ID: 1086167976

View in Genome Browser
Species Human (GRCh38)
Location 11:83801531-83801553
Sequence CTGTAAGACTGGAGGAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086167976_1086167980 5 Left 1086167976 11:83801531-83801553 CCAAGTTTCCTCCAGTCTTACAG 0: 1
1: 0
2: 1
3: 15
4: 179
Right 1086167980 11:83801559-83801581 ATGCCAGTGGTCCCTTTGACTGG 0: 1
1: 0
2: 0
3: 9
4: 123
1086167976_1086167979 -8 Left 1086167976 11:83801531-83801553 CCAAGTTTCCTCCAGTCTTACAG 0: 1
1: 0
2: 1
3: 15
4: 179
Right 1086167979 11:83801546-83801568 TCTTACAGCATTTATGCCAGTGG 0: 1
1: 0
2: 1
3: 16
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086167976 Original CRISPR CTGTAAGACTGGAGGAAACT TGG (reversed) Intronic
903696705 1:25212781-25212803 CTGTAAGAAGGGAGGAAATGAGG - Intergenic
904823666 1:33260848-33260870 CTCTGAGACTGGAAGAGACTGGG - Intronic
904860370 1:33533249-33533271 CTGTTGGACTGGAGGAGATTAGG + Intronic
904963858 1:34356402-34356424 CTTTAAGAATGGAGCAAAATGGG - Intergenic
907848011 1:58227353-58227375 ATTGAAGACTGGAGGAAATTTGG + Intronic
908152883 1:61322433-61322455 CAGTAAGACAGAAGGAACCTGGG - Intronic
908311021 1:62883875-62883897 CTGTAAGAGTTGATGAAACAGGG + Intergenic
908327547 1:63038204-63038226 TGTTAAAACTGGAGGAAACTGGG + Intergenic
914254960 1:145954409-145954431 CTGTAAGACTGGAGTTAAATGGG - Intronic
915007578 1:152654316-152654338 CTGGAAGTGTGGAGAAAACTGGG - Intergenic
915027463 1:152844125-152844147 CTGTGAGGCTGCTGGAAACTGGG - Intergenic
915273878 1:154774883-154774905 CTGCAAGGCCGGAAGAAACTAGG + Intronic
915956734 1:160226527-160226549 CTCTGAGATTGGAGGAGACTGGG - Intronic
916071921 1:161175453-161175475 CTGTAAGACAGGAGAAAGTTAGG - Intronic
918015321 1:180628038-180628060 ATTTAAGAGAGGAGGAAACTGGG + Intergenic
918134816 1:181662283-181662305 TTGTTACAGTGGAGGAAACTCGG + Intronic
921553500 1:216568504-216568526 CTGGCAGACTGGAGGGAAGTTGG - Intronic
921993702 1:221394965-221394987 GTGGAAGACTGGATGCAACTTGG + Intergenic
923554557 1:234990545-234990567 CAATATGACTGGAGGAAATTTGG - Intergenic
1064087893 10:12359185-12359207 CTGTAAAACAGGATGACACTTGG + Intronic
1064352891 10:14592919-14592941 CTGGAAGCCTGGGGGAAAGTAGG - Intronic
1065127316 10:22586099-22586121 CTGTTAGGCTGTAAGAAACTCGG - Intronic
1066596260 10:37053315-37053337 CCAGAAGACTGGAGGAAGCTAGG - Intergenic
1067956970 10:50802361-50802383 TTGGAAGACAGGAAGAAACTAGG - Exonic
1071746391 10:88424316-88424338 CTGGAAGACTGGATGAAGCAAGG + Intronic
1072495580 10:95954862-95954884 CAATAGAACTGGAGGAAACTAGG - Intronic
1074279464 10:112037280-112037302 TGGTAAGAGTGGAGGAAACAAGG - Intergenic
1076370282 10:129948603-129948625 CGTTAACACTGGGGGAAACTGGG + Intronic
1076535182 10:131172491-131172513 CCCTGAGGCTGGAGGAAACTGGG + Intronic
1079910366 11:26302059-26302081 CTGGAAGACTGGCTGAATCTTGG - Intergenic
1080779999 11:35420379-35420401 CTGGAATACTGCAGGAACCTAGG + Intergenic
1080880312 11:36313582-36313604 CTCTAAGAATGGAGGGACCTGGG + Intronic
1081056120 11:38412861-38412883 CTCTGAGACTGGGGGAATCTTGG - Intergenic
1085009637 11:73129371-73129393 CTGTAAGTATGGACGAAGCTTGG - Intronic
1086167976 11:83801531-83801553 CTGTAAGACTGGAGGAAACTTGG - Intronic
1089072514 11:115711351-115711373 CTGTATGACTGGAGGAGAGCAGG - Intergenic
1092811220 12:12272969-12272991 ATGTGAGGCTGGAGGAATCTGGG + Intergenic
1095634015 12:44409996-44410018 TAGAAAGGCTGGAGGAAACTGGG - Intergenic
1096093512 12:48919039-48919061 ATGTAAGAGGGGAGGAAACATGG - Intronic
1096933310 12:55240874-55240896 CAGTAAGCATGGAGGAAAATTGG - Intergenic
1098142030 12:67459590-67459612 CTGCATGACTTGAAGAAACTGGG - Intergenic
1099018628 12:77375784-77375806 ATGAAAGTCTGGAGGAAAATGGG - Intergenic
1099020605 12:77399463-77399485 AGGTAAGAATGGAGGAAACAGGG - Intergenic
1099108797 12:78530374-78530396 ATGCAAGACTGGCGGAAAATTGG + Intergenic
1100747145 12:97658866-97658888 CTCTAAGACTTGAGGAAAAGGGG - Intergenic
1100858704 12:98781638-98781660 CTGGAAGAATGAAGGTAACTAGG - Intronic
1101084984 12:101226628-101226650 CTGTAAGGCTGGAGGAAACCAGG - Intergenic
1101337816 12:103811764-103811786 TGTTAACACTGGAGGAAACTGGG + Intronic
1102132551 12:110543458-110543480 CTGTAAAACTGGGGGAAATCAGG + Intronic
1102391766 12:112554823-112554845 CTGTAAAAATGAAGAAAACTGGG - Intergenic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1103125869 12:118421784-118421806 CTGTCAGACTGGGGCAAGCTGGG + Intergenic
1106303004 13:28486459-28486481 CAGTCATACTGGAGGAAACCAGG + Intronic
1111075815 13:83233053-83233075 CTGTTACACTGTTGGAAACTGGG + Intergenic
1115501084 14:34050473-34050495 CGGTGAGACTAAAGGAAACTAGG - Intronic
1115554854 14:34536945-34536967 TGTTAACACTGGAGGAAACTGGG + Intronic
1115829170 14:37315815-37315837 CTGTGGGACTAGATGAAACTGGG + Intronic
1117724787 14:58662085-58662107 CAATAAGACAGGAGGAAACTGGG - Intergenic
1125404971 15:39342487-39342509 CTGGAAGAGTGGAGGAAAAGGGG - Intergenic
1128614089 15:69095856-69095878 CTGTAAGACAGGATCACACTAGG + Intergenic
1129932133 15:79420469-79420491 CTGTAGGCTTGGGGGAAACTTGG + Intronic
1130010198 15:80146439-80146461 CTGTAAAACTAGAAGAAAATGGG + Intergenic
1132090544 15:98944999-98945021 CTGGAAGACAGCAGGAAACTTGG - Intronic
1134594589 16:15485658-15485680 CTGTGTTACTGGAGGAAACTGGG + Intronic
1139667965 16:68471556-68471578 CTGAGAGACTGAAGGGAACTAGG - Intergenic
1141400285 16:83741348-83741370 CTGTAAAACTGTAGGAAAGAAGG - Intronic
1148766799 17:50044296-50044318 CTGGAAGAGTGGGGGAAATTGGG - Intergenic
1148942135 17:51223932-51223954 CAGTAAGACTGGTTTAAACTGGG + Intronic
1149568644 17:57656750-57656772 CTGGGGAACTGGAGGAAACTAGG - Intronic
1150529616 17:65963252-65963274 CTGTAACACTGAAGGATGCTGGG + Intronic
1152124509 17:78438248-78438270 CTGTAAGACCCGTGGAAGCTGGG + Intronic
1152288573 17:79425980-79426002 GTGTAACACTGGAGGAATCACGG + Intronic
1153596899 18:6735423-6735445 CTGTCAGATTGCAGGAGACTCGG - Intronic
1156225595 18:35103720-35103742 CAGAAAGAATGAAGGAAACTAGG + Intronic
1156622021 18:38864204-38864226 ATGCAAGAGTGAAGGAAACTTGG + Intergenic
1156627528 18:38927029-38927051 GTGTAATAGAGGAGGAAACTGGG + Intergenic
1156813595 18:41281698-41281720 CTGTGAGACTGGAGCAAATTTGG - Intergenic
1156896774 18:42255719-42255741 CTCTAAGACTGAAGGAACATAGG - Intergenic
1158864678 18:61626875-61626897 CTGTTACAGTGGAGGAAAGTGGG + Intergenic
1158866401 18:61641740-61641762 ATGTAACACTGGAGGAAACCAGG - Intergenic
1159872135 18:73770244-73770266 CTGGAAGACAGGAGGAAGATGGG + Intergenic
1166582109 19:43910169-43910191 TGTGAAGACTGGAGGAAACTTGG + Intergenic
926408388 2:12576870-12576892 CTCTAAGACTGTAAGTAACTTGG + Intergenic
928885505 2:36143707-36143729 CTGTGAGACTGGGGGCAACAGGG - Intergenic
930516380 2:52412530-52412552 CTGTAAGATTGGAGGCAATGAGG - Intergenic
931164135 2:59727650-59727672 CTGGAAGAGCTGAGGAAACTTGG - Intergenic
931766912 2:65465017-65465039 TTGAAAGACTGGAGGCAAGTAGG - Intergenic
932090343 2:68800354-68800376 CTGGAAAACTCCAGGAAACTGGG - Intronic
940169198 2:150808441-150808463 TTCTAAGAATGGAGGAAAGTGGG + Intergenic
940750723 2:157624597-157624619 ATGTAGGATTGGAGAAAACTAGG + Intronic
941765331 2:169290515-169290537 CAATAAGACTTGAGCAAACTTGG + Intronic
941825612 2:169892246-169892268 CTGTATGTCTGAAGGAAATTAGG + Intronic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
945305213 2:208253913-208253935 CTGCAAGACTGGGAGGAACTGGG - Exonic
945314114 2:208352130-208352152 CATTAAGACTGGATGAAATTAGG + Intronic
1170019576 20:11821364-11821386 CTATAAGAATGAAGGAACCTGGG + Intergenic
1170225751 20:13990559-13990581 CTGTAACACAGGCAGAAACTAGG + Exonic
1172970654 20:38870941-38870963 CTGCAGGACTGCAGTAAACTGGG - Intronic
1172982288 20:38952539-38952561 CTGTAAGCCTGGAAGAAACCAGG - Exonic
1173089471 20:39956312-39956334 CCGTAAGACTGGAGAGTACTGGG + Intergenic
1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG + Intronic
1176206896 20:63894179-63894201 CTGTGAGACTGGAACAAGCTTGG + Intergenic
1179242317 21:39603182-39603204 CTGTAAAAGAGGAGGAAATTTGG + Intronic
1179402528 21:41097154-41097176 CTGCAAGCCAGGAGGAAACAAGG + Intergenic
1179495285 21:41767359-41767381 TGGTAACACTGGGGGAAACTAGG - Intergenic
1181266413 22:21633440-21633462 CTGGAAGTCAGGAGGAAACAAGG - Intronic
1183764374 22:39857588-39857610 CTCTGAAACTGGAGCAAACTTGG - Intronic
1185140863 22:49100563-49100585 CTGTAACACGGGAGGGCACTGGG + Intergenic
954160514 3:48718200-48718222 TGGTGAGACTGGAGGAAACCAGG - Intronic
954352546 3:50056968-50056990 CTGTAACACTGGAAGAAGCAAGG + Intronic
956066912 3:65406343-65406365 CTTTAAACCTGGAGGAAATTAGG - Intronic
958800610 3:98750981-98751003 CTGTCATACTGGGGGAAACAGGG - Intronic
960080548 3:113535729-113535751 CTGTAAGATTTGAGGACATTTGG - Intronic
961129601 3:124453632-124453654 CTTTTGGACTGGAGGAAAGTGGG - Intronic
964231137 3:154469473-154469495 CTTTAAGACAGGAGGAGGCTAGG - Intergenic
965067261 3:163865927-163865949 ATGTAAGACTAGAGGACTCTTGG - Intergenic
971154660 4:24068504-24068526 CTGTATGACTGGAGCATAGTAGG + Intergenic
974786667 4:66626475-66626497 ATGAAAGACTGGAGAAAACAAGG - Intergenic
978413378 4:108449518-108449540 CTGTAATACTGGAGAGAGCTTGG + Intergenic
979389750 4:120114603-120114625 CTGTAAGACTAGACCAAACTAGG + Intergenic
980615473 4:135217096-135217118 CTGTAAGAGCTGAGCAAACTAGG - Intergenic
981104448 4:140864622-140864644 CTGTGGGACTGGGGGACACTGGG + Exonic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986185627 5:5433840-5433862 CTGTAAGGAGGGAGTAAACTAGG - Intronic
986848051 5:11778836-11778858 CTTTAATAATGGAGGAAAGTGGG + Intronic
987562917 5:19547485-19547507 CTGTCAGTCTGGAAGAAAATAGG + Intronic
989513689 5:42317698-42317720 CTGGAAGCCTGAGGGAAACTAGG - Intergenic
990316721 5:54589760-54589782 CTGCAAAACTAGAGGAAACCAGG + Intergenic
990683063 5:58267924-58267946 CTTTGGGACTGGAAGAAACTAGG - Intergenic
992979028 5:82147783-82147805 CTTTCTGACTGGAGGAAACTGGG - Intronic
993054206 5:82962849-82962871 CTTTAAGACTGGAGGAAAACGGG - Intergenic
994177325 5:96725090-96725112 CTGTGAAACTGGAGGAAAGTAGG + Intronic
996208672 5:120777003-120777025 CTAGAAGGCTGGAGGAAATTTGG + Intergenic
996267601 5:121561320-121561342 GTGTAAGACTGGATTTAACTGGG - Intergenic
996865162 5:128112428-128112450 ATGTAGGACTGGTGGCAACTAGG + Intronic
997246591 5:132355269-132355291 CTGTAAGAGTGAAGGAGGCTTGG + Intergenic
997432657 5:133851464-133851486 CTGTCTGACTCTAGGAAACTTGG - Intergenic
1000184446 5:158845425-158845447 CTGTAAGATGGGAGGAACATCGG + Intronic
1000359539 5:160434287-160434309 CTGCAAGACTGCAGGAAGCCAGG - Intergenic
1001960563 5:175878247-175878269 CTCTTAGAGAGGAGGAAACTGGG + Intronic
1002408499 5:179054808-179054830 CTGCTAGACTGAAGGAGACTGGG - Intergenic
1002948141 6:1782129-1782151 CTGTGAGTCTGGACTAAACTGGG - Intronic
1003601102 6:7518195-7518217 CTGAAAGACTGGAAGGAATTGGG - Intergenic
1004221799 6:13753704-13753726 CTGTAGGCCTGGAGGTACCTGGG + Intergenic
1007772196 6:44201031-44201053 CTGTAAGACATGAGCAAAATGGG - Intergenic
1008903423 6:56649212-56649234 CTTTAAAAATGGAGGAAACTTGG + Intronic
1009038042 6:58141810-58141832 CTGTATGACTTTATGAAACTTGG + Intergenic
1013206227 6:107948335-107948357 CTGTATGACTTTAGGAAAGTTGG + Intronic
1013892557 6:115042960-115042982 CAGGAAGACAGGAGGAAACTAGG + Intergenic
1014540143 6:122666053-122666075 CTATATGACTTGGGGAAACTCGG - Intronic
1015911308 6:138169981-138170003 CTGCAAGACTGGAGACAAGTTGG + Intronic
1018565659 6:165148987-165149009 CTGGAAGGCTGGAGGTAAGTTGG - Intergenic
1018999567 6:168737525-168737547 CTGTGAGCTTGGAGGAATCTCGG + Intergenic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1021164120 7:17313147-17313169 CTGGTAGTCTGGAGGAAATTTGG - Intronic
1021249254 7:18304107-18304129 ATGTAACACAGGAGGAACCTGGG - Intronic
1022164743 7:27747119-27747141 CTGTAATAATGGGGAAAACTGGG - Intronic
1022334448 7:29409057-29409079 CTATAAAACTTGAGGAAAGTGGG - Intronic
1022477013 7:30717618-30717640 CTCTAACACTGAAGGAAATTGGG + Intronic
1022702606 7:32775827-32775849 CTGTAAGGCAGGAGGACTCTGGG - Intergenic
1022811614 7:33874116-33874138 CTTTCAGACTGGAGGAAATAAGG - Intergenic
1022945156 7:35276141-35276163 ATGTAATAATAGAGGAAACTGGG - Intergenic
1023346198 7:39273655-39273677 CTGTAAGACTAGAGGTTTCTTGG + Intronic
1024861406 7:53846763-53846785 CAGAAAGACTGGAGGAGTCTGGG + Intergenic
1027870649 7:83702583-83702605 CTGGTAGACTGGAGGGAAATGGG - Intergenic
1028229760 7:88292535-88292557 GCATAAAACTGGAGGAAACTGGG - Intronic
1028285235 7:88988784-88988806 GAGTAAGACTAAAGGAAACTTGG + Intronic
1029518970 7:101048018-101048040 CTGCAAGAATGGAGGCACCTGGG + Exonic
1029856068 7:103518073-103518095 CAATAAGACAGGAGGAACCTGGG + Intronic
1032881088 7:136091244-136091266 CGGTAGGATTGGAGGAAACCAGG + Intergenic
1034660954 7:152768876-152768898 CTGTACGACAGAAGGAGACTCGG - Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037683188 8:21115830-21115852 CCCTAAGACTGGAGGAGACAAGG - Intergenic
1038447963 8:27616987-27617009 CTGCAAGCCTGGAGGTCACTGGG - Intergenic
1038923629 8:32113473-32113495 CTGTCAGGCTGGAGGAACCAAGG - Intronic
1041234792 8:55789230-55789252 TTGTCAGACTGGAAGAAAGTGGG - Intronic
1041629143 8:60065064-60065086 CCACAAGACTGGAGGAAACCAGG + Intergenic
1041815860 8:61970136-61970158 CTGTAAAACTGGCAGAAACAAGG - Intergenic
1041924756 8:63224954-63224976 CTTTAAGAATGGAGTAAACAAGG - Intergenic
1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG + Exonic
1042561512 8:70075266-70075288 CCTTAAGCCTGGAGGAAGCTTGG + Intergenic
1042978103 8:74493355-74493377 CAGTAACACTGGTGAAAACTTGG - Intergenic
1045243405 8:100422223-100422245 CTGTGTGACTGCAGGATACTAGG + Intergenic
1048704156 8:137131661-137131683 CTGTAACACTAGAGGAAGGTAGG - Intergenic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1055633627 9:78251308-78251330 TTGTAAGACTGAAGGTAGCTGGG - Intronic
1056531404 9:87491521-87491543 CTGAGAGACTGGAGAAATCTTGG + Intergenic
1056590615 9:87963546-87963568 TGGTAGGACTGGAGGAAACTGGG - Intergenic
1060346552 9:122821983-122822005 CTGCAAGATGGGAGGAAAATTGG - Intronic
1061128553 9:128692041-128692063 TTGTTAGAATGGAGGAAGCTTGG + Intronic
1061373107 9:130208982-130209004 CTGTAAAACCGGAGGCTACTGGG + Intronic
1188321617 X:28745286-28745308 ATGGAAGACTGAAGGAAACAGGG - Intronic
1197496244 X:127185224-127185246 CTGTAACACTGAAGGAAAAAAGG - Intergenic
1198655948 X:138913502-138913524 CTGTTAGACTTGTGAAAACTTGG + Intronic
1200314985 X:155123125-155123147 CCGTACCACTGGAGGAAACTGGG + Intronic
1201554815 Y:15256875-15256897 CTATTAGACTGAAGGAGACTGGG + Intergenic