ID: 1086163530

View in Genome Browser
Species Human (GRCh38)
Location 11:83750178-83750200
Sequence CTCACTGGCCCTAGGATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 213}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086163525_1086163530 -1 Left 1086163525 11:83750156-83750178 CCAAGATTCCCATCTGAAGCAGC 0: 1
1: 0
2: 2
3: 15
4: 158
Right 1086163530 11:83750178-83750200 CTCACTGGCCCTAGGATTTAAGG 0: 1
1: 0
2: 0
3: 15
4: 213
1086163528_1086163530 -10 Left 1086163528 11:83750165-83750187 CCATCTGAAGCAGCTCACTGGCC 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1086163530 11:83750178-83750200 CTCACTGGCCCTAGGATTTAAGG 0: 1
1: 0
2: 0
3: 15
4: 213
1086163524_1086163530 0 Left 1086163524 11:83750155-83750177 CCCAAGATTCCCATCTGAAGCAG 0: 1
1: 0
2: 2
3: 14
4: 150
Right 1086163530 11:83750178-83750200 CTCACTGGCCCTAGGATTTAAGG 0: 1
1: 0
2: 0
3: 15
4: 213
1086163523_1086163530 1 Left 1086163523 11:83750154-83750176 CCCCAAGATTCCCATCTGAAGCA 0: 1
1: 0
2: 1
3: 8
4: 214
Right 1086163530 11:83750178-83750200 CTCACTGGCCCTAGGATTTAAGG 0: 1
1: 0
2: 0
3: 15
4: 213
1086163522_1086163530 2 Left 1086163522 11:83750153-83750175 CCCCCAAGATTCCCATCTGAAGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1086163530 11:83750178-83750200 CTCACTGGCCCTAGGATTTAAGG 0: 1
1: 0
2: 0
3: 15
4: 213
1086163527_1086163530 -9 Left 1086163527 11:83750164-83750186 CCCATCTGAAGCAGCTCACTGGC 0: 1
1: 0
2: 1
3: 13
4: 103
Right 1086163530 11:83750178-83750200 CTCACTGGCCCTAGGATTTAAGG 0: 1
1: 0
2: 0
3: 15
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086163530 Original CRISPR CTCACTGGCCCTAGGATTTA AGG Intronic