ID: 1086163522

View in Genome Browser
Species Human (GRCh38)
Location 11:83750153-83750175
Sequence GCTTCAGATGGGAATCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086163522_1086163529 -6 Left 1086163522 11:83750153-83750175 CCCCCAAGATTCCCATCTGAAGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1086163529 11:83750170-83750192 TGAAGCAGCTCACTGGCCCTAGG 0: 1
1: 0
2: 0
3: 20
4: 206
1086163522_1086163533 18 Left 1086163522 11:83750153-83750175 CCCCCAAGATTCCCATCTGAAGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1086163533 11:83750194-83750216 TTTAAGGCTAAAAGTCGTGTAGG 0: 1
1: 0
2: 0
3: 6
4: 77
1086163522_1086163530 2 Left 1086163522 11:83750153-83750175 CCCCCAAGATTCCCATCTGAAGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1086163530 11:83750178-83750200 CTCACTGGCCCTAGGATTTAAGG 0: 1
1: 0
2: 0
3: 15
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086163522 Original CRISPR GCTTCAGATGGGAATCTTGG GGG (reversed) Intronic