ID: 1086163522

View in Genome Browser
Species Human (GRCh38)
Location 11:83750153-83750175
Sequence GCTTCAGATGGGAATCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086163522_1086163533 18 Left 1086163522 11:83750153-83750175 CCCCCAAGATTCCCATCTGAAGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1086163533 11:83750194-83750216 TTTAAGGCTAAAAGTCGTGTAGG 0: 1
1: 0
2: 0
3: 6
4: 77
1086163522_1086163530 2 Left 1086163522 11:83750153-83750175 CCCCCAAGATTCCCATCTGAAGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1086163530 11:83750178-83750200 CTCACTGGCCCTAGGATTTAAGG 0: 1
1: 0
2: 0
3: 15
4: 213
1086163522_1086163529 -6 Left 1086163522 11:83750153-83750175 CCCCCAAGATTCCCATCTGAAGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1086163529 11:83750170-83750192 TGAAGCAGCTCACTGGCCCTAGG 0: 1
1: 0
2: 0
3: 20
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086163522 Original CRISPR GCTTCAGATGGGAATCTTGG GGG (reversed) Intronic
900131300 1:1088346-1088368 ACTGCAGATGGGGGTCTTGGGGG - Intronic
900735209 1:4295390-4295412 GCATCAGTTGGGAGTCTGGGAGG - Intergenic
904677558 1:32207623-32207645 GCTGCAGATGAAAATCCTGGAGG + Exonic
905776425 1:40670350-40670372 GCTTCAGATGGGATGCCTTGGGG - Intergenic
906096271 1:43226287-43226309 GCCTCAGCTGGGAATACTGGGGG + Intronic
907883051 1:58569320-58569342 GCTGGAGATGGGAATTTGGGAGG - Intergenic
908149031 1:61280752-61280774 GCATTAGATGGGAATTTTGAAGG + Intronic
909727519 1:78853312-78853334 ACTTTAGGTGGGGATCTTGGGGG + Intergenic
910010724 1:82458297-82458319 GCTTCAAATGGGTAGATTGGGGG + Intergenic
911925583 1:103827129-103827151 CCGTAAGATGGGAATCTTTGGGG - Intergenic
915047623 1:153031824-153031846 GCTTCATATGGGACTTTTAGTGG - Intronic
918683361 1:187383339-187383361 GCTTAACATGTGAATTTTGGGGG - Intergenic
922213004 1:223499960-223499982 GCTTCAGATGCTACTCTTGAGGG - Intergenic
923768997 1:236920874-236920896 ACCTCAGCTGGGAATCCTGGAGG + Intergenic
1063788591 10:9413274-9413296 GCTGCAGAAGGGAATTTTGAAGG + Intergenic
1064070197 10:12222188-12222210 GCTGAAGATGGGAATCCTGGAGG + Intronic
1064425647 10:15226876-15226898 GCTCCAGGTGGGAAGCTGGGGGG - Intronic
1066177450 10:32923652-32923674 GCTGGAGATGGGAAACTTGGTGG - Exonic
1070703690 10:78621888-78621910 GGTTCAGGTGTGAATCCTGGAGG + Intergenic
1072033847 10:91546395-91546417 GGTACAGATGGGAATGTTGAGGG + Intergenic
1072225703 10:93367060-93367082 GTTTCAGATGGGTTTTTTGGTGG - Intronic
1072533011 10:96337232-96337254 GCATCAGGTAGGATTCTTGGGGG - Intronic
1073457362 10:103645718-103645740 GCCTCTACTGGGAATCTTGGTGG + Intronic
1073517292 10:104087855-104087877 GCTTCACATATGAATTTTGGAGG + Intergenic
1074895525 10:117773912-117773934 GCTTCTGATGGGAATATGGTTGG - Intergenic
1086163522 11:83750153-83750175 GCTTCAGATGGGAATCTTGGGGG - Intronic
1086902163 11:92380219-92380241 ACTGCAAATGGGAATCTTGAAGG - Intronic
1088894533 11:114067776-114067798 GCCTTTGATGGGAAGCTTGGGGG + Intronic
1089086231 11:115819218-115819240 GCTGGAGATGGAAATGTTGGAGG + Intergenic
1091802009 12:3330338-3330360 GCTGCAGATGGGCAGCTAGGAGG + Intergenic
1092597328 12:10021870-10021892 GCTTCAGATTGGAATCATGTAGG - Intergenic
1092879914 12:12880091-12880113 ACTTCAGATGTGAATTTTAGAGG + Intergenic
1093182052 12:15977768-15977790 GCTTCACATGGGAAGTGTGGAGG + Intronic
1094259948 12:28483219-28483241 GCTTCAGTTTTGATTCTTGGAGG - Intronic
1097217047 12:57422382-57422404 GCTACATATGGGATTCTTGTGGG - Intronic
1097517066 12:60618728-60618750 CCTTTAGATGGGAATTTTTGGGG - Intergenic
1098578882 12:72075502-72075524 GCTTCAGTTGGGAATTCTGGAGG - Intronic
1100447416 12:94674371-94674393 GCTTCAAATGGCAACCCTGGGGG + Intergenic
1108528092 13:51302870-51302892 GCTTCAGATTGGCACCTTGTGGG + Intergenic
1110160802 13:72376051-72376073 GAATAAGATGGGAATATTGGAGG + Intergenic
1111311698 13:86496078-86496100 GCTTTAAATGGGAATGTTAGAGG + Intergenic
1112241707 13:97688204-97688226 GATTAAGTTGGGAATCTTGGGGG + Intergenic
1113275690 13:108726949-108726971 GTTACAGATGGGAATGTTGAGGG + Intronic
1113499152 13:110759653-110759675 GATTAAGTAGGGAATCTTGGAGG + Intergenic
1113774053 13:112932548-112932570 GCTTAAGATATGAATATTGGAGG + Intronic
1113930556 13:113966642-113966664 GCTGCTGATGGGAATGATGGTGG + Intergenic
1115000673 14:28416862-28416884 GATGCCAATGGGAATCTTGGTGG - Intergenic
1116672025 14:47854864-47854886 GGTTCAGAGGGGAATCTGGTGGG + Intergenic
1118043047 14:61938064-61938086 GTTTCAGACAGGAAACTTGGAGG + Intergenic
1119777990 14:77260057-77260079 GCAGAAGATGGGAATCTTGTGGG + Intergenic
1120011796 14:79423937-79423959 GCTTCTGATGGGAATGCTGTAGG + Intronic
1120700790 14:87696825-87696847 TCTTCAGATGGGAACTGTGGGGG - Intergenic
1121276185 14:92669506-92669528 GCTCTAAATGGGAATCATGGTGG + Intronic
1121964626 14:98292533-98292555 GCTTTAGAAGGGAAACTAGGTGG - Intergenic
1122814025 14:104303570-104303592 GTTTCACATAGGAATTTTGGGGG + Intergenic
1128074715 15:64818953-64818975 GCTTAAGATGGGAAGGTGGGTGG + Intronic
1129778404 15:78252381-78252403 GCTTAACATGGGAACCTTGTGGG - Intergenic
1130207765 15:81893871-81893893 GCTTCAGTTTGGAATCATGGGGG - Intergenic
1132084519 15:98896407-98896429 GCTGCAGAAAGGAAGCTTGGGGG - Intronic
1133399958 16:5478600-5478622 TCTGCACATCGGAATCTTGGGGG - Intergenic
1144082956 17:11781280-11781302 GTGCCAGATGGGAATCTTTGTGG + Intronic
1144203798 17:12964908-12964930 GTCTCAGATGGGCATCTTGCAGG - Intronic
1148855356 17:50576116-50576138 GCCTCAGATGGGGACCTGGGAGG - Exonic
1150106742 17:62467790-62467812 ACGTCAGATGGGCAACTTGGTGG + Intronic
1151985347 17:77539890-77539912 GCTTAGGAGGTGAATCTTGGTGG + Intergenic
1156069435 18:33188300-33188322 GCCTAAGATGGAAATCTTAGAGG - Intronic
1160286768 18:77550317-77550339 GATTCAGATTGGAATCTGTGAGG - Intergenic
925065602 2:927254-927276 CCTGCAGATTGGAATCATGGGGG - Intergenic
927396228 2:22654672-22654694 GCTCCAGTTGGGACTCTTTGTGG - Intergenic
927592019 2:24364714-24364736 TATTCAGATGGGAATTTTGAAGG + Intergenic
928590597 2:32810637-32810659 GCTCCAGAGGGGAATCTGGCTGG + Intronic
929581626 2:43085183-43085205 GGTTCGGATGGAAATATTGGGGG + Intergenic
933153039 2:78937605-78937627 GCATTAGATGGGACACTTGGTGG - Intergenic
935139845 2:100343489-100343511 GCTTGTGATGGGAATGTTGCTGG - Intergenic
936086730 2:109474443-109474465 GCTACTGATGGGAACCTAGGTGG + Intronic
938604176 2:132875185-132875207 GAGTCAGATGGGAATCTCTGAGG + Intronic
940477780 2:154188122-154188144 ACTAGAGATGGAAATCTTGGAGG - Intronic
1168851399 20:979429-979451 GCTTCAGCTAGACATCTTGGAGG - Intronic
1170293314 20:14795368-14795390 ACTTCAGAAGTGAATCTTGAAGG + Intronic
1170740037 20:19047996-19048018 GTCTCAGATGGGACTCCTGGGGG + Intergenic
1172240204 20:33408127-33408149 GCTTCAGATGGGACCTCTGGGGG + Exonic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1174353601 20:49984244-49984266 GCTTCGGATGTGCATCTTGAGGG - Exonic
1177560364 21:22743447-22743469 GCTTCACATAGGAATTTTGAGGG - Intergenic
1177798912 21:25808106-25808128 GCATGACATGGGAATTTTGGAGG - Intergenic
1180867711 22:19128902-19128924 GCTTCGGGTGGGACTCTGGGAGG + Intergenic
1183057755 22:35317587-35317609 GCACCAGAGGGGAATCTAGGTGG - Intronic
950107538 3:10397775-10397797 GCTGCAGGTGGGGATGTTGGAGG - Intronic
952524435 3:34195529-34195551 TATTCACATTGGAATCTTGGTGG - Intergenic
953418902 3:42739675-42739697 GAGTCAGATGGGAACCCTGGTGG - Exonic
953860050 3:46536603-46536625 GCTGCACATGGGAATCATGTAGG + Intronic
954640948 3:52097377-52097399 GCTTCAGATAGGACTCCAGGAGG + Intronic
958605322 3:96350686-96350708 GGCTCATATGGTAATCTTGGTGG + Intergenic
962024462 3:131532632-131532654 GCTTCATATATGAATTTTGGAGG - Intergenic
968040924 3:195588664-195588686 GCTACAGATGGGAAGCCTGGAGG + Intergenic
970138914 4:12958479-12958501 ACTTCAGTTGGAAATTTTGGGGG - Intergenic
970293511 4:14602723-14602745 GCTACAGATGGGATTCTTGATGG + Intergenic
975006533 4:69295731-69295753 GATTCAGATGGGAGTGTGGGAGG - Intronic
985648686 5:1097294-1097316 GCTTCTGCTGGGAGTGTTGGAGG - Intronic
985847259 5:2359700-2359722 GTTTCAGATGTGAGTGTTGGAGG - Intergenic
991655985 5:68904181-68904203 GCTTGAAATGGGACACTTGGAGG + Intergenic
993126285 5:83839764-83839786 GGGTCATATGTGAATCTTGGAGG - Intergenic
998621181 5:143795935-143795957 GCTTCAGATGGGGTTCTTCCTGG - Intergenic
1001305208 5:170567395-170567417 ACATCAGATGGGAAGCTAGGAGG + Intronic
1001534380 5:172488512-172488534 GCCTCAGACGGGAGGCTTGGGGG + Intergenic
1001913628 5:175541432-175541454 GCTTCAGAGGGGACTCCCGGCGG + Intergenic
1001978548 5:176021265-176021287 GCTTCCTATGGGAAACTTGCTGG - Intronic
1002238869 5:177822497-177822519 GCTTCCTATGGGAAACTTGCTGG + Intergenic
1008110155 6:47483397-47483419 GATTCAGACTGGCATCTTGGGGG + Intronic
1011702310 6:89967156-89967178 GCTTCAGAATGGTACCTTGGAGG + Intronic
1012123075 6:95391272-95391294 CCTACAGATGGAAGTCTTGGAGG - Intergenic
1014527314 6:122516294-122516316 GCTTCAGATCTGCTTCTTGGGGG + Intronic
1016548959 6:145255623-145255645 ACTTCAGATGGACAGCTTGGTGG - Intergenic
1021150115 7:17140352-17140374 AATGCAGATGGGAATCTTGAAGG + Intergenic
1024510770 7:50203081-50203103 GCTTCCCATGGGAAGCTTGCAGG - Intergenic
1028208247 7:88041242-88041264 CCTTGGGGTGGGAATCTTGGGGG + Intronic
1030273506 7:107694929-107694951 GCCTCATATGGGATTCTTGCTGG - Intronic
1032189573 7:129756417-129756439 GCTTCAGAAGGGACTCCTGGAGG + Exonic
1032739366 7:134723472-134723494 GAATCAAATGGGAATATTGGGGG - Intergenic
1033535075 7:142304556-142304578 GTTTCAGATGTGCATCCTGGAGG - Intergenic
1039135823 8:34321688-34321710 GCTAGGGATGGGAATCCTGGGGG + Intergenic
1039727029 8:40229468-40229490 GCTTCAGATGAGAAACTTCAGGG - Intergenic
1041712369 8:60906185-60906207 GCTGCAGATGTGGATCATGGCGG - Intergenic
1041820527 8:62027717-62027739 GCTGCAGAAGGGCATCTTGGGGG - Intergenic
1045017428 8:98011292-98011314 GATTCAGATGTAAATTTTGGGGG + Intronic
1047006687 8:120627758-120627780 GCTCTAGATGGGATTGTTGGAGG + Intronic
1048274152 8:133053216-133053238 GCTTCAGAGGAAAATCTTAGGGG - Intronic
1049408776 8:142463298-142463320 GCTGCAGAGGGCAGTCTTGGGGG + Intronic
1051128738 9:13835366-13835388 GCTCCAGTTGGGACTCTAGGGGG - Intergenic
1053002933 9:34587509-34587531 GATTCATATGGGAACTTTGGGGG - Intronic
1059853342 9:118367796-118367818 GCTACATATAGGAAACTTGGTGG - Intergenic
1062396427 9:136354677-136354699 GCTTCAGCTGGGCCCCTTGGGGG + Intronic
1185611791 X:1397517-1397539 CCTTCAGAGGGCAGTCTTGGGGG - Intergenic
1187565715 X:20447508-20447530 GCTACAGATGCAAATGTTGGAGG + Intergenic
1188216208 X:27480520-27480542 GCTTCAGGTGGGTCTCTTGGCGG + Intergenic
1188616954 X:32169050-32169072 GCTTCAGGTAGGAATCCTGCAGG + Intronic
1191052268 X:56206783-56206805 GCTCCAGATGGGACTCTGTGTGG + Intergenic
1192772175 X:74204347-74204369 GCTAGAGATAGCAATCTTGGTGG - Intergenic
1194629398 X:96264977-96264999 GCTTCAGCTTGAAACCTTGGGGG - Intergenic
1196941223 X:120777912-120777934 GCCTCAGATGTGAACTTTGGAGG + Intergenic
1197609299 X:128621199-128621221 GCTTCAGATGGGAAACTTCAGGG - Intergenic
1197773743 X:130106950-130106972 GCTACAGGTGGCAATCTTGCAGG - Intronic