ID: 1086179526

View in Genome Browser
Species Human (GRCh38)
Location 11:83933790-83933812
Sequence CCTTGCAACCATGATCTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086179514_1086179526 27 Left 1086179514 11:83933740-83933762 CCTCCCTAAACAAAGCAGTTTAG 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1086179526 11:83933790-83933812 CCTTGCAACCATGATCTGTATGG 0: 1
1: 0
2: 0
3: 5
4: 91
1086179515_1086179526 24 Left 1086179515 11:83933743-83933765 CCCTAAACAAAGCAGTTTAGACC 0: 1
1: 0
2: 3
3: 9
4: 160
Right 1086179526 11:83933790-83933812 CCTTGCAACCATGATCTGTATGG 0: 1
1: 0
2: 0
3: 5
4: 91
1086179521_1086179526 3 Left 1086179521 11:83933764-83933786 CCATTGGATTAGGATTGGGCCCC 0: 1
1: 0
2: 1
3: 2
4: 78
Right 1086179526 11:83933790-83933812 CCTTGCAACCATGATCTGTATGG 0: 1
1: 0
2: 0
3: 5
4: 91
1086179516_1086179526 23 Left 1086179516 11:83933744-83933766 CCTAAACAAAGCAGTTTAGACCA 0: 1
1: 1
2: 3
3: 71
4: 4152
Right 1086179526 11:83933790-83933812 CCTTGCAACCATGATCTGTATGG 0: 1
1: 0
2: 0
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086179526 Original CRISPR CCTTGCAACCATGATCTGTA TGG Intronic
906073819 1:43036733-43036755 CCAGGCAACAATGATCTGCAGGG + Intergenic
914980153 1:152408336-152408358 CCTTAGAACCAGCATCTGTAGGG + Intergenic
916066440 1:161139814-161139836 CATTAAAACAATGATCTGTAAGG - Intergenic
916701634 1:167301715-167301737 CCTCCCAACCAGGAACTGTAAGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
919410499 1:197236162-197236184 CCATGCAGTTATGATCTGTATGG + Intergenic
920855903 1:209661498-209661520 CCTTGCTGCCATGATCTTTAAGG - Intergenic
1065445565 10:25795014-25795036 ACTTCAAACCATGATCTGTAAGG + Intergenic
1067168923 10:43888731-43888753 TTTTGCAACCATGAACTCTAAGG - Intergenic
1067578220 10:47420943-47420965 CCTTGCACCCAGGATCTGCCCGG + Intergenic
1073334865 10:102698983-102699005 ACTGGAAACCATGATGTGTAAGG - Intronic
1080709080 11:34728885-34728907 CCTAATATCCATGATCTGTAAGG - Intergenic
1086179526 11:83933790-83933812 CCTTGCAACCATGATCTGTATGG + Intronic
1089467400 11:118694200-118694222 CCTGGCCACCCTGAACTGTAGGG - Intergenic
1091214144 11:133890172-133890194 CCCTTCAGCCATGATCTGCAAGG + Intergenic
1092008155 12:5087012-5087034 CCTTGCATCCTTGATCTATCTGG - Intergenic
1093212892 12:16328599-16328621 AGTTGCTACCCTGATCTGTATGG + Intergenic
1095793924 12:46196545-46196567 CCTTCCAAGCCTTATCTGTAGGG - Intronic
1096912577 12:54998865-54998887 CCTTGAAACAGTGTTCTGTAAGG - Intergenic
1097381112 12:58896561-58896583 CCTTGCAGCTGTGATGTGTAAGG + Intronic
1102862207 12:116345672-116345694 CCTTGCAAACATGTTTTGTTGGG + Intergenic
1103796387 12:123506114-123506136 CCCTGCACCCATGGTCTGCATGG - Intronic
1106847211 13:33749168-33749190 CCCTGCAACCATGATCTCCTGGG + Intergenic
1111582009 13:90234640-90234662 GCTTGCAAGCATGTTGTGTATGG + Intergenic
1111800781 13:92977894-92977916 ACTTTCAACCATGGTCTGTTTGG + Intergenic
1118080043 14:62348171-62348193 CCTCGCAGCCATCCTCTGTAAGG - Intergenic
1120562749 14:86017334-86017356 CCTTGGTTCCCTGATCTGTAGGG - Intergenic
1121325010 14:93014777-93014799 ACTTGCTCCCATGAGCTGTAAGG - Intronic
1122423658 14:101592792-101592814 CCTTGGATCCTTGGTCTGTAGGG + Intergenic
1128665971 15:69538707-69538729 CCTTGCAACAAGCATCTGTAGGG - Intergenic
1133652304 16:7823902-7823924 TCTTGCAAACATGATCACTAAGG + Intergenic
1138650581 16:58458731-58458753 CCTTTCTCCCATGATATGTAAGG - Intergenic
1148026797 17:44594267-44594289 GCTTACAACCATGATCTACAGGG + Intergenic
1151171629 17:72251356-72251378 TCATGCATACATGATCTGTATGG + Intergenic
1152219034 17:79050823-79050845 CCCTGCAATCCTGCTCTGTACGG + Intergenic
1153968062 18:10199919-10199941 ACTTGCACCCATGATCAGGATGG + Intergenic
1154073891 18:11180043-11180065 CCTTGCAACTATGAGCTTTAAGG - Intergenic
1154407873 18:14111902-14111924 ACTTCCAACCTTGTTCTGTAAGG + Intronic
1157093112 18:44659960-44659982 CCTTTCAACCATGAAATGTCAGG + Intergenic
930421426 2:51157815-51157837 CATTGCAACCTTCATCTGTTTGG - Intergenic
933879037 2:86649472-86649494 CCTTGCTATCATGATTTGTTAGG - Intronic
935222323 2:101026377-101026399 ACTTGCAAACATGATGTGTACGG + Intronic
937425957 2:121798571-121798593 CATTGCAACCATGAGCTCTGGGG - Intergenic
942000190 2:171638730-171638752 CTTTTGAACCAGGATCTGTAGGG + Intergenic
944140339 2:196449248-196449270 CCTTGAAACTATGAGTTGTATGG + Intronic
947711480 2:232318859-232318881 CCTTCTATCCATGATCTTTAGGG - Intronic
1175814651 20:61877173-61877195 CCGAGCTGCCATGATCTGTAGGG - Intronic
1179271468 21:39854323-39854345 CCTGGCATCCCTGATCTCTAGGG - Intergenic
1184670350 22:46009039-46009061 CCTTTCAACCATTATCTGGGTGG - Intergenic
1184923682 22:47623229-47623251 CCTTGCATGCATGATATGGAAGG + Intergenic
952101610 3:30019538-30019560 CCTTTCAACCAGGATCTATCTGG - Intergenic
954939806 3:54361352-54361374 CATTGCCAGCATGATCTGTCTGG + Intronic
957421535 3:79977919-79977941 CTTTGCTACCATATTCTGTATGG + Intergenic
958668076 3:97165898-97165920 CATTGCAAACTTGATTTGTAGGG - Intronic
961325674 3:126107813-126107835 CCTGGCAACCAGGGCCTGTAGGG - Intronic
962376020 3:134859288-134859310 CCTTGCAAACATGATCTCAGGGG + Intronic
964978822 3:162652843-162652865 CCTTACAACCTTTATTTGTAAGG + Intergenic
969262217 4:6041189-6041211 CCCTGCAAGCATGATCTCTCCGG + Intronic
972786050 4:42327627-42327649 CCTGAGAGCCATGATCTGTAAGG - Intergenic
976208359 4:82642931-82642953 CCTTGCAGCCATGTCCTTTAGGG + Intronic
976843587 4:89460826-89460848 CTTTGCAAACATCATTTGTAAGG + Intergenic
978581420 4:110235516-110235538 CCTTGGAAACATGAACTGGAAGG - Intergenic
978862068 4:113461952-113461974 CCTTGCCCCCATCATCTTTAAGG - Intronic
980236291 4:130111225-130111247 CCTTGCAATCAGGTTCTGTGGGG + Intergenic
982059215 4:151586143-151586165 CATTGGAACCATGAGCTTTATGG - Intronic
982099020 4:151950344-151950366 TCTTGCCACCATGACCTCTATGG + Intergenic
982449483 4:155535222-155535244 CCTTGCACACATGAGTTGTATGG - Intergenic
991473346 5:66993571-66993593 TCTTTCAAGCATGAGCTGTAAGG - Intronic
992077328 5:73203430-73203452 CCTTGCCACCCTGAGCTGCAGGG + Intergenic
994731854 5:103500817-103500839 TCTTGCATCTATGCTCTGTAAGG - Intergenic
995682994 5:114741573-114741595 ACTGGCAACCATCATCTGAAAGG + Intergenic
1000950938 5:167482325-167482347 CTTTGCAAACGTGATTTGTATGG + Intronic
1001640063 5:173237656-173237678 CCTTGCCACCTTGATTTGCAAGG - Intergenic
1002795780 6:470229-470251 CCTTGCAGCCTTGACCTGTGGGG + Intergenic
1008135708 6:47774498-47774520 CATCGCTAACATGATCTGTATGG + Intergenic
1008910823 6:56730731-56730753 CCTAGAAACCATGATTTGCAAGG + Intronic
1012226636 6:96711330-96711352 AGTTGCAACCATGTTCTGTTGGG + Intergenic
1012900421 6:104999213-104999235 CATTGCAACCTTGAACTCTAAGG + Intronic
1016063060 6:139650283-139650305 ACTTGTTACCATGACCTGTAAGG + Intergenic
1019623250 7:2002812-2002834 CCCTGCACCCATGACCTGCACGG + Intronic
1022112987 7:27242935-27242957 TCTTGCAACCAAGATCCGTCCGG + Exonic
1023082137 7:36535830-36535852 CCTCTCAGCCATGATCTGTGAGG - Intronic
1026836580 7:73643677-73643699 CCTTGCAAACATCATGTGTCAGG + Intergenic
1026959831 7:74400976-74400998 CCTAGGAACCTTGATCTGAAGGG + Intronic
1027433529 7:78139611-78139633 CCTTGCAGACATCATCTGTCAGG + Intronic
1027881342 7:83842298-83842320 CCTTGCTGCCATAATCAGTAGGG + Intergenic
1029563480 7:101319717-101319739 CACTGCAGCCTTGATCTGTAGGG + Intronic
1032879791 7:136076984-136077006 CCTTGCAGCATTGAACTGTAGGG + Intergenic
1039268825 8:35858110-35858132 GCTTGCAACTGTGTTCTGTAGGG + Intergenic
1043809913 8:84726370-84726392 ATTTTCAACCATTATCTGTAAGG - Intronic
1045618586 8:103947954-103947976 ACTTGCATCCATGATATATAAGG + Intronic
1048538410 8:135319249-135319271 CCTTTCCTGCATGATCTGTATGG - Intergenic
1055103777 9:72492142-72492164 CTTTGCAGCCAGGATCTCTAAGG - Intergenic
1058172324 9:101697302-101697324 ACTTTCAACCATGATTTGAAAGG - Intronic
1186460302 X:9743133-9743155 CACTGCAACCTTGATCTTTAGGG - Intronic
1187875592 X:23801052-23801074 CCTGGCAACCCTTAGCTGTAAGG + Intergenic
1199334386 X:146601008-146601030 TCTTGGAACCAGGATATGTACGG + Intergenic