ID: 1086171469

View in Genome Browser
Species Human (GRCh38)
Location 11:83841465-83841487
Sequence TAGTCTCTCTACTCTAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086171465_1086171469 -9 Left 1086171465 11:83841451-83841473 CCTGATACTCTCCTTAGTCTCTC 0: 1
1: 0
2: 0
3: 16
4: 251
Right 1086171469 11:83841465-83841487 TAGTCTCTCTACTCTAGGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 164
1086171464_1086171469 -8 Left 1086171464 11:83841450-83841472 CCCTGATACTCTCCTTAGTCTCT 0: 1
1: 0
2: 2
3: 10
4: 252
Right 1086171469 11:83841465-83841487 TAGTCTCTCTACTCTAGGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086171469 Original CRISPR TAGTCTCTCTACTCTAGGCT GGG Intronic
902306280 1:15542214-15542236 TGGGCCCTCTACTGTAGGCTTGG - Intronic
902900793 1:19514452-19514474 TAGTCTCCGTTGTCTAGGCTGGG + Intergenic
903828088 1:26159428-26159450 TAGTCTCCCTGCTCAGGGCTGGG + Intronic
904151994 1:28449290-28449312 TAGCCACTGTACTCTAGCCTGGG + Intronic
905339344 1:37267559-37267581 TAGAGTCTCAACCCTAGGCTTGG - Intergenic
907199545 1:52714650-52714672 TAGTCTCTGCACTCCAGCCTAGG + Intergenic
908218326 1:61977846-61977868 TAGCCACTGTACTCTAGCCTGGG + Intronic
909583742 1:77266340-77266362 TGGTGTCTCTCCTCTGGGCTGGG - Intergenic
910513539 1:88034442-88034464 TAGCCACTGTACTCTAGCCTGGG - Intergenic
910652258 1:89582322-89582344 TTGTATCTCAACTCCAGGCTAGG - Intronic
910906015 1:92179201-92179223 TTGCCTCTATACTCCAGGCTGGG + Intronic
911266399 1:95749812-95749834 TAGGCTCCCTTCTCTGGGCTGGG - Intergenic
911861059 1:102949998-102950020 TAGAATCTCTGCTCTTGGCTGGG + Intronic
913491677 1:119385711-119385733 TAGTATCTCTACTATAGCCAGGG - Intronic
914281077 1:146173523-146173545 TACTCTCTCTTCTCTAGCATTGG + Intronic
914542120 1:148624462-148624484 TACTCTCTCTTCTCTAGCATTGG + Intronic
914624520 1:149446782-149446804 TACTCTCTCTTCTCTAGCATTGG - Intergenic
916748327 1:167701599-167701621 TTCTCTCTCTAAACTAGGCTGGG - Intronic
919937376 1:202263557-202263579 TAATCCCTCTCCTCTAGCCTAGG - Intronic
922524196 1:226286159-226286181 TAGTCACTGCACTCTAGCCTGGG - Intronic
922812141 1:228422807-228422829 TAGCCACTGTACTCTAGCCTGGG + Intergenic
923543247 1:234904443-234904465 TAGCCACTGTACTCCAGGCTGGG + Intergenic
1067116278 10:43437437-43437459 TTGTCTCGCTTCTCTAGGGTGGG - Intronic
1069003431 10:63291657-63291679 TAGTCACTGCACTCTAGCCTGGG - Intronic
1069850277 10:71399731-71399753 TAGCCACTGTACTCCAGGCTGGG + Intronic
1071692129 10:87832114-87832136 TTGTCACTCTACTCCAGCCTGGG - Intronic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1079195231 11:18320770-18320792 TAGTGTTTCTACTCTATTCTGGG - Intronic
1079835195 11:25325291-25325313 TAGCCACTGTACTCTAGCCTGGG + Intergenic
1082022715 11:47548254-47548276 GAGTCACTGCACTCTAGGCTGGG + Intronic
1083789897 11:64977696-64977718 TAGTCTCTCTCCTGCAGGATGGG + Intergenic
1083928542 11:65824738-65824760 GATTCTCTCTGCTCTGGGCTGGG + Intronic
1084135380 11:67175403-67175425 GAGTCTCTGTCATCTAGGCTGGG - Intronic
1085147962 11:74220320-74220342 TTGTCTCTGTTCTCTAGTCTCGG + Intronic
1086171469 11:83841465-83841487 TAGTCTCTCTACTCTAGGCTGGG + Intronic
1087525533 11:99305936-99305958 TCGTCTCTGCACTCTAGCCTGGG + Intronic
1087709916 11:101536490-101536512 TATATTCTCTACTCTAGGGTAGG + Intronic
1089811106 11:121132409-121132431 TACTTTCTCTGCTCTAGCCTTGG + Intronic
1090153284 11:124408306-124408328 TATTCTCTCTCCTCTATGTTTGG - Intergenic
1092726454 12:11490776-11490798 TAGTCACTGCACTCTAGCCTGGG - Intronic
1092847408 12:12596589-12596611 TCCTCTCTCTCCTCTAGGGTAGG + Intergenic
1093861884 12:24175953-24175975 TAGTTTCTCTTCTCAAGGCAAGG + Intergenic
1096451444 12:51745608-51745630 TGGTCTTTCTACTCTATGCTTGG + Intronic
1096930333 12:55200851-55200873 TAGTCTCTCTGCACTAAACTAGG - Intergenic
1097213797 12:57394003-57394025 AAATGGCTCTACTCTAGGCTGGG + Intronic
1097308229 12:58092153-58092175 TAGGCTTTCTCCTGTAGGCTTGG + Intergenic
1097715635 12:62963009-62963031 TTGTCACTGTACTCTAGCCTGGG - Intergenic
1098965893 12:76788041-76788063 TAGCCACTGTACTCTAGCCTGGG + Intronic
1099239461 12:80121497-80121519 TAGACTCTCTGCTCTAGGGAGGG - Intergenic
1103009072 12:117443924-117443946 GAGACTCGCTGCTCTAGGCTTGG - Intronic
1105935457 13:25094551-25094573 GAAACCCTCTACTCTAGGCTAGG + Intergenic
1108214256 13:48168439-48168461 TAGTCACTGCACTCCAGGCTGGG + Intergenic
1110085545 13:71374588-71374610 TTGGGTCGCTACTCTAGGCTAGG + Intergenic
1110603465 13:77403357-77403379 TATGCTCTCTATTCTAGACTGGG - Intergenic
1111805703 13:93038671-93038693 TTGTGTCTCTACTCTAGGCCAGG - Intergenic
1114214402 14:20645134-20645156 TAATCTCTCTACTGAAGGGTGGG + Intergenic
1119392057 14:74297599-74297621 TAGCCACTGTACTCTAGCCTGGG - Intronic
1121146739 14:91590693-91590715 TAGTCACTGCACTCTAGCCTGGG - Intronic
1121455157 14:94034052-94034074 TAGTCTCTCTTCTCAAGAGTGGG - Intronic
1125061680 15:35433481-35433503 GAGTCTCTCTACACTGGGGTTGG + Intronic
1129585855 15:76863895-76863917 TGGTCTCTCTACTTGTGGCTTGG - Intronic
1130722630 15:86404439-86404461 TAGACTGTCTCCTCTGGGCTGGG + Intronic
1130929828 15:88416095-88416117 GAGTCTCTTGAGTCTAGGCTGGG - Intergenic
1134410398 16:13999145-13999167 TCGTCACTGTACTCTAGCCTGGG + Intergenic
1135063911 16:19293214-19293236 TACTCTCTCTAGTATTGGCTGGG - Intronic
1135754395 16:25084319-25084341 GAGTCTCTGTACTCCAGCCTGGG + Intergenic
1137574254 16:49588148-49588170 CAGACTCTCCACCCTAGGCTTGG - Intronic
1139258021 16:65562195-65562217 TAGTCTTTCTTGTCTAGGTTTGG + Intergenic
1139621192 16:68144698-68144720 GAGTCTCTGCACTCCAGGCTAGG - Intronic
1139720443 16:68848136-68848158 TAGTCACTGTACTCCCGGCTGGG - Intronic
1139829272 16:69783502-69783524 TAGCCACTGTACTCTAGCCTGGG + Intronic
1140414326 16:74762821-74762843 AAGTTTTTCTACTCTAGGCCGGG - Intronic
1143089167 17:4438567-4438589 TTCTCTCTCTACATTAGGCTGGG + Intronic
1143594456 17:7906171-7906193 TGGCCCCTCTACTCTAGGCTCGG - Intronic
1143817553 17:9529946-9529968 TAGCCACTCTACTCCAGCCTGGG + Intronic
1144049828 17:11489040-11489062 TAGATTCTCTCTTCTAGGCTAGG + Intronic
1145897795 17:28470618-28470640 TATCTTCTCTCCTCTAGGCTGGG + Intronic
1148097645 17:45064371-45064393 TAGACTCTCTCCTCCAGACTAGG - Intronic
1148399298 17:47340460-47340482 TAGTCACTGTACTCCAGTCTGGG + Intronic
1149757844 17:59202518-59202540 TAGCCACTCTACTCCAGCCTGGG + Exonic
1152154700 17:78625288-78625310 GAGCCGCTCTACTCTAGCCTGGG - Intergenic
1152343562 17:79738247-79738269 CAGCCTCTCTGCTCTGGGCTTGG + Intronic
1152841214 17:82569825-82569847 TAGCCACTGTACTCTAGCCTGGG + Intronic
1203172520 17_GL000205v2_random:162316-162338 AAGTCTCCCTCCTCTGGGCTTGG + Intergenic
1203173199 17_GL000205v2_random:170462-170484 AAGTCTCCCTCCTCTGGGCTTGG - Intergenic
1157772777 18:50364370-50364392 TAGAGGCTCTACCCTAGGCTTGG - Intergenic
1158396583 18:57083396-57083418 TAACCTCTTGACTCTAGGCTGGG - Intergenic
1158726037 18:59973162-59973184 TAGTCTCTACACTCCAGCCTGGG + Intergenic
1159439891 18:68464699-68464721 TAGCCACTCTACTCCAGCCTGGG + Intergenic
1161586123 19:5106833-5106855 TGGTCTCACTGCTCTGGGCTGGG - Intronic
1162825094 19:13246384-13246406 TAGCCTCTCAACCCTGGGCTTGG + Intronic
1163072336 19:14854736-14854758 CAATCTCTCTGCTCTGGGCTTGG + Intergenic
1165648015 19:37460721-37460743 TAGTCACTGCACTCTAGCCTGGG + Intronic
1166476608 19:43131261-43131283 GATTCTCTCTCCTCTAGGATTGG + Intronic
925664343 2:6237435-6237457 TTGTCTCAATACTCTAAGCTGGG - Intergenic
927115349 2:19895279-19895301 TATTCTCTTTACTCTTGACTGGG - Intergenic
928161983 2:28936149-28936171 TAGCCACTATACTCTAGCCTAGG + Intronic
929224778 2:39501564-39501586 TAGTCACTGCACTCTAGCCTGGG - Intergenic
935725652 2:106021712-106021734 TTGTCTCTTTACCCTAGGCTGGG + Intergenic
935868601 2:107419695-107419717 AAGTTTCTCTACTCTAGCCCAGG - Intergenic
938556318 2:132427727-132427749 TAGTCACTATACTCCAGCCTAGG - Intronic
944984843 2:205164421-205164443 TAGTCACTGTGCTCTAGGCCTGG + Intronic
945880147 2:215316530-215316552 TAATCACTGTACTCCAGGCTGGG + Intronic
948997227 2:241587944-241587966 TAGCCACTCTACTCCAGCCTGGG + Intronic
1169281433 20:4270510-4270532 TAGTCACTGTACTCTAGCCTGGG - Intergenic
1170032827 20:11960094-11960116 CTGTCTCTCTAGTCTAGGATGGG - Intergenic
1170999582 20:21398193-21398215 TTTTCTCTCTTCTCTGGGCTTGG - Intergenic
1172011365 20:31847918-31847940 TAGTCTCTCTTCTTTATTCTGGG - Intronic
1175116808 20:56688650-56688672 TAGTCACTGTACTCCAGCCTGGG + Intergenic
1175208302 20:57328943-57328965 TAGCCACTGTACTCCAGGCTGGG - Intergenic
1181391450 22:22585675-22585697 AAGCCTCTCCACTCTAGCCTGGG - Intergenic
1184479037 22:44736574-44736596 CAGTCTCTCTTCTCCAGCCTAGG - Intronic
950465665 3:13151921-13151943 GAGTCACTGTACTCCAGGCTGGG + Intergenic
953234505 3:41094442-41094464 TAGTCCCTCTGCTCTTGGCTAGG + Intergenic
954042329 3:47898206-47898228 TAGTTTCATTACACTAGGCTGGG + Intronic
955662091 3:61311823-61311845 TAGTCTTTTTACTGTAGGCAAGG - Intergenic
956331444 3:68114320-68114342 TAGTTCTTCTGCTCTAGGCTAGG - Intronic
956617848 3:71190593-71190615 TACTCTCTGTACTCTAACCTGGG + Intronic
957138487 3:76320948-76320970 TAGTCTATCTACTATAGCCATGG + Intronic
959896139 3:111608716-111608738 TTGACTCTCTACTCTGTGCTAGG - Intronic
962208314 3:133454286-133454308 TAGCCACTCTACTCCAGCCTGGG + Intronic
962900156 3:139754945-139754967 TTGTCTCTCTACATCAGGCTTGG - Intergenic
964634141 3:158842280-158842302 TATGCTGTCTACTCTAGGCTGGG + Intergenic
965975685 3:174618518-174618540 TAGTTTCTGTACTCTAGGGCAGG - Intronic
975636214 4:76451871-76451893 TAACCTCTGTACTCTAGCCTGGG - Intronic
976276201 4:83281248-83281270 TATTCTCTCTTCTCTAGCCTAGG - Intronic
977646610 4:99419918-99419940 TAGTCTCTTTACGCTATGCCAGG + Intronic
977746476 4:100554908-100554930 TTTTCTCTCTACTCTCTGCTTGG + Intronic
978407418 4:108394978-108395000 TTGTCTCTCCAGTCTAGGCGTGG + Intergenic
978581320 4:110234608-110234630 TAGCCACTGTACTCTAGCCTGGG + Intergenic
979965614 4:127073416-127073438 AAGGCTCTCTGCTCTTGGCTGGG + Intergenic
980123413 4:128750696-128750718 TAATCTCCCTACTGTAGGCTGGG - Intergenic
980701387 4:136436218-136436240 TAGTCTCTCTCCTATTGGCTAGG + Intergenic
983527756 4:168777616-168777638 CAGCCTCTCTAGTCTAGCCTTGG - Intronic
984452661 4:179923439-179923461 TAGAATCTCCACTATAGGCTGGG - Intergenic
985846708 5:2354852-2354874 GAGTATCTATAATCTAGGCTGGG - Intergenic
985893905 5:2738221-2738243 CTGTCTCTCTCCTCTGGGCTTGG + Intergenic
987052968 5:14163548-14163570 CTGTCTCTCTATTCTAGCCTGGG + Intronic
988811443 5:34788924-34788946 GAGTCACTATACTCTAGCCTGGG + Intronic
992671407 5:79064790-79064812 AAGCCACTGTACTCTAGGCTGGG - Intronic
998632506 5:143915532-143915554 TTGTCTCCCCACTGTAGGCTGGG - Intergenic
998647851 5:144083755-144083777 CAGTCTCTCTACTCAAGCCCTGG + Intergenic
998830593 5:146154206-146154228 TAGCCTCTACACTCTAGCCTTGG - Intronic
1005711148 6:28503791-28503813 TAGCCTCTCTCCTCTAAGATAGG - Exonic
1006995093 6:38252111-38252133 TAGTCTCTCTGCTCCAGGAGTGG - Intronic
1008177873 6:48290350-48290372 TTGAGTATCTACTCTAGGCTGGG - Intergenic
1011334407 6:86244169-86244191 TAGTCTCTCTCCTCAAGCATTGG + Intergenic
1013465442 6:110413814-110413836 TCGTCGCTGTACTCCAGGCTGGG - Intronic
1016699438 6:147037711-147037733 TAGCCTCTGCACTCTAGCCTGGG + Intergenic
1016943224 6:149501951-149501973 TAGCCTCTGTACTCCAGCCTGGG - Intergenic
1018442601 6:163826715-163826737 TATTCTCACTGCTGTAGGCTCGG + Intergenic
1023276059 7:38519712-38519734 TAGTCTCTGTAGTCCAGGTTAGG + Intronic
1029085506 7:98008593-98008615 TAGCCACTGTACTCTAGCCTGGG + Intergenic
1029148302 7:98462510-98462532 GTGCCACTCTACTCTAGGCTGGG - Intergenic
1031086393 7:117305702-117305724 TAGTCACTGCACTCTAGCCTGGG - Intronic
1032108993 7:129059232-129059254 CAATCTCTCTACTCTGGGTTAGG - Intergenic
1038354792 8:26817733-26817755 TTGTCTCTGTACTCCAGCCTGGG + Intronic
1039800942 8:40953849-40953871 GATCCTCTCTACTTTAGGCTGGG + Intergenic
1042368087 8:67959479-67959501 TTGTCTCTCTACCCTTGGCTAGG - Intronic
1043544387 8:81298793-81298815 AAGTCCCTCCACTCTGGGCTTGG - Intergenic
1044818781 8:96141355-96141377 TTGGCTCTCTACTCTTTGCTGGG - Intergenic
1046012681 8:108569352-108569374 GAGCCTCTGTACTCTAGCCTGGG + Intergenic
1046056437 8:109084251-109084273 TAATCTCTGTCCTCTAGGCCAGG + Intergenic
1047500389 8:125436008-125436030 TAGACTTTCTAGTCTAAGCTGGG - Exonic
1053066753 9:35074502-35074524 AAGACTCTGTACTCTGGGCTGGG - Intronic
1054909663 9:70442662-70442684 TAGTCACTGCACTCTAGCCTGGG + Intergenic
1061143708 9:128784523-128784545 CAGTCTCTCTGTTCTTGGCTGGG - Intergenic
1061592356 9:131606029-131606051 AAGTCACTGTACTCCAGGCTGGG + Intronic
1186186652 X:7026898-7026920 GATTCTCTCTCCTCTAGGATTGG + Intergenic
1189972742 X:46434526-46434548 TGGTCTCTCTACTCTGGGGAGGG - Intergenic
1193950959 X:87797668-87797690 TAGTCTGTGTAGTCAAGGCTAGG - Intergenic
1196215427 X:113045965-113045987 TAGTCTTTCTACTCAAGACAAGG + Intergenic
1200706013 Y:6443146-6443168 TAGTCTCATTACCCTAGGATAGG - Intergenic
1200849010 Y:7863297-7863319 CAGTATCTCTGCTGTAGGCTGGG + Intergenic
1201020115 Y:9647546-9647568 TTCTCTCTCTAATCTAGGCTAGG - Intergenic
1201028097 Y:9721562-9721584 TAGTCTCATTACCCTAGGATAGG + Intergenic
1201562123 Y:15328728-15328750 GATTCTCTCTCCTCTAGGATTGG + Intergenic