ID: 1086178941

View in Genome Browser
Species Human (GRCh38)
Location 11:83926692-83926714
Sequence TTCCACAACATTACTAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086178938_1086178941 22 Left 1086178938 11:83926647-83926669 CCATGAGGTGTAATAAGACGTAG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1086178941 11:83926692-83926714 TTCCACAACATTACTAGAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086178941 Original CRISPR TTCCACAACATTACTAGAGT TGG Intronic
909230989 1:73089771-73089793 GTCCATCACATTACTAGACTGGG - Intergenic
909885390 1:80935827-80935849 TTCAACAACATTGCTAGGGATGG - Intergenic
910166703 1:84336088-84336110 TTCCCCAACCTTGCTAGAGAGGG - Intronic
915150036 1:153823370-153823392 TTCTAAAACATTAGTAGTGTTGG + Intronic
915201877 1:154236107-154236129 TTACACATCAGTAATAGAGTAGG - Intronic
921129825 1:212210086-212210108 ATTCTCAACATTCCTAGAGTTGG - Intergenic
1063235579 10:4112102-4112124 TTCCATACCATTACTTAAGTGGG - Intergenic
1065206204 10:23360055-23360077 TTACACAGCAGTACTAGAATCGG + Intergenic
1068103819 10:52590192-52590214 AACCACAACATTACTGGACTTGG - Intergenic
1073979808 10:109141946-109141968 TTCCACAGGATCCCTAGAGTAGG - Intergenic
1075243158 10:120796669-120796691 TTCAAAAACATTTCTAGATTTGG + Intergenic
1075668712 10:124248500-124248522 TTTCACAACACCACTGGAGTGGG + Intergenic
1079423831 11:20320850-20320872 TACCACATCATTACTATATTTGG - Intergenic
1081470677 11:43367275-43367297 TAACACAACATGACTACAGTAGG - Intronic
1085571986 11:77568026-77568048 AGCCACAACATTACTGGACTTGG - Intronic
1086178941 11:83926692-83926714 TTCCACAACATTACTAGAGTTGG + Intronic
1090776210 11:129968355-129968377 TTCCATAGCATGTCTAGAGTTGG - Intronic
1093345410 12:18034736-18034758 TTCCACAACCTTATTAGGGAGGG + Intergenic
1099728608 12:86467957-86467979 TTCCACATCATTAATAATGTTGG + Intronic
1100325630 12:93537415-93537437 TTCCAGAAAATTACCAGAATTGG - Intergenic
1100922818 12:99508314-99508336 TTCCCCATCACTACTAGAATAGG - Intronic
1106644667 13:31619239-31619261 TGCCCCACCATTATTAGAGTTGG - Intergenic
1110954117 13:81531934-81531956 TTAGAGAAAATTACTAGAGTGGG - Intergenic
1111749793 13:92314587-92314609 TCCCACAACATGACTGGAATTGG - Intronic
1113023609 13:105916847-105916869 TTCCACAACAATGCTGGGGTAGG - Intergenic
1115745743 14:36435613-36435635 TTTCCCAGCATTCCTAGAGTGGG + Intergenic
1115981452 14:39056301-39056323 TCCCACAACATTAGTAGAGAGGG + Intronic
1116182047 14:41547136-41547158 TCCCCCAACATGACAAGAGTAGG + Intergenic
1117904165 14:60566929-60566951 TTCCACACTACTACTTGAGTAGG - Intergenic
1118549291 14:66932078-66932100 ACTCACAGCATTACTAGAGTTGG - Intronic
1120010113 14:79404242-79404264 TTCAACAAATTTACAAGAGTAGG + Intronic
1129772203 15:78209409-78209431 TTCCACAACCTCCCTGGAGTGGG - Intronic
1131611781 15:93972348-93972370 TTCCACAACATTACTTCTGATGG + Intergenic
1135467975 16:22703553-22703575 TTCCTCAACATCAAAAGAGTTGG + Intergenic
1138699802 16:58850543-58850565 TTTGACAACATTACCAGAGATGG + Intergenic
1140673368 16:77301507-77301529 TTCCACAAGATTCATGGAGTGGG - Intronic
1143820466 17:9557395-9557417 TTCCACCTCTTTTCTAGAGTGGG - Intronic
1144137622 17:12313522-12313544 TTCCCCAACCTCACTAGAGAGGG - Intergenic
1149054482 17:52346890-52346912 TTCCTGAACATTACTATATTTGG + Intergenic
1150261898 17:63800196-63800218 TTCCACAGCCTTCCTGGAGTGGG - Intronic
1164486066 19:28656814-28656836 TCCCACCACAGGACTAGAGTGGG + Intergenic
927300798 2:21511822-21511844 TTCCACAAAATTACTAAATATGG + Intergenic
930676589 2:54207787-54207809 TTCCAGAACATTTTTTGAGTCGG + Intronic
931215909 2:60244459-60244481 TTCCATGTCATTACTAGAGTGGG - Intergenic
931473424 2:62563594-62563616 TTCCTCAACTTTTTTAGAGTTGG - Intergenic
932075163 2:68655900-68655922 TTCCACAAAAGAACTGGAGTAGG + Intergenic
934169533 2:89328846-89328868 TTCCACCATAATACTAGAGAGGG + Intergenic
934197759 2:89853739-89853761 TTCCACCATAATACTAGAGAGGG - Intergenic
935750976 2:106233434-106233456 TTGTACAGCATTGCTAGAGTGGG + Intergenic
937299281 2:120829301-120829323 TTCCACATCATTTACAGAGTGGG + Intronic
939853391 2:147327043-147327065 TGCCACAACATTAATGAAGTTGG + Intergenic
941867684 2:170351595-170351617 AACCATAACATTACTAGAATAGG + Intronic
942132843 2:172897996-172898018 TTTCACAACATCACTGGGGTGGG + Intronic
946696512 2:222365380-222365402 TTCCACCAGATCACTACAGTGGG + Intergenic
1184459477 22:44628804-44628826 TTCAACAGCATTACTTGTGTAGG - Intergenic
1184789484 22:46690701-46690723 TCCCCCAACATGACTAGACTCGG + Intronic
953527155 3:43701592-43701614 TTCTAGGAGATTACTAGAGTTGG + Intronic
958493211 3:94805340-94805362 TTCCAAAACATTACTAGGATGGG - Intergenic
959243731 3:103835018-103835040 TTCTACAACTTTACTAAATTTGG - Intergenic
964458827 3:156898239-156898261 TGGCATAACATTACTAGAGAAGG - Intronic
966940956 3:184746746-184746768 TTCCAGTGCATTACTGGAGTAGG - Intergenic
967677611 3:192318013-192318035 ACCCACAACATTACTAGGCTTGG + Intronic
970720816 4:18986942-18986964 TTCCACCACGTTACTAGTGGAGG + Intergenic
975912303 4:79281313-79281335 TGCCACATCATTTCTACAGTTGG - Intronic
976756551 4:88504531-88504553 TTCCAAAACATCACTATGGTGGG - Exonic
977690540 4:99903634-99903656 TTCCAGAACATTCCTTGAATAGG + Intronic
979765239 4:124457108-124457130 TACCACAACTTTACTACACTGGG + Intergenic
980218440 4:129881342-129881364 TTCCATAGCATTTCTAGAGCTGG + Intergenic
987752018 5:22052259-22052281 TCCCACAACATTAAAAGAATGGG + Intronic
991210066 5:64093809-64093831 TTCCATAATATTACTAGGCTTGG + Intergenic
994293094 5:98053053-98053075 TTCCAAAAAATTAACAGAGTAGG + Intergenic
995622333 5:114039851-114039873 TTCCATCACAAGACTAGAGTGGG - Intergenic
996927066 5:128840260-128840282 TTCCACAGCATTCCCAGAGCTGG - Intronic
998442037 5:142170755-142170777 TTCCACAACATAACTTGATGGGG - Intergenic
999975197 5:156905365-156905387 TTACACAAAATTTCTAGAATAGG - Intergenic
1001191377 5:169635934-169635956 TTCCACCAGATGACCAGAGTAGG - Intergenic
1001389559 5:171367890-171367912 TTCCACATCTTTAGTAGAGACGG + Intergenic
1009704035 6:67221509-67221531 TTTCCCAACATTGCTAGAGAGGG + Intergenic
1009778086 6:68232259-68232281 TTCCTCTCCATTACAAGAGTAGG - Intergenic
1014321286 6:119930959-119930981 CTCCAAAACATTGCTATAGTGGG + Intergenic
1022603569 7:31785468-31785490 TTCCAAAAAATGACTAGGGTGGG + Intronic
1025833387 7:65074586-65074608 TTCCACAAGATTTATATAGTTGG + Intergenic
1025903150 7:65764095-65764117 TTCCACAAGATTTATATAGTTGG + Intergenic
1026379768 7:69787742-69787764 TCCCCCAACTTTACTAGAGATGG + Intronic
1027299576 7:76816958-76816980 TTCCCCAACCTCACTAGAGAGGG - Intergenic
1027710958 7:81600802-81600824 TTAGACAACATTGCTAGATTAGG + Intergenic
1028297864 7:89157996-89158018 TTCCAAAACATTAGAAGAATAGG - Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1039974847 8:42353757-42353779 CTCCACTACTTTATTAGAGTGGG + Intronic
1042027755 8:64442229-64442251 TTCCAGATCCTTACTAGAGATGG + Intergenic
1045417187 8:101979121-101979143 TTCCAGAAGATTCCAAGAGTGGG + Intronic
1047031308 8:120884362-120884384 TGTCACAACATTATTTGAGTTGG - Intergenic
1048109796 8:131455187-131455209 TTCCCCAACCTTGCTAGAGAGGG + Intergenic
1051020858 9:12540954-12540976 ATCCACAACATTCCTGTAGTGGG - Intergenic
1054991098 9:71327951-71327973 CTCCACACCATTACTGGACTGGG + Intronic
1187046308 X:15650826-15650848 TCCCACAACATTGCTACTGTGGG - Intronic
1187052569 X:15709355-15709377 TCCCACAACATTCCTACTGTGGG - Intronic
1190579555 X:51878598-51878620 TTCCACAATTTTAATAAAGTTGG - Intronic
1195596530 X:106697515-106697537 TTGCACAACAGTACGAGGGTGGG - Intronic
1197427071 X:126310542-126310564 TTCCAGAACACTACTAGAAAAGG + Intergenic
1199189576 X:144953846-144953868 ATCCACAACATTACTAAACTTGG + Intergenic
1199917112 X:152355235-152355257 TTCCACACTACTAATAGAGTAGG - Intronic
1201669992 Y:16509118-16509140 TGCCACAACATGACTAGACCAGG + Intergenic