ID: 1086167651

View in Genome Browser
Species Human (GRCh38)
Location 11:83798065-83798087
Sequence CCTTCTAAGCAGCATCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086167651_1086167654 4 Left 1086167651 11:83798065-83798087 CCTTGGAGATGCTGCTTAGAAGG 0: 1
1: 0
2: 1
3: 16
4: 195
Right 1086167654 11:83798092-83798114 GCAAATGCTCATGGCTGCCAAGG 0: 1
1: 0
2: 1
3: 16
4: 199
1086167651_1086167653 -5 Left 1086167651 11:83798065-83798087 CCTTGGAGATGCTGCTTAGAAGG 0: 1
1: 0
2: 1
3: 16
4: 195
Right 1086167653 11:83798083-83798105 GAAGGCAGAGCAAATGCTCATGG 0: 1
1: 1
2: 3
3: 30
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086167651 Original CRISPR CCTTCTAAGCAGCATCTCCA AGG (reversed) Intronic
902236811 1:15062941-15062963 CCTTCCAGGCAGGAGCTCCAGGG - Intronic
905291810 1:36926699-36926721 CTTTTTAAGCAGGATCTCCCAGG + Intronic
908855524 1:68422701-68422723 CTTTCTACCCAGCATCTCGAAGG - Intergenic
909918957 1:81356604-81356626 CCTTCTAAGCATCTTCTCAGTGG + Intronic
909926744 1:81446502-81446524 TCTTCTAAGAAGCATAACCATGG + Intronic
910654036 1:89601812-89601834 CCTTCTCAGCAAATTCTCCATGG - Intergenic
911986497 1:104632166-104632188 CCCTCTAATCAGCACCACCACGG + Intergenic
912650484 1:111434293-111434315 CCATCTAAGCAGCATAACCACGG + Intergenic
918868838 1:189939345-189939367 ACTTCTAAGCACCATCACCTTGG + Intergenic
919868920 1:201805608-201805630 CATTTTAAGGAGCATCTCAATGG - Intronic
920250077 1:204617615-204617637 CATTCTGAGGAACATCTCCAAGG - Exonic
920596206 1:207272923-207272945 CCTTCTACTCACTATCTCCATGG + Intergenic
922146058 1:222945876-222945898 ACTTCCAAGCAACTTCTCCATGG - Intronic
922254077 1:223876401-223876423 GCTTCTTAGCAGCCACTCCATGG - Intergenic
922348128 1:224714164-224714186 TCTTTTAAGCAGCCTCTACAAGG + Intronic
924460015 1:244250605-244250627 CTTACTAAGCAGCATCTTGAGGG + Intergenic
1063511486 10:6648759-6648781 TCTTCTAAGCAGCATTACAATGG - Intergenic
1064227931 10:13503957-13503979 CCTCCTAGGCAGCAGCTGCAGGG - Intronic
1065387120 10:25144587-25144609 CATTCTCAACACCATCTCCAGGG - Intergenic
1067349796 10:45465456-45465478 CTTTCTAAGTACCATCCCCAAGG + Intronic
1068091695 10:52440296-52440318 CTTGCTAAGCAGGGTCTCCAGGG + Intergenic
1068666663 10:59683641-59683663 CCTTCTAGGCAGCTTCTACATGG - Intronic
1071284991 10:84136352-84136374 ACTACTGAGCAGCATCTCGAAGG + Intergenic
1072892601 10:99337686-99337708 CCATATAATGAGCATCTCCAGGG + Intronic
1073068850 10:100780886-100780908 CCTTCTAGGCAGCACCTCCATGG - Intronic
1074418879 10:113291826-113291848 CGTTCTAAAGAGCCTCTCCAGGG + Intergenic
1075186270 10:120261167-120261189 CCTTCTATGCAGCATCACTGGGG + Intergenic
1076409628 10:130236726-130236748 TCTTCTGAGCAGCATATCCAAGG - Intergenic
1077372059 11:2186992-2187014 CCTTTTCAGCAGCCTCTCCAGGG - Intergenic
1078120542 11:8504366-8504388 CACCCTAAGCAGCATTTCCAGGG + Intronic
1081188538 11:40075438-40075460 CCTTCCCAACAGCATCTACAAGG + Intergenic
1081779011 11:45696948-45696970 CCTTCTGAGCAGCATGGGCAGGG - Intergenic
1082246900 11:49934318-49934340 CCTACTAAAGAGCATCTTCATGG - Intergenic
1082895517 11:58185851-58185873 CCTTCTACGAAGTATCACCATGG - Intergenic
1083315453 11:61812245-61812267 CCTTTTTAGCTGCTTCTCCAAGG - Intronic
1083395689 11:62390325-62390347 CCTTCTGAGGAGCCTCCCCAAGG + Intronic
1085635547 11:78156790-78156812 CCCTCTAAGAAGCAGCACCAGGG - Intergenic
1086167651 11:83798065-83798087 CCTTCTAAGCAGCATCTCCAAGG - Intronic
1088751734 11:112847796-112847818 CCTTCAAAGCTCCCTCTCCAGGG - Intergenic
1094828627 12:34289724-34289746 CCTTCAAAGCAGCCCCTGCATGG - Intergenic
1094830974 12:34300127-34300149 CCTTCCCAGCAGCACCTGCATGG + Intergenic
1094831309 12:34301558-34301580 CCTTCCCAGCAGCACCTACAGGG + Intergenic
1094833362 12:34310936-34310958 CCTTCTCAGCAGCTCCTGCACGG + Intergenic
1098932948 12:76441743-76441765 CCTTCTACTCTGTATCTCCATGG - Intronic
1101590030 12:106117222-106117244 CCTTAGAAAGAGCATCTCCAGGG - Intronic
1102866903 12:116381891-116381913 CCCTCTCCCCAGCATCTCCAGGG + Intergenic
1106076499 13:26465447-26465469 CTTTCTAGGCAGCATGCCCAGGG + Intergenic
1107692235 13:42965466-42965488 CCCTCAAAGCAGGATCTGCAAGG + Intronic
1108633747 13:52312248-52312270 CCTACTAAGCAGCTTCTTAAAGG - Intergenic
1108634162 13:52315951-52315973 CCTACTAAGCAGCTTCTTAAAGG - Intergenic
1109648488 13:65292562-65292584 CATTGTAACCATCATCTCCATGG + Intergenic
1109813528 13:67547475-67547497 CCTTCTTAGCAGTTTCTCCTGGG + Intergenic
1109922897 13:69092723-69092745 CCTACTATGCAATATCTCCAAGG - Intergenic
1112652870 13:101417182-101417204 CCTCCTAAGCACCATGCCCAGGG + Intergenic
1114775425 14:25475607-25475629 GGTTCTAAGCTTCATCTCCAGGG + Intergenic
1115552413 14:34516432-34516454 CCTTCTCGGCAGCATCTTCCCGG + Exonic
1119034317 14:71216787-71216809 CCCTCTACAAAGCATCTCCAGGG - Intergenic
1121494558 14:94383135-94383157 TCTTCTGGGCAGCATCTCCCTGG + Exonic
1122146990 14:99697206-99697228 GCTCCTACGCAGCATCTGCATGG - Intronic
1123727674 15:23120812-23120834 CCTTCTAAACAGATTCTGCAAGG - Intergenic
1124632937 15:31347552-31347574 CCTCATGAGCAGCACCTCCAAGG - Intronic
1127569088 15:60223435-60223457 CTTGCCAAGAAGCATCTCCAGGG + Intergenic
1129760235 15:78125004-78125026 CCTTCTAAGCTGCTGCTCCCTGG + Intronic
1130919193 15:88330005-88330027 CCTTCTCTGCATCATCTGCAGGG - Intergenic
1131058031 15:89387697-89387719 CCTTGGAAGAAGCATCTCCTGGG - Intergenic
1131186444 15:90278557-90278579 CTTTCTACACAGCATCTTCAAGG - Intronic
1131279143 15:91006773-91006795 CCTTCTACACAGCATGTCCAAGG + Intronic
1131623411 15:94091661-94091683 CCTCCTATGCAGGGTCTCCATGG - Intergenic
1133201836 16:4208521-4208543 CCTTCTTGGAAGCATCTCCAAGG - Intronic
1134045511 16:11098265-11098287 CCTGCTCAGCCCCATCTCCAAGG + Intronic
1134686967 16:16165778-16165800 CCTGCTAAACCGCTTCTCCAAGG - Exonic
1135734575 16:24920504-24920526 CTTTAAAAGCTGCATCTCCAAGG - Intronic
1136010942 16:27363143-27363165 CCTTGTAACCAGCCTCTCCTGGG - Exonic
1138549459 16:57739677-57739699 CCCTCTAAGCAGCCTGACCAGGG - Intronic
1141144586 16:81520090-81520112 CCTGCTAAGCACACTCTCCAAGG - Intronic
1141255656 16:82400142-82400164 GCTGCTTACCAGCATCTCCAAGG - Intergenic
1141581839 16:85004600-85004622 CCTTCCTAGCAGCCTCTCCCTGG + Intronic
1142205605 16:88781552-88781574 CCTTCTGAGCATCAGCTCCCTGG - Intronic
1143715833 17:8768387-8768409 CCATTTCTGCAGCATCTCCAGGG - Intergenic
1143861752 17:9896552-9896574 CCTTCAAAGCAACAAATCCAGGG + Exonic
1147550034 17:41435022-41435044 CCTAAAAAGTAGCATCTCCAAGG + Intergenic
1148543579 17:48499789-48499811 CATCCTTAGCAGCATCTCCTGGG - Intergenic
1149076531 17:52602066-52602088 CCTGCTATGCAGCCTGTCCATGG + Intergenic
1149284323 17:55145282-55145304 CCTTCAAAGCATCATCTATATGG - Intronic
1150495030 17:65601270-65601292 GCTTCGACACAGCATCTCCAAGG - Intronic
1151240584 17:72754637-72754659 CCTCCTAAGCAGAAACACCAGGG + Intronic
1153568406 18:6444048-6444070 CCTCCTCAGCAACACCTCCAGGG - Intergenic
1154324990 18:13383448-13383470 CCATCAAAGAAGCATCTCCAGGG + Intronic
1156846507 18:41671786-41671808 TCTTCTACACAGCATCTCCAAGG - Intergenic
1157551916 18:48588143-48588165 CCTCCTAAGTGGCAGCTCCATGG + Intronic
1158335757 18:56414021-56414043 CCTTCAAAGCAGCCCCTCCCAGG + Intergenic
1158813021 18:61059256-61059278 CTTTCTTAGCAGTATATCCAGGG - Intergenic
1160470713 18:79130210-79130232 TCTTTTAAGCAACATCCCCATGG - Intronic
1161001256 19:1912361-1912383 CAGGCAAAGCAGCATCTCCAGGG - Exonic
1161352401 19:3801334-3801356 CCTTGCAGGCAGCATCTCCCTGG - Intronic
1161467475 19:4439678-4439700 CCTCCTCAGCAGCGTCTACAGGG + Intronic
1163443863 19:17335090-17335112 CATTCCAAACAGCGTCTCCAGGG - Intronic
1163561814 19:18023689-18023711 CCTCCTAAGCACCATGGCCAGGG - Intergenic
1166371381 19:42302981-42303003 CCTTCTAAGGAGCCACTCTAAGG + Intronic
1168115196 19:54218399-54218421 CCTTCACAGCAGCATCTGCTGGG + Exonic
926001067 2:9333025-9333047 CCTTTAATGCAGCAACTCCAAGG - Intronic
926550244 2:14292900-14292922 CCTTGTAAGCAGCATTTTTAAGG - Intergenic
928717886 2:34083807-34083829 CTTTCTAAGCAGAATATCCTTGG + Intergenic
928846801 2:35684040-35684062 CCTTCTCCTCAGCTTCTCCAAGG - Intergenic
930439798 2:51391271-51391293 CCTTCCCAGCAGCAGCTACATGG - Intergenic
932083007 2:68732417-68732439 CCGGCCCAGCAGCATCTCCACGG - Intronic
934847687 2:97672707-97672729 CCCTCTGGGCAGCATTTCCAGGG + Intergenic
934849451 2:97688123-97688145 CCCTCTGGGCAGCATTTCCAGGG + Intergenic
937313393 2:120915851-120915873 GCTTCTGAGCAGCAGCTGCAAGG - Intronic
942344399 2:174987249-174987271 CCTCCTAAGCATCATGTTCAAGG + Intronic
945325450 2:208476910-208476932 CTTTCTCTGCAGCGTCTCCAGGG - Intronic
946602688 2:221369532-221369554 CCCTCTAAGCCACATCTTCAAGG - Intergenic
946765784 2:223038932-223038954 CCTTGTAAGCAGCATCCTCCAGG - Intergenic
948145211 2:235703485-235703507 CCTCCTTGGCAGCATCTCCTTGG + Intronic
948949919 2:241242787-241242809 GCTTGTAAGTGGCATCTCCAGGG - Intronic
949037947 2:241826979-241827001 ACTTCCAAGCAGCATTACCATGG + Intergenic
1168937395 20:1677525-1677547 CTTTTTAAGCTGCATCTTCATGG - Intergenic
1170194407 20:13675509-13675531 CCTTCTACACAGCTCCTCCATGG + Intergenic
1170391975 20:15885014-15885036 CCTTCTAATCACCATCACCTTGG + Intronic
1170576364 20:17664750-17664772 ATTACTAAGCAGCAGCTCCACGG + Intronic
1170600576 20:17838510-17838532 GCTTATAAGCAGCATTTCCTGGG + Intergenic
1170703406 20:18724415-18724437 CCTTCTGAGCAGAATGGCCATGG + Intronic
1170826809 20:19803206-19803228 GCTTCTAAGCTGCATCTGCTAGG - Intergenic
1173575272 20:44109272-44109294 CATTCTTCGCAGTATCTCCATGG - Intergenic
1174080876 20:47969880-47969902 TCTCCTGAGTAGCATCTCCAGGG - Intergenic
1175668758 20:60882904-60882926 CCTACTAATCTGAATCTCCAGGG + Intergenic
1176943368 21:14950764-14950786 CCTTTTCAGAAGCTTCTCCAAGG - Intergenic
1178177626 21:30121995-30122017 CCATCAAAGCAGAATGTCCATGG - Intergenic
1178240420 21:30893530-30893552 CCTTATAGGCAGCATGCCCAGGG - Intergenic
1179182372 21:39056753-39056775 TGTTCCAAGCAGCATCTCAAAGG - Intergenic
1182594618 22:31409468-31409490 CCTTCAAATCAGAATCTGCAGGG + Intronic
949947534 3:9202425-9202447 CCCTCTAAGCCCCAACTCCAGGG + Intronic
950179989 3:10904630-10904652 CCTACTGACCAGCATCTCCCAGG - Intronic
950605738 3:14078426-14078448 CCTTGTAAGCCTCTTCTCCATGG - Intronic
952862823 3:37829004-37829026 CCCATAAAGCAGCATCTCCAAGG - Intergenic
953460686 3:43079450-43079472 CCTGCTAAGGAACTTCTCCAGGG + Exonic
955352329 3:58203068-58203090 CCTTCTGAGCAGCTCCTCCTGGG + Intronic
955589695 3:60521911-60521933 CCTTGTAACCATCATTTCCATGG + Intronic
956110028 3:65861028-65861050 TATTTTCAGCAGCATCTCCATGG + Intronic
957938509 3:86974789-86974811 CTTTCTAAGCATCATTGCCATGG + Intronic
961339315 3:126206800-126206822 CCTTCTAAGCAGAAGCTCTCTGG + Intergenic
961920594 3:130421339-130421361 CCTTCTGCCCCGCATCTCCAGGG - Exonic
962389671 3:134960692-134960714 CCTTCTCACCAGCCTCTCCAGGG - Intronic
968757756 4:2425778-2425800 CCCCCTAGGCAGCTTCTCCAAGG + Intronic
969309915 4:6347166-6347188 TCTTCTGAACAGCATCTCCTGGG + Intronic
972067492 4:34968154-34968176 CCTTCAAAGCAGCCTTTCCCCGG + Intergenic
975161942 4:71134397-71134419 CCTTATAAGCACTATCACCAAGG - Intergenic
979800795 4:124906290-124906312 CCTGCTAACAAGCATCTCTAGGG - Intergenic
980399678 4:132265385-132265407 GCTGCTGAGTAGCATCTCCAGGG + Intergenic
980980411 4:139650003-139650025 CCTTCTCAGCACCATCTTCCAGG + Intergenic
982068037 4:151671899-151671921 CCTGCTCTGCAGCGTCTCCAAGG + Intronic
982678130 4:158399582-158399604 ATTTCTAGGCAGGATCTCCAAGG + Intronic
985327753 4:188791519-188791541 TCTTTTAAGCACCATTTCCAGGG + Intergenic
986313840 5:6573107-6573129 CCATCCAAGCTGCTTCTCCAAGG - Intergenic
986702829 5:10428203-10428225 CCTTCTAAGTAGAAACTTCAAGG + Intronic
987046061 5:14109728-14109750 CCTTGTAAGAAGAATCTTCAAGG + Intergenic
993503724 5:88688739-88688761 CCTTCTAAGCTGCAAGACCACGG - Intergenic
995114807 5:108467742-108467764 CCGTTTATACAGCATCTCCAAGG - Intergenic
995324181 5:110872648-110872670 CCTGCTTTGCTGCATCTCCAAGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995843218 5:116465122-116465144 CCGTGTATGCAGCATCTCCCGGG - Intronic
998994172 5:147852284-147852306 CCTTCTGACCCTCATCTCCATGG - Intergenic
999237229 5:150106177-150106199 CCTTCCCGGCAGCATCACCAAGG - Intronic
999528809 5:152438697-152438719 ACTTCTATGGAGCATCTCCTGGG + Intergenic
1000359989 5:160438202-160438224 CCTTCAAAGCAGCAACCACAGGG - Intergenic
1001589164 5:172853653-172853675 TGTTCTAAGCAGCCTCTCCAAGG + Intronic
1002188337 5:177466347-177466369 CCTTGGGAGCAGCATCTCCCTGG - Intronic
1002693275 5:181065790-181065812 CCTTCTGGGCAGCCTCTCCCGGG - Intergenic
1003395121 6:5746530-5746552 CTTTGCAAGCAGCATCTCCTTGG + Intronic
1004004397 6:11625961-11625983 CCATCTCAGCATCTTCTCCAGGG - Intergenic
1004594619 6:17087218-17087240 CCTGATAGGCAGCATTTCCATGG + Intergenic
1007835525 6:44671184-44671206 CCTTCTCTGCAGCCTCACCAAGG + Intergenic
1008306955 6:49914924-49914946 CCATCTAGGCAGCATTTCTAGGG + Intergenic
1009851141 6:69200669-69200691 CCTTCTCAGCTGCATCTCCCTGG + Intronic
1011945942 6:92903520-92903542 CCTTCCCCACAGCATCTCCAGGG + Intergenic
1013540002 6:111098719-111098741 ACTTCAAAGCAGCATCTCAAAGG + Intronic
1017304523 6:152900840-152900862 ACTTCTAAGAAGCTTCTCAATGG - Intergenic
1026159132 7:67853254-67853276 CCATCTAAGCAGCATGTGCTGGG - Intergenic
1032489570 7:132314121-132314143 CCTTCTCTGCACCATCACCAGGG + Intronic
1033582294 7:142749154-142749176 CCTTCTAACCCTCATCTCCAGGG + Intergenic
1033583859 7:142760084-142760106 CCTTCTAACCCTCATCTCCTCGG + Intronic
1033585333 7:142770658-142770680 CCTTCTAACCCTCATCTCCTCGG + Intergenic
1035531618 8:356695-356717 CATTGTAATCAGCATCTCCCCGG - Intergenic
1035540840 8:436494-436516 GCTTCTGAGCAGAATTTCCAGGG + Intronic
1036403636 8:8433217-8433239 CCTTCTAATCAGATTCTCCAGGG + Intergenic
1037784743 8:21895952-21895974 CCTTCTGAGCCTCATCTCCTGGG + Intergenic
1046110974 8:109724163-109724185 CCTTCTAAGCAGCATATGATTGG - Intergenic
1046132303 8:109981135-109981157 CCTTTTAAATAGCATCTCCATGG + Intergenic
1046556511 8:115779711-115779733 GCTTCTGAGCAGCATCTCGGCGG - Intronic
1046961214 8:120115226-120115248 CCAGCTAAGAAGCATCTCTAGGG - Intronic
1048377514 8:133835498-133835520 CCTCACAGGCAGCATCTCCAGGG - Intergenic
1048558155 8:135502703-135502725 AATTCTAAGCAGCAGCTCGACGG - Intronic
1048932681 8:139327379-139327401 CCTTCTGAGGCCCATCTCCATGG - Intergenic
1051540692 9:18213478-18213500 CCTTTTCAGCATCATCTCAAAGG - Intergenic
1052901032 9:33795242-33795264 CCTTCTAACCCTCATCTCCTCGG + Intronic
1055427971 9:76215513-76215535 CCTCTTTAGCAGCATCTCTAGGG - Intronic
1055464363 9:76549705-76549727 GCTTTTAAGCAGAATCTCCTTGG - Intergenic
1057822316 9:98342191-98342213 GCTTCTAAGCTGCCTCTCAAAGG + Intronic
1058750786 9:108036616-108036638 CCTACTAAGCAGCATTTACTGGG - Intergenic
1059473631 9:114526247-114526269 CCATCTAACAAGCATCTCCTTGG - Intergenic
1061485250 9:130917345-130917367 CCCTCTAAGCGGCACTTCCAAGG - Intronic
1061666292 9:132162457-132162479 CGTTCTTAGCAGCATCTTAAAGG + Intronic
1062065088 9:134522376-134522398 CCTCCTAAGCAGCCTCTGCCAGG - Intergenic
1186694298 X:12013392-12013414 CATGGTAAGCATCATCTCCAGGG + Intergenic
1186852855 X:13597435-13597457 AATTCTAAGAAACATCTCCAGGG - Intronic
1187276789 X:17823410-17823432 TCTTCTCAGCAGCTTTTCCATGG + Intronic
1189289997 X:39878184-39878206 CCTGCTAAGCAGCCTATCCAGGG + Intergenic
1194143826 X:90239566-90239588 CCTTCTGAGCACAATCTCAATGG + Intergenic
1195412932 X:104588309-104588331 CTTTCTGAGCAGCATGTACAAGG + Intronic
1196986616 X:121280848-121280870 CCTTCTACGCTCTATCTCCATGG - Intergenic
1197706022 X:129635022-129635044 CCTGACAAGCAGCATTTCCATGG - Intergenic
1199925300 X:152456633-152456655 CCTTCTACACTGTATCTCCATGG - Intergenic
1200489588 Y:3808867-3808889 CCTTCTGAGCACAATCTCAATGG + Intergenic