ID: 1086170003

View in Genome Browser
Species Human (GRCh38)
Location 11:83825645-83825667
Sequence GTGAACAAGATGGAGGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 1, 2: 4, 3: 19, 4: 321}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086169998_1086170003 2 Left 1086169998 11:83825620-83825642 CCAAGTTCCTTTTCGAGGAAATT 0: 1
1: 0
2: 0
3: 17
4: 211
Right 1086170003 11:83825645-83825667 GTGAACAAGATGGAGGTAGGAGG 0: 1
1: 1
2: 4
3: 19
4: 321
1086169996_1086170003 13 Left 1086169996 11:83825609-83825631 CCTTGTCTACTCCAAGTTCCTTT 0: 1
1: 0
2: 4
3: 22
4: 249
Right 1086170003 11:83825645-83825667 GTGAACAAGATGGAGGTAGGAGG 0: 1
1: 1
2: 4
3: 19
4: 321
1086169999_1086170003 -5 Left 1086169999 11:83825627-83825649 CCTTTTCGAGGAAATTCAGTGAA 0: 1
1: 0
2: 1
3: 11
4: 188
Right 1086170003 11:83825645-83825667 GTGAACAAGATGGAGGTAGGAGG 0: 1
1: 1
2: 4
3: 19
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086170003 Original CRISPR GTGAACAAGATGGAGGTAGG AGG Intronic
900002111 1:20272-20294 GTAGACAAGATGGAGCTATGGGG + Intergenic
900021832 1:190795-190817 GTAGACAAGATGGAGCTATGGGG + Intergenic
901712945 1:11130058-11130080 CTGAACAGGATGGAGGGAGGAGG + Intronic
901723572 1:11220609-11220631 TTTAATAAGATGGAGGAAGGGGG + Intronic
903247870 1:22029467-22029489 ATGAAAGAGATGGAGGGAGGTGG + Intergenic
904349914 1:29898509-29898531 GTGAAGAAGATGGAGGGTGAGGG + Intergenic
904995719 1:34629830-34629852 GTTCACAATAAGGAGGTAGGAGG - Intergenic
905050999 1:35051057-35051079 GAGAACAACATGGAGGAAGAGGG + Intergenic
905091102 1:35432191-35432213 GTAAACAAGATGGAGAAAAGAGG + Intergenic
905257142 1:36692155-36692177 GAGAACAATATGGAGGTGAGGGG - Intergenic
908728076 1:67198047-67198069 GTGAACAAGATAGAGGGAGGGGG + Intronic
909004566 1:70259870-70259892 TTGAACAACATGGAGGTTAGGGG - Intergenic
909883856 1:80915269-80915291 GTGAGCAAAATGGAGGAAGAAGG - Intergenic
910077198 1:83295604-83295626 GTGAACAAGACAGAGGGAGAGGG - Intergenic
911824172 1:102460722-102460744 GTGAACAAGAAGAAGGGAGTAGG - Intergenic
913246003 1:116870604-116870626 ATGAACAAGGGGGAGGTAGTTGG - Intergenic
914901779 1:151715022-151715044 GTGATCAAGATGGAGGGAGGTGG - Intronic
915875918 1:159612158-159612180 ATGAAAAAGATGGAGGAAGAGGG - Intergenic
916749545 1:167712165-167712187 GTGAACTAGCTGGGTGTAGGTGG + Intergenic
917273237 1:173301749-173301771 ATGAACAAGATAGTTGTAGGTGG - Intergenic
917442722 1:175081170-175081192 CAGAACAAGATGGAGGATGGTGG + Intronic
917670647 1:177270480-177270502 ATGAACAAGATGATGGTGGGGGG + Intronic
917743356 1:177983367-177983389 GTGAACAAGATGGAAGAGGTGGG - Intronic
918009424 1:180572679-180572701 GGGGACAACTTGGAGGTAGGAGG - Intergenic
918096686 1:181341902-181341924 GTGAACAAGATAAAGGTGGGAGG + Intergenic
920310427 1:205044999-205045021 GCGAATAAGAGGGAGGCAGGAGG + Intronic
921798934 1:219379934-219379956 GTGAAGAAGAGGCAGGAAGGAGG + Intergenic
922174506 1:223186620-223186642 GTAAGAAAGATGGAGGAAGGGGG + Intergenic
923267371 1:232327765-232327787 GGGAACAATAAGGAGGGAGGAGG - Intergenic
923270691 1:232352646-232352668 GTGAATAAGATTGAGGTCAGAGG + Intergenic
924385674 1:243496408-243496430 ATGCCCCAGATGGAGGTAGGGGG + Intronic
1063595976 10:7435974-7435996 GTGGACCAGATGGAGGGGGGTGG + Intergenic
1064454324 10:15472789-15472811 GTGACTAAGAGGGAGGAAGGGGG + Intergenic
1065314699 10:24451847-24451869 GTGAACAACATGCAGGTACAAGG - Intronic
1066229027 10:33413868-33413890 CTGACTAAAATGGAGGTAGGAGG + Intergenic
1068502658 10:57859739-57859761 GTGGTGAAGATGGAGGTAAGGGG + Intergenic
1071334323 10:84588982-84589004 GGGAACAAGATGTAGGGAGATGG + Intergenic
1071711234 10:88051738-88051760 GTGAACAGCATGGGGGTGGGTGG + Intergenic
1072250550 10:93578992-93579014 GAGAAAAAGATGGGGGTGGGTGG - Intronic
1072338366 10:94421159-94421181 GGGAACCAGGTGGAGGTGGGTGG - Intronic
1072478798 10:95790440-95790462 TTGAACAACATGGAAGTTGGGGG - Intronic
1073943942 10:108729852-108729874 GAGAGGAAGATGGAGGGAGGGGG + Intergenic
1074601583 10:114919162-114919184 ATGAACAATATGGAGGTATAGGG + Intergenic
1079994730 11:27283745-27283767 GTGGAAAGGATGGAGGTAGTGGG - Intergenic
1080569361 11:33542292-33542314 ATGAAGAGGATGGAGGTAGAGGG - Exonic
1080824597 11:35837333-35837355 GTGAAGAGGGTGGAAGTAGGAGG - Intergenic
1080942425 11:36934389-36934411 GTGTGCAAAATGGAGGTTGGAGG + Intergenic
1081477176 11:43446022-43446044 GTGAACCAGATGGAGAGATGTGG + Intronic
1081884581 11:46483905-46483927 GGTAAAAAGAAGGAGGTAGGGGG + Intronic
1081927763 11:46845180-46845202 GTGATGAAAATGGAGGAAGGAGG + Intronic
1081959405 11:47123640-47123662 GAAAACAAGATGGGGGTAGAGGG + Intronic
1084185111 11:67467415-67467437 GTGAAGGAGGTGGAGGGAGGGGG + Intronic
1085307016 11:75492245-75492267 GGGCACAGGCTGGAGGTAGGAGG - Intronic
1085986923 11:81799110-81799132 ATGAGCAAGAGGGAGGCAGGAGG - Intergenic
1086170003 11:83825645-83825667 GTGAACAAGATGGAGGTAGGAGG + Intronic
1088764496 11:112962583-112962605 GTGAACAATAGGGAGCTGGGAGG + Intronic
1089157346 11:116412698-116412720 GTAAACAAGACGGTGGTGGGAGG - Intergenic
1089409365 11:118226623-118226645 GTGAAAAAGATGGGGGTTTGTGG - Intergenic
1091070189 11:132555720-132555742 GTGAGCAAAATGGATGAAGGGGG - Intronic
1091375176 12:20307-20329 GTAGACAAGATGGAGCTATGGGG + Intergenic
1091855505 12:3736142-3736164 GGGAAGAAGATGGAAGGAGGGGG + Intronic
1093007677 12:14068185-14068207 GAGAAAAAGAGGGAGGGAGGAGG - Intergenic
1094268573 12:28586187-28586209 CTAAACAAGATGGAGATAGCAGG + Intergenic
1094713611 12:32989151-32989173 GTGAAAAAGAGACAGGTAGGAGG + Intergenic
1096737782 12:53669344-53669366 GTGAAAAAGAGGCAGGTAGAAGG + Intronic
1097564249 12:61248666-61248688 GTGTAAGAGATGGAGGTAGAAGG - Intergenic
1097707512 12:62883151-62883173 GTGAGCAGGATGGAGGAGGGTGG - Intronic
1097744445 12:63285755-63285777 GAGAACAAGGTGGAGGTGAGTGG - Intergenic
1099170087 12:79353589-79353611 CTGAAGAAGATGGATGTGGGTGG + Exonic
1100159977 12:91846687-91846709 GAGAACTAGATGGCTGTAGGAGG + Intergenic
1100599047 12:96097120-96097142 GTGAGCAAGATGGGAGTAGTAGG + Intergenic
1102394484 12:112574942-112574964 GTGATGAAGATGGAGGAGGGAGG + Intronic
1103163207 12:118748155-118748177 TTGAAGAACATGGAGGTTGGAGG + Intergenic
1104145121 12:126025925-126025947 ATGCACAAGATGAGGGTAGGGGG - Intergenic
1104713590 12:131002823-131002845 GTGAAGCACAGGGAGGTAGGGGG + Intronic
1106419060 13:29570469-29570491 AGGAACAAGATGGAGGTAGGGGG - Intronic
1106544516 13:30718484-30718506 GAGAAAAGGATGGAGGAAGGGGG - Intronic
1107574073 13:41697883-41697905 TTGAATAAGAGGGAAGTAGGAGG - Intronic
1107753915 13:43599017-43599039 GTGAACATGATGGAGGGAAGAGG + Intronic
1109133893 13:58624029-58624051 CTGAAGAAGATGGAGGTAAATGG - Intergenic
1109219631 13:59628213-59628235 GTGAACATGATGGAGAGAGAAGG + Intergenic
1109724251 13:66318622-66318644 GGGAACAAAATGGAGGCAGAGGG + Intronic
1110068027 13:71133536-71133558 GTTTTCAAGATGGAGGTAGGAGG + Intergenic
1110356152 13:74570153-74570175 GTGTAGATCATGGAGGTAGGAGG + Intergenic
1110980037 13:81885687-81885709 GTGAACCAGATGGAGGCAATTGG - Intergenic
1111863784 13:93742513-93742535 GTGAACAAGATGGATAAATGTGG + Intronic
1113162622 13:107399193-107399215 GGGAAACAAATGGAGGTAGGGGG + Intronic
1114261449 14:21039526-21039548 CAGAAAAAGATGGAGGAAGGGGG - Intronic
1114738761 14:25071479-25071501 GTAAAAAAAATGGAGGTAGGCGG + Intergenic
1115074783 14:29374918-29374940 GTGAAAAAGAAGCAGGTAGCAGG - Intergenic
1115475554 14:33809901-33809923 TTGAGAAAGATGGAGGTGGGGGG + Intergenic
1116866851 14:50038297-50038319 GTGAACAAGAGTCAGGTGGGCGG - Intergenic
1121290057 14:92766903-92766925 GTAAACAAGCTGGGGGTGGGGGG - Intergenic
1122091355 14:99343020-99343042 GTGAATAAGGTGGATGCAGGGGG + Intergenic
1122874637 14:104658323-104658345 GAGAACAAGATGGAGGTGCGTGG - Intergenic
1125074933 15:35602990-35603012 ATGAAAGAGAGGGAGGTAGGTGG - Intergenic
1126454898 15:48850282-48850304 GTTTACAAGATAGAGGAAGGTGG + Intronic
1127770798 15:62229060-62229082 GTGAGCAAGAGAGAGGGAGGAGG + Intergenic
1128801162 15:70498011-70498033 GTGAGCCAGTTGGAGATAGGAGG - Intergenic
1129332385 15:74834273-74834295 GTGACTGGGATGGAGGTAGGAGG + Intergenic
1130904112 15:88227930-88227952 GTGAACATGAAGAAGGGAGGAGG - Intronic
1132353695 15:101156206-101156228 GTGAGCAGCATGGAGGTGGGTGG + Intergenic
1132451400 15:101970667-101970689 GTAGACAAGATGGAGCTATGGGG - Intergenic
1132652903 16:1029491-1029513 GTGCACAGGCTGGAGGGAGGTGG - Intergenic
1133005568 16:2879660-2879682 GTGAAAATGATGGCGGCAGGAGG + Intergenic
1134784654 16:16930668-16930690 GTGCTAAGGATGGAGGTAGGGGG + Intergenic
1135065310 16:19304766-19304788 GTGAACAAAAAAGAGGAAGGAGG + Intronic
1135138576 16:19902899-19902921 GTGAACAAGAGGGAGGGTGTTGG + Intergenic
1135485548 16:22861768-22861790 GTGAGCAAGGGGGAAGTAGGAGG - Intronic
1136428416 16:30183947-30183969 GCGGCCAAGATGGAGGTGGGTGG + Intronic
1137598073 16:49737980-49738002 ATCCACAAGATGGAGGCAGGGGG + Intronic
1138811320 16:60153961-60153983 TTGAACTACATGGAGGTAAGGGG - Intergenic
1139421389 16:66851455-66851477 GTGAACCAGATGCAGCTATGGGG - Exonic
1139754332 16:69131482-69131504 GTGGAGAAGATGGGGGTGGGTGG - Intronic
1140271157 16:73467457-73467479 ATGAACAAGATGTAGGTAGCAGG + Intergenic
1140406483 16:74714527-74714549 GGGAAGGAGATGGAGGTGGGGGG - Intronic
1140871310 16:79109127-79109149 GAGAACAATATAGAGGCAGGGGG + Intronic
1142325601 16:89412442-89412464 GAGAAGAAGAGGAAGGTAGGAGG - Intronic
1143001332 17:3796993-3797015 GTGTAGAAGATCGAGGTGGGGGG - Intronic
1143033581 17:3981900-3981922 CTGCACAAGGTGGAGGTTGGAGG - Intergenic
1144114804 17:12077625-12077647 GGCAACAAGAAGGAGGTTGGAGG + Intronic
1145771479 17:27496420-27496442 GTGAACAAAATAGAGAAAGGGGG - Intronic
1146259742 17:31413568-31413590 GTGAGCAAAAGGGAGGGAGGAGG - Intronic
1146564493 17:33900731-33900753 TTGAAGAAGTTGGAGGTGGGAGG + Intronic
1146679953 17:34799916-34799938 GAGAACAAGCAGGAGGAAGGGGG - Intergenic
1147988885 17:44321523-44321545 GTGAAGTAGATGGCGGTAGCTGG + Exonic
1148201057 17:45750295-45750317 GGAAACAGGATTGAGGTAGGCGG - Intergenic
1148987082 17:51632436-51632458 GGGAACAAGGGGGAAGTAGGAGG + Intronic
1150437909 17:65168323-65168345 GAGCACAGGATGGAGGTGGGAGG - Intronic
1151029308 17:70717724-70717746 GAAAACAAGAGGGAGGTCGGGGG + Intergenic
1151661104 17:75518634-75518656 GTGAACAAAATGATGGCAGGTGG - Intronic
1152002147 17:77653695-77653717 GTGAAGAAGGTGGAGAGAGGAGG - Intergenic
1152174622 17:78779632-78779654 CTTAATAAGAGGGAGGTAGGAGG + Intronic
1154063583 18:11085881-11085903 GAGAAAAAAAGGGAGGTAGGGGG + Intronic
1155620662 18:27775141-27775163 GTGAACAGGAGAGAAGTAGGTGG - Intergenic
1155840271 18:30633993-30634015 GTGTATATGATAGAGGTAGGAGG - Intergenic
1157403850 18:47407641-47407663 CTGAAGAAGAGGGAGGCAGGAGG - Intergenic
1158245902 18:55431669-55431691 GTAAACAAGATGGCAGCAGGCGG + Intronic
1158723028 18:59942719-59942741 GTAAAAAATATGGAGGTAGAGGG + Intergenic
1158925532 18:62254632-62254654 GGCAACAAACTGGAGGTAGGCGG - Intronic
1159505177 18:69327493-69327515 GTCAACTAGATGCAGGCAGGAGG + Intergenic
1160633864 19:61880-61902 GTAGACAAGATGGAGCTATGGGG + Intergenic
1161544708 19:4873291-4873313 GTGAGCGAGAGGGAGGGAGGAGG - Intergenic
1161863551 19:6817462-6817484 GTTAACTAGATGGATGGAGGTGG - Intronic
1163618679 19:18344619-18344641 GTGAACGGGATGGAGGGACGGGG + Intronic
1165432783 19:35781935-35781957 GTGGCCAAGAGGGAGGCAGGAGG + Intronic
1168257525 19:55174890-55174912 CTGAAGAAGATGGACGTAGGAGG - Exonic
925593207 2:5530276-5530298 GTGAGCAGGCTGGAGGAAGGAGG - Intergenic
926126871 2:10277429-10277451 GTGGACCAGATGGAGGACGGGGG + Intergenic
926720882 2:15959357-15959379 GTGGATGAGATGGAGGAAGGAGG + Intergenic
927220740 2:20706644-20706666 CTGAACAAGATGGAGTAAGAGGG + Intronic
927370956 2:22354846-22354868 GTGAACAACATGGTGGTTAGGGG - Intergenic
927639921 2:24839882-24839904 GCCAACAAGATGGAGGCCGGCGG - Exonic
927908076 2:26876237-26876259 GTGAACAGAATGGAGGAAGGGGG + Intronic
928143104 2:28747884-28747906 GTGAGCAGGATGGGGGGAGGGGG + Intergenic
928180724 2:29066586-29066608 CTGAACAAGATCGAGGTGGGTGG + Intronic
929425737 2:41842956-41842978 GGGAAGAATATGGAGCTAGGTGG - Intergenic
929572849 2:43033606-43033628 GTGGACAGGATAGAGGTCGGGGG - Intergenic
931119661 2:59202005-59202027 GTGAAAAAGATGCAGGAAAGAGG + Intergenic
931473442 2:62563833-62563855 GTGAAGTAGAAGGAGGCAGGAGG + Intergenic
932452916 2:71827279-71827301 TTGAGCAAGATGGTGGAAGGTGG - Intergenic
932500282 2:72177193-72177215 GTGAACAAGGTGGAGGAATAGGG - Exonic
933274197 2:80266371-80266393 GAGCACCAGATGGTGGTAGGTGG + Intronic
933860485 2:86461889-86461911 GTGAAAGAGATGGGGGGAGGAGG + Intronic
933892349 2:86783490-86783512 ATGAACAAGTTGGAGGTCTGTGG + Intergenic
935135342 2:100295625-100295647 GTGAACAAGGAGGTGGTGGGTGG + Intronic
935263439 2:101374820-101374842 GTTAAAAAGATGGAGGCTGGGGG + Intronic
935613190 2:105047479-105047501 GGGAAGGGGATGGAGGTAGGAGG + Intronic
935867679 2:107408548-107408570 GGGAACAAAATGGAAGAAGGAGG + Intergenic
936567613 2:113593135-113593157 GTAGACAAGATGGAGCTATGGGG - Intergenic
936917754 2:117657190-117657212 CTGAACAAAATGGAGGTCAGAGG + Intergenic
937125387 2:119472162-119472184 GTGAGAGAGATGGAGGCAGGTGG + Intronic
937770918 2:125720503-125720525 CTGATCATGATGGAGGCAGGAGG + Intergenic
939341009 2:140895925-140895947 GAGTACAGGATGGAGGTGGGGGG + Intronic
939933558 2:148260564-148260586 GTGAAAAATATGGGGGCAGGAGG - Intronic
940460972 2:153962417-153962439 TTGAAAAAGATGGAGATAGGTGG + Intronic
940638760 2:156327636-156327658 GAGGACAGGATGGAGGAAGGAGG - Intronic
941610462 2:167654978-167655000 ATGAATAAAATGGAGGTAAGGGG + Intergenic
941884460 2:170514016-170514038 GAGAACAAGGTGTAGGTAAGAGG + Intronic
941947795 2:171119354-171119376 GAGAACAAGAAGGTGGTGGGGGG - Intronic
942007719 2:171723229-171723251 GAGAATAAGATGTGGGTAGGAGG + Intronic
942177651 2:173349885-173349907 GTGGAAAAGATGGAGGAAAGAGG - Intergenic
943515890 2:188885990-188886012 GTCAACAAGAAGGAGGTAGGAGG + Intergenic
944333510 2:198501372-198501394 GTGAACAGGATGTAGATATGAGG - Intronic
947818355 2:233053405-233053427 GTGAACAGGGTTGAGTTAGGCGG - Intergenic
947955591 2:234187775-234187797 GAGAAGGAGATGGAGGTGGGAGG - Intergenic
948458426 2:238117975-238117997 GAGAAATAGATGGAGGAAGGTGG + Intronic
1169202891 20:3722622-3722644 TTGAACAACATGGGGGTTGGGGG - Intergenic
1170460248 20:16571139-16571161 GTGAACAGGTTTGAGGAAGGTGG - Intronic
1171418165 20:24997778-24997800 TTGAACAAAGTGGAGGTTGGGGG - Intergenic
1171784451 20:29449269-29449291 GTGAACTCGATTGAGGGAGGAGG + Intergenic
1172623697 20:36335652-36335674 GGGAACAAGAGGGAGGAAGAAGG - Intronic
1172772902 20:37392035-37392057 GTGTACAACAAGGAGGTGGGTGG + Intronic
1175146917 20:56904034-56904056 AGGAAGAAGATGGAGGTAGAAGG - Intergenic
1175227392 20:57452554-57452576 GTGAACAAGAAGGAGTGTGGCGG + Intergenic
1175414352 20:58792077-58792099 GGGAACAAAAGGAAGGTAGGAGG - Intergenic
1177666664 21:24168323-24168345 GTGAACAAGATGAGGCTAGTTGG + Intergenic
1179772514 21:43632836-43632858 TTGAGCAACATGGAGGTTGGAGG - Intronic
1180008569 21:45034770-45034792 GTGCAGAAGGTGGAGGTGGGAGG + Intergenic
1180874250 22:19167490-19167512 GTGACCAAGGTGGAGATGGGAGG - Intergenic
1182663030 22:31938444-31938466 CTGAACAAGCTGGAGGGGGGCGG + Intronic
1182719719 22:32387292-32387314 GTGAACAAAATGGAGGTAGGTGG - Intergenic
1183229183 22:36570243-36570265 GTGGACAAGATGGAGGGCGGCGG + Intronic
1183552897 22:38502478-38502500 GGGAACAAGAAGGAGATAGAAGG - Intronic
1184313608 22:43665117-43665139 GAGAACAGGAAGGATGTAGGCGG + Intronic
1184494072 22:44827107-44827129 CTTTACAAGAGGGAGGTAGGAGG + Intronic
1184666927 22:45994191-45994213 GTGGTGATGATGGAGGTAGGGGG + Intergenic
949102540 3:163456-163478 GAGAAGAAGATGGAGGAGGGAGG - Intergenic
949599111 3:5579309-5579331 GTGAAAAAGGTGGAGGAATGGGG + Intergenic
949974737 3:9445778-9445800 GTTCACATGATGGAGGTAGCAGG - Intronic
950120684 3:10480678-10480700 GAGAACAAGATGGACTTGGGAGG - Intronic
950141866 3:10621180-10621202 GAGAACAGGATGGAGGGAGGGGG - Intronic
950692199 3:14668794-14668816 CTTAACAACTTGGAGGTAGGTGG + Intronic
951107428 3:18761483-18761505 TTGACCTAGATAGAGGTAGGTGG + Intergenic
951477667 3:23125719-23125741 GTGAGCAAGACGGAGGAACGTGG + Intergenic
952856192 3:37772584-37772606 GTCATCAAGGTGGAGGGAGGCGG - Intronic
952950064 3:38515665-38515687 GTGAACATGATGGGTGTAGCGGG - Intronic
953783974 3:45896764-45896786 GGGCACAAGAAGGAGGGAGGTGG - Intronic
953905412 3:46866075-46866097 GTGAACAGGAGGCAGGAAGGTGG + Intronic
955018035 3:55090722-55090744 TTGAAGGAGATGGAGGTGGGGGG - Intergenic
955645776 3:61135993-61136015 ATGATCATGCTGGAGGTAGGAGG + Intronic
957569931 3:81933630-81933652 GTGAACAAGATGGAGTGCTGGGG - Intergenic
957712286 3:83877100-83877122 GTGAACAAGGTGGAAGAAGCTGG + Intergenic
958159820 3:89804351-89804373 TCTAACAAGAAGGAGGTAGGGGG - Intergenic
960430150 3:117559284-117559306 ATGAATAAGATGGTGGAAGGGGG + Intergenic
960455585 3:117867133-117867155 GTGAACAACATGTAGGTTAGAGG - Intergenic
960630941 3:119729742-119729764 GAGAACAAGTTGAAGGTAGGAGG + Intronic
960778846 3:121294373-121294395 GTGAAGAAGCTTGAGATAGGAGG + Intronic
961345409 3:126260541-126260563 GGGAAGAAGATGGGGGGAGGAGG - Intergenic
961618862 3:128207248-128207270 GGGAAGAAAATGGAGGGAGGGGG - Intronic
961659730 3:128462365-128462387 GTGAACATGAAGGAGGGAGTGGG - Intergenic
962310559 3:134323978-134324000 CTGAGCAAGATGGTGGTATGAGG + Intergenic
962436430 3:135371429-135371451 GGGAACAGGAGGGAGGTGGGTGG - Intergenic
964792035 3:160461365-160461387 TTGAACAATGTGGAGGTTGGGGG - Intronic
964793663 3:160475559-160475581 ATGAATAGGGTGGAGGTAGGAGG - Intronic
965795818 3:172437703-172437725 TGGAAGAAGATGTAGGTAGGAGG - Intergenic
965877699 3:173347845-173347867 TTGAACAACATGGGGGTTGGGGG + Intergenic
967655080 3:192038241-192038263 GTGGGCAGGGTGGAGGTAGGGGG + Intergenic
970236555 4:13964682-13964704 TTGAACAACATGGAGGTTAGGGG - Intergenic
970943399 4:21661721-21661743 GTGAACTAGATGGAGGGTGGAGG - Intronic
971566781 4:28154359-28154381 GAGAACAGAATGGAGGTTGGTGG - Intergenic
973295723 4:48518606-48518628 GTGAACAAGAAGGAGAGGGGTGG - Intronic
974538501 4:63200882-63200904 GGGAACAAGATGTAGCTGGGAGG - Intergenic
976343755 4:83975518-83975540 GTGAAGGAGTAGGAGGTAGGGGG - Intergenic
976356639 4:84126561-84126583 GTGACCAAGGTGGGGGTAGAAGG + Intergenic
976777173 4:88719529-88719551 GAGAAAAAGATAGAGGAAGGAGG - Intergenic
979459754 4:120968506-120968528 TTGAACAACATGGAGGTTAGGGG - Intergenic
981394397 4:144229989-144230011 GTAAACTAGTTGGAGGTGGGAGG + Intergenic
981601252 4:146491529-146491551 AGGAAAAAGATGGAGGGAGGAGG + Intronic
981757613 4:148157531-148157553 GCGAATATGATGGAGGTAGTGGG + Intronic
982311293 4:153988062-153988084 GTGAAGAGGGTGAAGGTAGGAGG - Intergenic
984424452 4:179565184-179565206 TTGAAAAAGATGGTGGAAGGAGG - Intergenic
985181413 4:187268239-187268261 GGGAGCAAGAGAGAGGTAGGAGG - Intergenic
985401204 4:189595987-189596009 GTCAACAAGATGGAGTTCAGTGG + Intergenic
985857701 5:2443000-2443022 ATGAGCAAGAAGGAGGTCGGAGG - Intergenic
986706931 5:10460305-10460327 TTGAGCAAGTTGGAGGTGGGAGG + Intronic
986811234 5:11361701-11361723 TAGAAAAAGATGGTGGTAGGTGG - Intronic
986827024 5:11532884-11532906 GAGAAAAAGAAGGAGGGAGGTGG + Intronic
987826017 5:23031328-23031350 TTGAAAAAGATGGAAGGAGGAGG - Intergenic
987839486 5:23204677-23204699 TTGAACAACATAGAGGTTGGAGG - Intergenic
988483432 5:31648501-31648523 GAGAACAAGGTGGAGGCTGGAGG - Intronic
988573520 5:32396256-32396278 TTGAACAACATGGAGGTCAGGGG - Intronic
989062786 5:37426143-37426165 GTGGCCAAGAAGGAGGTAGAAGG + Intronic
989325365 5:40186913-40186935 GGGATGGAGATGGAGGTAGGAGG + Intergenic
990784259 5:59401531-59401553 GTGAATAAGATGGGGGAGGGTGG + Intronic
990863603 5:60355550-60355572 TTGAACAAGGTGGGGGTTGGGGG + Intronic
991186197 5:63811064-63811086 GTGGACAAGATGGTGGTCAGAGG + Intergenic
991394340 5:66188050-66188072 GGGAACAAGATGGAAGTTGCAGG - Intergenic
991397079 5:66215371-66215393 TTGAACAACATGGGGGTAAGGGG - Intergenic
993128793 5:83870049-83870071 AAAAACAAGATGGAGGTGGGGGG - Intergenic
994057517 5:95435005-95435027 GTGAAAAAGATGGAGAAAGAAGG + Intronic
994577346 5:101595210-101595232 GTTACCAAAATGGAGGCAGGGGG + Intergenic
996089911 5:119340549-119340571 GTGAACAAGTTTGAGGAATGGGG + Intronic
996244761 5:121248480-121248502 GTAAAAAAGATGGAGGGTGGGGG - Intergenic
996629603 5:125611649-125611671 GAGAAAGAGAGGGAGGTAGGGGG + Intergenic
996629610 5:125611671-125611693 GAGAAAGAGAGGGAGGTAGGGGG + Intergenic
996922769 5:128788304-128788326 CTGAACAATGTGGAGGTTGGGGG + Intronic
997229130 5:132229948-132229970 GTGAAAAAGATGGAGAGAAGTGG - Intronic
997232823 5:132256745-132256767 GAGAACCAGAGGGAGGTTGGTGG + Intronic
999862910 5:155667732-155667754 GTAAACAAGGTGGAGGCTGGTGG - Intergenic
1000662199 5:163950664-163950686 TTGAACATGATGGACCTAGGTGG + Intergenic
1003487853 6:6595242-6595264 GAGAACAAGAAGGAGGGAAGGGG + Intronic
1004112552 6:12733549-12733571 CTAAACCAGATGGAGGTAGATGG + Intronic
1005613244 6:27547223-27547245 CTGAACATGATGGAGGAAGTAGG - Intergenic
1005625989 6:27662969-27662991 GTGAAGAAGATGGATGTCTGAGG + Intergenic
1005881497 6:30065638-30065660 TTGAACAACATGGGGGTAAGGGG - Intergenic
1006409154 6:33862284-33862306 GTGAAGAGGATGCAGGAAGGTGG + Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007554544 6:42755090-42755112 GAGAAAAGGGTGGAGGTAGGGGG + Intronic
1010010147 6:71039726-71039748 GTGGACAAGATGGAGAAATGAGG - Intergenic
1010315806 6:74448706-74448728 GTGTTCATGGTGGAGGTAGGAGG + Intergenic
1011541172 6:88431882-88431904 GTGATGAAGATGGAGGTTGGGGG + Intergenic
1012118282 6:95332639-95332661 TTGAACAACATGGAGGTTAGGGG + Intergenic
1012310801 6:97721822-97721844 GTGACCAAGAAGGGAGTAGGAGG - Intergenic
1013311278 6:108896479-108896501 GTGTATAAAATGGAGGCAGGAGG + Intronic
1015203969 6:130614237-130614259 GTCAACCAGATGGAGGTTGGGGG + Intergenic
1018377518 6:163227266-163227288 AGGAACAAGAGGGAGGTGGGAGG + Intronic
1021620989 7:22550767-22550789 GTGAAGAACAGTGAGGTAGGAGG - Intronic
1023394916 7:39743756-39743778 CTGGACATGCTGGAGGTAGGGGG + Intergenic
1025204470 7:56984188-56984210 AAGAACAAAATGGAGGTAGGAGG - Intergenic
1025667467 7:63592747-63592769 AAGAACAAAATGGAGGTAGGAGG + Intergenic
1025696919 7:63782384-63782406 GGGAGGGAGATGGAGGTAGGAGG - Intergenic
1025919889 7:65901653-65901675 GAGGACAAGATGGGGGTTGGCGG + Intronic
1026454972 7:70563303-70563325 GTTAACATGAAGGAGGTATGTGG + Intronic
1027294969 7:76760818-76760840 GTGAACAAGACAGAGGGAGAGGG - Intergenic
1028384955 7:90244454-90244476 GTGAAAAGGGAGGAGGTAGGGGG + Intergenic
1030658722 7:112196320-112196342 GTGACAGAGAAGGAGGTAGGGGG - Intronic
1030703273 7:112664470-112664492 GTGAAAAAAATGGAGGCAGTTGG - Intergenic
1031344460 7:120648497-120648519 GTCAACAAGATGGAGAAAGATGG + Intronic
1033453255 7:141480403-141480425 GGGAGCAAGATGGGGGTGGGTGG + Intergenic
1035035486 7:155891585-155891607 GTGAAGGGGATGGGGGTAGGGGG + Intergenic
1044937829 8:97309947-97309969 GGGAACAAGAGGGAGGGAGTGGG - Intergenic
1046124297 8:109884882-109884904 GTGTTAAAGATGGAGGAAGGAGG - Intergenic
1048613861 8:136053092-136053114 GGGAAGAAGATAGAGATAGGGGG + Intergenic
1048873585 8:138818468-138818490 CTGGACAAGATGGAGCTATGGGG - Intronic
1048970530 8:139642906-139642928 CAGAACAAGATTGGGGTAGGTGG + Intronic
1049210761 8:141385442-141385464 GGGAAAAAGAGGGAGGGAGGGGG - Intergenic
1049535746 8:143180915-143180937 GAGAACAGGGTGGGGGTAGGGGG - Intergenic
1049596308 8:143485184-143485206 GAGAACAGGAGGGAGGCAGGCGG + Intronic
1049884921 9:20385-20407 GTAGACAAGATGGAGCTATGGGG + Intergenic
1049927190 9:420926-420948 CTGGACAAGACAGAGGTAGGAGG - Intronic
1050302233 9:4271387-4271409 TTGAACAATATGGAGGTTAGGGG - Intronic
1050790600 9:9463966-9463988 GTTAACAAGAAGCAGGTAGCTGG - Intronic
1051127876 9:13824643-13824665 GGCAACAAGATGGGGGTTGGAGG - Intergenic
1051516374 9:17934725-17934747 ATGAACTACATGCAGGTAGGTGG - Intergenic
1053594613 9:39546909-39546931 GAGAACAATATGGGGGTATGGGG - Intergenic
1058869667 9:109191068-109191090 GGGAAGCAGATGGAGGGAGGAGG + Intronic
1058935295 9:109764304-109764326 ATGTACAAGATGGAGGGGGGTGG - Intronic
1059645549 9:116263218-116263240 GTGGATAAGAAGGAGGTCGGTGG + Intronic
1062591839 9:137277893-137277915 GTGGACCAGCTGCAGGTAGGGGG + Exonic
1062631843 9:137466626-137466648 GTGATGGAGATGGTGGTAGGAGG - Intronic
1186232574 X:7471859-7471881 GAGGACAAGAGGGAGGGAGGAGG + Intergenic
1186400386 X:9253228-9253250 TGGAACAAGATTGATGTAGGAGG - Intergenic
1186673665 X:11793479-11793501 GGGGACAAGAGGGAGGCAGGGGG - Intergenic
1189412209 X:40782665-40782687 GTTAACGAGATGGTGGGAGGTGG - Intergenic
1189814727 X:44813450-44813472 GTGAAAAAGATAGAGGAAGATGG - Intergenic
1190823300 X:53994456-53994478 TTGAATAAGATGAAGGTGGGAGG - Intronic
1190842016 X:54154078-54154100 GAGAATAAAATGGAGGTAAGGGG + Intronic
1192024733 X:67437424-67437446 GAGAACAGGAGGGAGGAAGGTGG - Intergenic
1193552580 X:82915147-82915169 GCCAACAAGAGGGAGGTAGACGG - Intergenic
1195880336 X:109586529-109586551 GAGAACAGGAGGGAGGTGGGTGG - Intergenic
1196138921 X:112239339-112239361 AGGAACAAGATGGAGCTAGCAGG + Intergenic
1196694238 X:118594069-118594091 GTGAGCCAGAGGGAGGTTGGGGG + Intronic
1197297061 X:124731848-124731870 ATGAACAAGATGGAGAAATGTGG + Intronic
1197651445 X:129069420-129069442 CTTAACAAGATGGGGGAAGGGGG + Intergenic
1199509868 X:148609914-148609936 AAGAACAAGATGGATGTGGGAGG - Intronic