
957017233 3:75081696-75081718 CAGAATTTCCTTCTTTTTCAAGG - Intergenic
957071779 3:75572971-75572993 CAGGATTTCCTTCTTTTTGAAGG - Intergenic
957777934 3:84778907-84778929 CATGATTTGACTATTTTTCTTGG - Intergenic
958185420 3:90113644-90113666 CAGGTTTTACTTATTTTTCTTGG - Intergenic
958787607 3:98614845-98614867 AAGACTTTGCATCTTCTTCTGGG + Intergenic
958865047 3:99490743-99490765 CAGGTTTTGGATTTTTTTCCTGG - Intergenic
958957924 3:100481204-100481226 CAGGATTTCCTTCTTTTTTATGG + Intergenic
959497859 3:107072357-107072379 GATGATTTGCTTCTTTTTCTAGG - Intergenic
959947603 3:112143058-112143080 CAGGATTTGGGTCTTTTTTATGG + Intronic
960616909 3:119604428-119604450 CAGGATTTCCTTCTTTTTAAAGG - Intronic
960967871 3:123117648-123117670 TAGGATTTCCTTCTTTTTTTAGG + Intronic
961500961 3:127335609-127335631 CAGGATTTTCTTCTTTTTTAGGG - Intergenic
962674099 3:137740482-137740504 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
962935423 3:140076231-140076253 CAGGATTTTCACCTTTTTAAAGG + Intronic
963393237 3:144696732-144696754 CAGGATCTAATTCTTTTTCTTGG + Intergenic
963500258 3:146116654-146116676 CAGGATTTCCTTCTTTTTTATGG - Intronic
963615353 3:147529867-147529889 CAGGATTTCCTTCTTTTTTGTGG - Intergenic
963699941 3:148612375-148612397 CAGGATTTTCTTCTTTTTAAAGG - Intergenic
964135650 3:153342081-153342103 CAGTATTGGCATCTGCTTCTAGG - Intergenic
964291082 3:155180760-155180782 AAGGTTTTGCATTGTTTTCTAGG - Exonic
964866257 3:161265303-161265325 GAGTATTTTCATCTTTGTCTGGG + Intergenic
965408170 3:168296502-168296524 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
966217017 3:177514390-177514412 CATGATTGACATCTTCTTCTTGG + Intergenic
966566522 3:181388360-181388382 TAGGATTTCCTTCTTTTTCAAGG + Intergenic
966650904 3:182299864-182299886 CACAATATGCATGTTTTTCTAGG + Intergenic
966690804 3:182739471-182739493 AAGGATGTACACCTTTTTCTGGG - Intergenic
966972610 3:185059339-185059361 CAGGATTTCATTCTTTTTCACGG - Intergenic
967102578 3:186228520-186228542 CAGAGTTTGCATCTTATCCTAGG - Intronic
967122434 3:186395024-186395046 CATGATTTGGTTCTTTTTCATGG - Intergenic
967140551 3:186554708-186554730 CAGGAATAGCATCTTTGTCTTGG - Exonic
967227028 3:187301792-187301814 CAGGATTTCCTTCTTTTTGAAGG + Intergenic
967555585 3:190853753-190853775 CAGGATGTGCAAATTATTCTGGG + Exonic
968145646 3:196296455-196296477 CAGAGTTTGCTCCTTTTTCTGGG - Intronic
968191823 3:196673824-196673846 CAGGATCTCATTCTTTTTCTTGG + Intronic
968344086 3:197985825-197985847 GAGGATTTCCATCTTTATCATGG - Exonic
968852112 4:3088729-3088751 CAGGATTTGTGTTTTTTTTTTGG + Intronic
969015371 4:4100282-4100304 CAGGATTTCCTTCTTTTTGAAGG - Intergenic
969865362 4:10073080-10073102 CAGGATCTGCATCAGTTTCAGGG - Intergenic
970405851 4:15762873-15762895 CAGGATTTCCTTCTTTTTTATGG + Intergenic
971447866 4:26771487-26771509 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
971535311 4:27740444-27740466 CAGGATTTCCTTCTTTTTTAGGG + Intergenic
971568690 4:28181398-28181420 CAGGATTTTATTCTTTTTCATGG + Intergenic
973116105 4:46461687-46461709 CAGAATTTCCTTCTTTTTCATGG - Intronic
973730609 4:53818846-53818868 CAGGATTTTCTTCTTTTTAAAGG + Intronic
973734086 4:53853183-53853205 CAGGATTGGCTTCTTTTTTAGGG - Intronic
973833518 4:54786188-54786210 CAGGATTTTCTTCTTTTTAAAGG + Intergenic
974091673 4:57317590-57317612 CTGCATTTGCATATTGTTCTGGG - Intergenic
974734762 4:65915384-65915406 CATAAATTGAATCTTTTTCTAGG + Intergenic
974934664 4:68398060-68398082 GAGAATTTTCATCTTCTTCTGGG - Intergenic
975445484 4:74459313-74459335 CAGGATTTCATTCTTCTTCTTGG + Intergenic
975599467 4:76084253-76084275 TTGGATTTGCAACTCTTTCTTGG + Intronic
975758714 4:77596977-77596999 CAGCATTTTCATCTTTTTAAAGG - Intronic
975841424 4:78478420-78478442 CTGGCTTTCCATCTTATTCTTGG + Intronic
975926217 4:79456910-79456932 CAGCATTTGGATCTTTCTCTTGG - Intergenic
976021185 4:80629127-80629149 CAGGATTTCCTTCTTTTTTATGG - Intronic
976572345 4:86627025-86627047 CAGGATTTCCTTCTTTTTTAAGG - Intronic
976612695 4:87046232-87046254 CAGGAAATGCCTCTTTCTCTTGG - Exonic
976821139 4:89208433-89208455 TAGGATTTTCCTCTTTTTTTGGG + Intergenic
977507576 4:97921839-97921861 CAGGATTTCCTTCTTTTTAAAGG - Intronic
977889500 4:102291865-102291887 CAGGATTTCCTTCTTTTTAAAGG - Intronic
978221579 4:106282100-106282122 CAGGTTTTGGATTTTTTTCATGG + Intronic
978539179 4:109797999-109798021 CAGGATTTCCTTCTTTTTTAAGG - Intronic
978731728 4:112035650-112035672 CAGAATTTGCTTCTTTTTAATGG - Intergenic
978898240 4:113916401-113916423 CAGGATTTTTTTCTTTTTTTGGG + Intronic
979228957 4:118324420-118324442 TAGGATTTGTTACTTTTTCTAGG - Intronic
979559575 4:122087074-122087096 CAGGATATGGATCTTTTGCAAGG + Intergenic
979913587 4:126403564-126403586 AAGAATTTGCTTCTTTGTCTAGG - Intergenic
980005463 4:127537289-127537311 CAGGATTTCCTTCTTGTTTTAGG + Intergenic
980094801 4:128478413-128478435 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
980541831 4:134205710-134205732 CAGGATTTCAATCTTTTTTATGG - Intergenic
981196195 4:141923575-141923597 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
981290904 4:143073321-143073343 CAGGATTTTCTTCTTTTTTTAGG + Intergenic
981826131 4:148943543-148943565 CTGGAATTACCTCTTTTTCTGGG - Intergenic
981847261 4:149183971-149183993 TAGGGTTTGCCTCTTTTTATGGG - Intergenic
981893169 4:149763813-149763835 CAGGTATTGCATCTTTTTGCAGG - Intergenic
982306594 4:153938343-153938365 CAGGATTTCCTTCTTTTTTATGG - Intergenic
982367150 4:154591703-154591725 CAGAATTTCCTTCTTTTTCAAGG - Intergenic
982573988 4:157085493-157085515 CTGTATTTTCATCTTTTTTTTGG + Intronic
982603341 4:157481292-157481314 CAGGATTTCATTCTTTTTCATGG - Intergenic
983005615 4:162481152-162481174 CAGGATTTTCTTTTTTTTATGGG - Intergenic
983666299 4:170188393-170188415 CAGGAGTTGGAGCTTTCTCTGGG + Intergenic
984550454 4:181153015-181153037 CATGATTTCCTTCTTTTTCATGG + Intergenic
984573088 4:181416621-181416643 CAGGTTCTGCACATTTTTCTTGG - Intergenic
984730856 4:183066686-183066708 CCTGATTTCCATTTTTTTCTGGG - Intergenic
985032273 4:185801201-185801223 CAGGATTTTCTTCTTTTTTAGGG + Intronic
1202770850 4_GL000008v2_random:205569-205591 CTGCATTTGTATCTTTATCTTGG - Intergenic
986004351 5:3655772-3655794 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
986149356 5:5112846-5112868 CAGGATTTCATTCTTTTTCGTGG + Intergenic
986963984 5:13247878-13247900 CAGGTTTTTTATTTTTTTCTAGG + Intergenic
987446197 5:18022504-18022526 CAGTATTTAGTTCTTTTTCTGGG - Intergenic
987749163 5:22017540-22017562 CAGAATTTGAATCATTTTCAGGG - Intronic
988179500 5:27771811-27771833 CAGGTTTTGCATTTTTTTGTGGG - Intergenic
988216509 5:28281326-28281348 CAGGATTTGTATCAGTATCTTGG - Intergenic
988378222 5:30467099-30467121 CAGGATTCCCATCTTTTTTAAGG + Intergenic
988568004 5:32335847-32335869 CAAGGATTTCATCTTTTTCTGGG + Intergenic
988947142 5:36215770-36215792 CAGGATTTCATTCTTTTTATGGG + Intronic
989650417 5:43682510-43682532 CAGGATTTTCCTGTTTTTCATGG + Intronic
990330154 5:54717853-54717875 CAGGATCTCCTTCTTTTTTTAGG - Intergenic
990330658 5:54722249-54722271 TAGAGTTTGCATTTTTTTCTTGG + Intergenic
990530104 5:56664922-56664944 CATGATTTCATTCTTTTTCTTGG + Intergenic
990755518 5:59065148-59065170 CAGGATTTCCTTCCTTTTTTAGG - Intronic
991381111 5:66028967-66028989 CAGGATTTCCTTCTTTTTTAAGG + Intronic
991701540 5:69320844-69320866 CAGGATTTCCTTCTTTTTCAAGG - Intronic
992012503 5:72542869-72542891 CAGGATTTCATTCTTTTTCATGG + Intergenic
992200260 5:74376506-74376528 CAGGACTGGCACCTTGTTCTGGG + Intergenic
992800356 5:80290066-80290088 CAAGATTTTCTTCTTTTACTTGG - Intergenic
993048610 5:82897726-82897748 CAGGATTTCCTTCTTTTTTAGGG - Intergenic
993093569 5:83456915-83456937 CAGGATTTCCTTCCTTTTCAAGG - Intergenic
993544327 5:89192417-89192439 CAGGATTTCCATCTTTATTAAGG + Intergenic
994316053 5:98334564-98334586 CAGGATTTTCTTCTTTTTTATGG + Intergenic
994459351 5:100053011-100053033 CGGGAATTGCATCTGTTTTTAGG + Intergenic
994470466 5:100198407-100198429 CTGGATTTGCTTCTATTTCCTGG + Intergenic
994859108 5:105165378-105165400 CAGAAATTACATTTTTTTCTGGG - Intergenic
995212994 5:109561751-109561773 TAGGATTTCAATCTTTTTTTAGG + Intergenic
995301118 5:110584316-110584338 CAGGATTTTCTTTTTCTTCTTGG - Intronic
995925123 5:117363627-117363649 TAGGTTTTGCATATTTTTGTTGG + Intergenic
996585075 5:125078388-125078410 CAGGATTTCCCTCTTTTTTAAGG - Intergenic
996872852 5:128211273-128211295 CAGGATTTGCTTCCTTTTTAAGG - Intergenic
997532275 5:134589052-134589074 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
997871350 5:137507781-137507803 CAGGATTTCCTTCTTTTTAAAGG + Intronic
997888376 5:137652480-137652502 CAGGATTTCCTTCTTTTTTAAGG - Intronic
998425159 5:142020302-142020324 CAAGATTTCCTTCTTTTTCAAGG + Intergenic
998546582 5:143033445-143033467 TAGGAAGTGCATCCTTTTCTAGG - Intronic
998799023 5:145849534-145849556 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1000157851 5:158569398-158569420 CAGAATTTTCATTTTTTACTAGG - Intergenic
1000212880 5:159124305-159124327 CAGAATTTCCTTCTTTTTCAAGG + Intergenic
1000380263 5:160622567-160622589 CTGGAGTTACATCTTTTTCCTGG + Exonic
1000529350 5:162399986-162400008 CAGGATTTCCTTCTTTTTTGAGG - Intergenic
1000751292 5:165099148-165099170 CAGGATTTTCTTCTTTTTCAAGG + Intergenic
1000806696 5:165803978-165804000 CAGGATTTCCCTCTTTTAATAGG - Intergenic
1000906772 5:166973826-166973848 CAGCATTTGCATTTTTGTATAGG - Intergenic
1000970231 5:167705937-167705959 CAGGAGTTCCTTCTTTTTCAAGG + Intronic
1001293543 5:170483296-170483318 CAGGAGTTGCATCTCCTCCTGGG - Intronic
1001438940 5:171723491-171723513 CAGAATTTGATTCTTTTTTTAGG + Intergenic
1001448860 5:171808633-171808655 CATGATTTCCTTCTTTTTCATGG - Intergenic
1003405825 6:5826548-5826570 CAGGATTTCCTTCTTTTTAGAGG - Intergenic
1003582414 6:7352725-7352747 AAGTATTTGCATTTATTTCTGGG - Intronic
1003663872 6:8090863-8090885 CAGGATTTCCTTCTTTTTTAGGG + Intronic
1003852531 6:10239964-10239986 GAGGATGGGCATCTTTTTCTTGG + Intergenic
1004175279 6:13334510-13334532 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1004823479 6:19395504-19395526 CATGATTTGATTCTTTTTCATGG - Intergenic
1005811048 6:29517003-29517025 CAGGATTTCCTTCTTTTGCATGG + Intergenic
1007362073 6:41365880-41365902 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1007871566 6:45045297-45045319 CAGGAACTTCATCTTTTTGTTGG + Intronic
1008151936 6:47963651-47963673 CAGAATTTCCTTCTTTTTCAAGG - Intronic
1008358632 6:50587569-50587591 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1008658182 6:53637640-53637662 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1008677469 6:53835318-53835340 CAGGATTTTCATTTTTCTTTTGG + Intronic
1008756864 6:54806477-54806499 CAGGATTTGTTTCTCTTTCTGGG + Intergenic
1008949744 6:57143866-57143888 CAGGATTTCAATCCTTTTCATGG - Intronic
1009745703 6:67812321-67812343 CAGGATTTTATTATTTTTCTTGG + Intergenic
1009803694 6:68574747-68574769 CAGGATTTCCTTCTTTTTCATGG - Intergenic
1010110814 6:72228497-72228519 CAGGATTTCCTTCTTTTTCAAGG + Intronic
1010694908 6:78960097-78960119 TTGAATTTTCATCTTTTTCTGGG - Intronic
1010705196 6:79100504-79100526 CAGGATTCCCTTCTTTTTCTTGG + Intergenic
1011038637 6:83005803-83005825 CAGGATTTCCATCCTTTTAAAGG - Intronic
1011901699 6:92306413-92306435 CAGGTTTTGGATTTTTTTCCTGG - Intergenic
1012020477 6:93912107-93912129 AGGGATTTGCATCTTTTTAATGG - Intergenic
1012256041 6:97033348-97033370 CAGGATTTTCTTCTTTTTTAAGG + Intronic
1012402313 6:98852001-98852023 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1012419367 6:99046351-99046373 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
1012483795 6:99697826-99697848 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1012522236 6:100135652-100135674 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1012636010 6:101543119-101543141 CAGGACATCCATCATTTTCTGGG - Intronic
1012677894 6:102139685-102139707 CAGGAATTGCATCTTTATATAGG + Intergenic
1012707914 6:102557417-102557439 AAGGACTTGCATTTTATTCTTGG + Intergenic
1012796122 6:103764103-103764125 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1012892340 6:104910717-104910739 CAGGATTTTCTTCTTTTTTATGG - Intergenic
1012960213 6:105614516-105614538 CTTGTTTTGCATCTTTGTCTTGG + Intergenic
1012960473 6:105616542-105616564 CTTGTTTTGCATCTTTGTCTTGG + Intergenic
1013443597 6:110197755-110197777 CAAGATTTCCTTCTTTTTCAAGG + Intronic
1013705052 6:112823138-112823160 CAGGATTTTCTTCTTTTTTATGG + Intergenic
1013776264 6:113682037-113682059 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1013981579 6:116136261-116136283 CAGGATTTTCTTCTTTTTTAAGG + Intronic
1015183970 6:130392250-130392272 CAGGCTATGCATTGTTTTCTAGG - Intronic
1015231891 6:130924148-130924170 CAGGATTTCCTTCTTTCTCAAGG + Intronic
1015517799 6:134101663-134101685 CAGGATTTTGTTCTTTTTCGTGG - Intergenic
1015655469 6:135513490-135513512 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1015999396 6:139028499-139028521 CAGGATCTGCATCTGATCCTGGG - Intergenic
1016524082 6:144980353-144980375 CAGAATTTGCTTCTTTTTTAAGG + Intergenic
1016855081 6:148660085-148660107 CAGGATTTTCTTCTTTTTTATGG - Intergenic
1017157589 6:151336091-151336113 CATGATTTCCTTCTTTTTCATGG + Intronic
1017678536 6:156840167-156840189 CAGCCTTTAAATCTTTTTCTTGG + Intronic
1018622209 6:165740655-165740677 CAGGATTTCCTTCTTTTTTAAGG - Intronic
1019123974 6:169826913-169826935 CAGGATTTGAACATTTTTCATGG - Intergenic
1019994450 7:4714974-4714996 GTGGTTCTGCATCTTTTTCTTGG + Intronic
1020355421 7:7270572-7270594 AAAGTTTTGGATCTTTTTCTTGG - Intergenic
1020356951 7:7288054-7288076 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1020941121 7:14538797-14538819 TAGGATTTCCATCTTTTTAAAGG - Intronic
1021057852 7:16072823-16072845 CAGGATTTCCTTCTTTTTGAAGG - Intergenic
1021070076 7:16227066-16227088 CAGGATTTCCTTCTTTTTCATGG + Intronic
1021322023 7:19224034-19224056 CAGAATTTCCTTCTTTTTCAAGG + Intergenic
1021635290 7:22685980-22686002 CAGGCTTTGCATTTATATCTAGG - Intergenic
1021822019 7:24507719-24507741 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1022442436 7:30445455-30445477 CAGGATTTCCTTCTTTTTTAAGG - Intronic
1022551331 7:31242268-31242290 CAGCATCTGCATCTTTTGGTTGG - Intergenic
1022552600 7:31255528-31255550 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1022641448 7:32188655-32188677 TAGGATTTGCATTTTTCTTTGGG + Intronic
1022784269 7:33621823-33621845 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1022934761 7:35162536-35162558 CATTATTTTTATCTTTTTCTAGG + Intergenic
1023103317 7:36740386-36740408 AAGCATTTGCATTTTTTTCCAGG - Intergenic
1023231500 7:38035310-38035332 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1023236549 7:38095925-38095947 CAGGATTTACTTCTTTTTAAAGG - Intergenic
1023262234 7:38369748-38369770 CAGGATTAGCATCTGTTGTTTGG + Intergenic
1023372448 7:39525353-39525375 CAGGATTTCCTTCTTTTTAAGGG - Intergenic
1023382863 7:39625158-39625180 CAGGAGTTGCTTATTTTTGTTGG + Intronic
1023597543 7:41847522-41847544 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1023646428 7:42321422-42321444 CAGGATTTGCTTCTTTTTTGAGG + Intergenic
1024108700 7:46121838-46121860 CAGGATTTCCATCTTGTTGGAGG + Intergenic
1024743403 7:52379814-52379836 CAGGATTTCCATCCTTTTTATGG - Intergenic
1026234540 7:68514782-68514804 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1026507704 7:70999648-70999670 AAGTTTTTGCATCCTTTTCTTGG + Intergenic
1026514294 7:71054531-71054553 CAGGATTTTCTTCTTTTTAAAGG - Intergenic
1027155861 7:75767394-75767416 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1027425330 7:78056244-78056266 CAGGATTTCCTTCTTTTTTAAGG + Intronic
1027551782 7:79607096-79607118 CAGGATTTCCTTCTTTTTTGTGG - Intergenic
1027568514 7:79830461-79830483 CAGGATTTTCTTCTTTTTTATGG - Intergenic
1027573659 7:79904225-79904247 CAGAATTTCCATCTTTTTAAAGG - Intergenic
1027731951 7:81885557-81885579 GATGATTTGCAGCTTTATCTAGG + Intergenic
1028239939 7:88407526-88407548 CAGAATTTCCTTCTTTTTCATGG + Intergenic
1028358261 7:89935949-89935971 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1028411774 7:90537900-90537922 AAGGATTTGCACTTTATTCTAGG - Intronic
1028803072 7:94990874-94990896 CAGGATTTCCTTCTTTTTTATGG + Intronic
1029074035 7:97921942-97921964 CAGGATTTCCTTCTTTTTGAAGG - Intergenic
1029588637 7:101492283-101492305 GAGGATTTGCCACTGTTTCTTGG + Intronic
1030232103 7:107219501-107219523 CAGGATTTGCTTCTTTTTGAAGG - Intronic
1030350239 7:108476803-108476825 CAGGATTTCCTTCTTTTTTAAGG - Intronic
1030594465 7:111520664-111520686 CAGAATTTGCATTTTGTTATAGG - Intronic
1030731453 7:112994642-112994664 CAGGATTTTCTTCTTTTTAAAGG - Intergenic
1031347439 7:120686399-120686421 TAGGATTTCCATCTTTTTAAAGG - Intronic
1031775128 7:125899394-125899416 CAAGGTTTTCATCTTTTTTTAGG + Intergenic
1031992484 7:128207338-128207360 CAGGGATGGCATCTTCTTCTTGG + Intergenic
1032165956 7:129545036-129545058 CAGGATTTCCTTCTTTTTTTAGG - Intergenic
1032661693 7:133990753-133990775 CAGGATTTTATTCTTTTTATGGG + Intronic
1032963143 7:137063844-137063866 CAGGATTTCCATCTTTTTTAAGG - Intergenic
1033647129 7:143314135-143314157 CAGGATTTTCTTCTTTGTCAGGG + Intergenic
1033925967 7:146460640-146460662 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1034249701 7:149678580-149678602 CAGAATTTCCATCTTTTTAAAGG + Intergenic
1034363259 7:150521427-150521449 CAAGATTTACTTCTTTTTCAAGG + Intergenic
1035091013 7:156310334-156310356 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1035380363 7:158435740-158435762 CAGGATTTTCTTCTTTTTTAAGG - Intronic
1036207970 8:6819194-6819216 CAGGAATTGCAGCTTCTTCTGGG + Intronic
1036243667 8:7099353-7099375 CAGGATTTCCTTCTTTTTGAAGG + Intergenic
1036309181 8:7673303-7673325 CAGGATTTCCTTCTTTTTGAAGG - Intergenic
1036360353 8:8072816-8072838 CAGGATTTCCTTCTTTTTGAAGG + Intergenic
1036666409 8:10745612-10745634 CAGGATTTGTCTTTTTTTATTGG + Intronic
1036683069 8:10890097-10890119 CAGGAGGGGCATTTTTTTCTTGG + Intergenic
1036890617 8:12594151-12594173 CAGGATTTCCTTCTTTTTGAAGG - Intergenic
1036898172 8:12652071-12652093 CAGGATTTCCTTCTTTTTGAAGG - Intergenic
1037745289 8:21638940-21638962 CAGGATTTCCGTCTTTTTAAAGG - Intergenic
1038172286 8:25147043-25147065 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1038682481 8:29681972-29681994 CAGGATTTCATTCTTTTTCATGG + Intergenic
1038759168 8:30370507-30370529 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1038875240 8:31541360-31541382 CACTATTTGCATATCTTTCTAGG + Intergenic
1039646393 8:39289210-39289232 TAGGATTTCTATCTTTTTTTTGG + Intergenic
1040343834 8:46465602-46465624 CAGGATATTCATTTTTTTATTGG + Intergenic
1040496336 8:47968895-47968917 CATGATTTGCATGCTTTTGTCGG + Intronic
1040578227 8:48673287-48673309 CATTATTTGCAACTTTTTGTTGG + Intergenic
1041275596 8:56154866-56154888 CAGAATTTGCCTCCTGTTCTGGG - Intergenic
1041298098 8:56382275-56382297 TATGATTTCCATCTTTTTGTTGG - Intergenic
1041419269 8:57648267-57648289 CAGGTTTTGCATCTTGCTCCAGG + Intergenic
1041486351 8:58381749-58381771 CAGGATTTTCTTCTTTTTAATGG + Intergenic
1041556851 8:59167268-59167290 CAGGATTTTCTTCCTTTTCAAGG + Intergenic
1041853192 8:62417296-62417318 CAGGATTTCATTCTTTTTTTAGG + Intronic
1041853779 8:62424953-62424975 CAGGATTTGCTTCTTTTTTAAGG - Intronic
1042069944 8:64920899-64920921 CAGGACTTTCTTCTTTTTTTAGG + Intergenic
1042074231 8:64971966-64971988 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1042199397 8:66266594-66266616 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1042567475 8:70127000-70127022 CAGGATTTCCCTCTGTCTCTGGG + Exonic
1042646208 8:70988986-70989008 CAGGATTTCCTTCTTTTTGAAGG + Intergenic
1042734557 8:71973672-71973694 CAACATTTTCTTCTTTTTCTGGG + Intronic
1043037154 8:75212443-75212465 CAGGATTTGGATCTGTTCCTGGG - Intergenic
1043603285 8:81967672-81967694 TGGCATTTGCATCTTTTTCTAGG + Intergenic
1043944474 8:86233708-86233730 CAGGATTTACATCTAGTCCTGGG + Intronic
1043944584 8:86235072-86235094 CAGGATTTACATCTAGTCCTGGG + Intronic
1044175602 8:89117481-89117503 CAGGATTTGCTTCTTTTCTAAGG - Intergenic
1044680742 8:94775011-94775033 CAGGATTTTCTTCTTTTTCAAGG + Intronic
1044826703 8:96205377-96205399 CAGGATTTCCTTCTTTTTTGAGG + Intergenic
1044872640 8:96634575-96634597 CAGGATTTCCTTCCTTTTCAAGG + Intergenic
1045125153 8:99081228-99081250 CAGGTTTTACATCTTTTGCATGG + Intronic
1045432994 8:102131268-102131290 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1045633654 8:104157635-104157657 CAGAATTTGCTTCTTTTTTAAGG + Intronic
1045832885 8:106485774-106485796 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1046204596 8:110976197-110976219 TAGGATTTCCATCTTTTTAAAGG - Intergenic
1046553450 8:115746222-115746244 CAGGATTTCCTTCTTTTTTATGG - Intronic
1047355592 8:124118822-124118844 AAGGTTTTGCATCTTTTTGCAGG + Exonic
1047409849 8:124615385-124615407 CAGGATTTCCTTCCTTTTTTAGG - Intronic
1047819919 8:128507612-128507634 CAGGATTTATCTCTTTTACTTGG - Intergenic
1048145950 8:131843443-131843465 AAGGATTTGCATCTTCTTTATGG + Intergenic
1048151767 8:131901641-131901663 TGGGATCTGCATCTTTTTCAAGG + Intergenic
1048326718 8:133445285-133445307 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1048954042 8:139519510-139519532 CAGGATTTTCTTCTTTTTTATGG + Intergenic
1049076907 8:140404399-140404421 CAGGCATTTCATCTTGTTCTAGG + Intronic
1050212307 9:3274514-3274536 CAGAATTTGCTTCATTGTCTGGG - Intronic
1050241422 9:3639873-3639895 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1051106246 9:13584143-13584165 CAAGATTTTCTTCTTTTTTTAGG + Intergenic
1051132400 9:13876799-13876821 CTGTATTTGGTTCTTTTTCTTGG - Intergenic
1051559399 9:18423360-18423382 CAGGATTATCAGCTTTTTGTTGG - Intergenic
1051764221 9:20504411-20504433 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1051864968 9:21669670-21669692 CAGGATTTTCTTCTTTTTTATGG + Intergenic
1051924250 9:22304477-22304499 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1052077888 9:24166632-24166654 CAGGATTTCCCTCTTTTTAATGG + Intergenic
1052264545 9:26556565-26556587 CACGATTTCCTTCTTTTTCATGG + Intergenic
1052379207 9:27751807-27751829 CAGGAATTGGATATTCTTCTAGG - Intergenic
1052579541 9:30337426-30337448 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
1052943396 9:34148082-34148104 CAGGATTGGCTTCTATCTCTTGG - Intergenic
1053534524 9:38912748-38912770 GATCATTTGCATCTGTTTCTGGG + Intergenic
1054206743 9:62137167-62137189 GATCATTTGCATCTGTTTCTTGG + Intergenic
1054355189 9:64054118-64054140 CTGCATTTGTATCTTTATCTTGG + Intergenic
1054631608 9:67451180-67451202 GATCATTTGCATCTGTTTCTTGG - Intergenic
1054853116 9:69869272-69869294 CAGGATTTTCTTCTTTTTTAAGG - Intronic
1055460230 9:76512448-76512470 CAGGATTTTCTTATTTTTCATGG + Intergenic
1055570596 9:77613032-77613054 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1055940276 9:81642896-81642918 TAGGATTTTCTTCTTTTTCAAGG - Intronic
1056105191 9:83340170-83340192 CAGGTTTTGTATTTTTTTGTAGG - Intronic
1056506386 9:87262106-87262128 CAGTATTTCCTTCTTTTTGTGGG + Intergenic
1056681585 9:88724055-88724077 CAAGATTTCCATCTTTTTAAAGG + Intergenic
1056923970 9:90816865-90816887 TAGGATTTCCTTCTTTTTCATGG + Intronic
1057524896 9:95789900-95789922 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1057595011 9:96408441-96408463 CAGGATTTCCATCTTTCTGAAGG - Intronic
1057811717 9:98262394-98262416 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1058569919 9:106330310-106330332 CAGGATTTAGACATTTTTCTAGG - Intergenic
1058640904 9:107084200-107084222 CAGGATTTCCCTCTTTTTAAAGG - Intergenic
1058771393 9:108236188-108236210 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1059028420 9:110662548-110662570 CAGGATTTTCTTCTTTTTAAAGG + Intergenic
1059094786 9:111400883-111400905 CTGGGTGTTCATCTTTTTCTAGG - Intronic
1059236710 9:112766785-112766807 CAGGATTTCCATCTTTTTTAAGG + Intronic
1059795379 9:117689154-117689176 CATAATTTTCTTCTTTTTCTAGG - Intergenic
1059967484 9:119629598-119629620 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1060020709 9:120128232-120128254 CAGGATTTTCTTCTTTTTAAAGG - Intergenic
1060483679 9:124033452-124033474 CAGGAATTGGATCTTTGTCTCGG - Intergenic
1060713809 9:125900395-125900417 CTACATTTGCATCTTTTGCTTGG + Intronic
1061956775 9:133967549-133967571 CAGGATTTTATTCTTTTTCATGG - Intronic
1061976197 9:134068888-134068910 CACGTTTTGCATCTTGTTTTGGG + Intergenic
1203743517 Un_GL000218v1:23223-23245 CTGCATTTGTATCTTTATCTTGG + Intergenic
1203452352 Un_GL000219v1:131119-131141 AAGGATTTCCTTCTTTTTCAAGG - Intergenic
1203703799 Un_KI270742v1:18184-18206 CTGCATTTGTATCTTTATCTTGG + Intergenic
1185483291 X:464098-464120 CATGATTTGATTCTTTTTCATGG - Intergenic
1185550243 X:977194-977216 CAAGATTTTCTTCTTTTTCAAGG - Intergenic
1186301871 X:8208155-8208177 TATGAGGTGCATCTTTTTCTTGG + Intergenic
1186574857 X:10753987-10754009 AAGGATTTGAATTTTTTACTTGG - Intronic
1186723928 X:12336481-12336503 CAGAAAATGCATCTTTTTCTTGG - Intronic
1187044790 X:15636356-15636378 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1187060788 X:15785336-15785358 CAGGATTTCCTTCTTTTTAAAGG - Exonic
1187752960 X:22487615-22487637 CAAGCTTTGCATATTTTACTGGG - Intergenic
1187777749 X:22782396-22782418 CAGGATTTTCTTCTTTTTGAAGG - Intergenic
1188024707 X:25195968-25195990 CAGGATTTCTTTATTTTTCTTGG + Intergenic
1188226068 X:27599184-27599206 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1188412332 X:29888648-29888670 CAAGATATGCATTTTTTTCTTGG - Intronic
1188845949 X:35072426-35072448 CAGGTTTTGGATTTCTTTCTGGG + Intergenic
1188951852 X:36385791-36385813 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1189024946 X:37384361-37384383 CAGGATTTGCTTCATTTTGGTGG - Intronic
1189078960 X:37948764-37948786 CAGGATTTCCTTCTTTTTTATGG + Intronic
1189151808 X:38716776-38716798 CAGAATTTCCTTCTTTTTCAAGG + Intergenic
1189889068 X:45579986-45580008 AGATATTTGCATCTTTTTCTAGG + Intergenic
1190009684 X:46773701-46773723 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1190409343 X:50119687-50119709 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1190459287 X:50655439-50655461 CAGGATTTCCTTCTTTTTTATGG + Intronic
1190524738 X:51317457-51317479 CAGGATTTCCTTCTTTTTTAAGG - Intergenic
1190545536 X:51522577-51522599 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1191782785 X:64886411-64886433 CAGTCTCTGGATCTTTTTCTGGG + Intergenic
1192025938 X:67451733-67451755 CAGGATTTGATTCTTTTTAATGG - Intergenic
1192179146 X:68905074-68905096 CAGGATTTTCTTCTTTTTAAAGG + Intergenic
1192253415 X:69433355-69433377 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1192400611 X:70831126-70831148 CAGGATTTCCTTCTTTTTTATGG - Intronic
1192440257 X:71169126-71169148 CACCATTTCCATCTTTTTCAGGG - Intronic
1192749340 X:73972100-73972122 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1193209438 X:78788678-78788700 CAGGTTTTGCATTTCTTTATAGG + Intergenic
1193254278 X:79328006-79328028 CAGAATTTGCTTCTTTTTTAAGG + Intergenic
1193585233 X:83312917-83312939 CAGTATTGGTCTCTTTTTCTGGG - Intergenic
1193812195 X:86064830-86064852 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1193860927 X:86666572-86666594 CTGGATTTGCAGCTACTTCTTGG - Intronic
1193881578 X:86929392-86929414 CAGTATTTGCATTTTCTTCCTGG - Intergenic
1193924986 X:87473821-87473843 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
1194073471 X:89358038-89358060 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1194491487 X:94555395-94555417 CAGCCTTTACATCTTTGTCTGGG + Intergenic
1194791101 X:98150788-98150810 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1194847834 X:98833655-98833677 CAAGATTTTCTTCTTTTTCATGG + Intergenic
1196115918 X:111999441-111999463 CAGGATTTCATTCTTTTTCATGG + Intronic
1196129405 X:112138059-112138081 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1196142640 X:112281313-112281335 CAGGATTTCCTTCTTTTTTACGG + Intergenic
1196164549 X:112524156-112524178 CAGGAGTTTCATCTTTTTAAAGG + Intergenic
1196296903 X:114008327-114008349 CAGGTTTTGGATATTCTTCTAGG - Intergenic
1196317576 X:114247102-114247124 CAGGATTTTCTTCTTTTTTAGGG - Intergenic
1196623959 X:117856492-117856514 CAAGATTTCCATCTGTTACTGGG + Intergenic
1196902072 X:120394531-120394553 CAGGATTTCCCTCTTTTTAAAGG - Intergenic
1197524201 X:127541763-127541785 CAGGTTATGCATTTTTTTCCTGG + Intergenic
1197946348 X:131843051-131843073 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1197948614 X:131869899-131869921 CTGGATTTGCTTCTCTTTCATGG - Intergenic
1198504132 X:137284321-137284343 CAGGATTTCCTTCTTTTTTATGG - Intergenic
1198940209 X:141946225-141946247 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
1199205746 X:145146470-145146492 CAGGATAGGCAGCTGTTTCTGGG - Intergenic
1199460007 X:148073949-148073971 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1199558357 X:149134324-149134346 CAGGATTTCCTTCTTTTTAATGG + Intergenic
1200335275 X:155344347-155344369 CAGGACTTTCTTCTTTTTCAAGG + Intergenic
1200351193 X:155496874-155496896 CAGGACTTTCTTCTTTTTCAAGG - Intronic
1200728853 Y:6709616-6709638 CAGGATTTCCTTCTTTTTTAAGG + Intergenic
1200859830 Y:7978910-7978932 CACGATTTTAATCTTTTGCTGGG + Intergenic
1200906641 Y:8490174-8490196 CATGATTTTAATCTTTTGCTGGG - Intergenic
1201737643 Y:17286581-17286603 CAAGATTTCCTTCTTTTTCAAGG - Intergenic
1202268112 Y:23042262-23042284 AATGATTTGACTCTTTTTCTAGG + Intergenic
1202421104 Y:24676006-24676028 AATGATTTGACTCTTTTTCTAGG + Intergenic
1202449682 Y:24994076-24994098 AATGATTTGACTCTTTTTCTAGG - Intergenic