ID: 1086181959

View in Genome Browser
Species Human (GRCh38)
Location 11:83962979-83963001
Sequence CATTGTTGCCAGAGAGTAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086181956_1086181959 20 Left 1086181956 11:83962936-83962958 CCTGGAGAGATGGGTGGCAGGGA 0: 1
1: 1
2: 6
3: 46
4: 639
Right 1086181959 11:83962979-83963001 CATTGTTGCCAGAGAGTAGATGG 0: 1
1: 0
2: 3
3: 20
4: 204
1086181953_1086181959 24 Left 1086181953 11:83962932-83962954 CCTTCCTGGAGAGATGGGTGGCA 0: 1
1: 0
2: 3
3: 24
4: 216
Right 1086181959 11:83962979-83963001 CATTGTTGCCAGAGAGTAGATGG 0: 1
1: 0
2: 3
3: 20
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086181959 Original CRISPR CATTGTTGCCAGAGAGTAGA TGG Exonic
901557898 1:10046089-10046111 CATTCTGGCCAGAGAGGGGAGGG + Intronic
904480614 1:30791113-30791135 CATTGCAGCCAGAGAGAAGCAGG - Intergenic
904921701 1:34013310-34013332 CATGGGTGCCAGGGAGCAGATGG - Intronic
907495597 1:54842136-54842158 CATGGGGGCCAGAGAGCAGATGG + Exonic
908079678 1:60562746-60562768 CATTTCTGCCAGAGAGAAGAAGG + Intergenic
909196244 1:72628167-72628189 CAGTGCTCCCAGAGAATAGAAGG - Intergenic
909900865 1:81133053-81133075 CATTCTTGAAAGAGAGAAGAAGG - Intergenic
910375591 1:86566282-86566304 CATTGTTGGGAAACAGTAGAAGG - Intronic
912673538 1:111654096-111654118 AATTCTTGCCTGAGACTAGAAGG - Intronic
913331826 1:117674088-117674110 CACTGTTGTCAGAGGGTAAAGGG - Intergenic
914778139 1:150757390-150757412 CACTGTTGCCAAAGTGAAGAAGG - Intronic
915445468 1:155972176-155972198 CATTGATGCCAGAGAGAGGAAGG - Intronic
920222978 1:204417669-204417691 GAGTTTTGCCAGGGAGTAGAAGG - Intergenic
920805238 1:209227473-209227495 CATTATTGGCAAAGACTAGAAGG - Intergenic
921898693 1:220427703-220427725 AATTGTTTCCAGAGACTAGAAGG + Intergenic
922568943 1:226620958-226620980 CAATTTTTCCAGAAAGTAGAAGG - Intergenic
922789255 1:228301418-228301440 CATTATAACCAGAGGGTAGAGGG - Intronic
922946355 1:229519134-229519156 CATGGCTGCTAAAGAGTAGAGGG + Intronic
922982407 1:229838758-229838780 CATTGTTTCCAGAGGGGCGAGGG - Intergenic
923295350 1:232589708-232589730 AGTTGTTGACAGAGAGTTGAGGG - Intergenic
923851231 1:237797430-237797452 CATTGTGGCCAGAGAGTTGAAGG + Intronic
1063767936 10:9163844-9163866 GATTTTTGCTAGAGAGTAAATGG + Intergenic
1067271874 10:44798734-44798756 CAGTCTTGCCAGAGAGTAAAGGG + Intergenic
1069643770 10:69975754-69975776 CATTGTTGCCAGTGAGAATGTGG - Intergenic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1070036347 10:72728934-72728956 CTATGTTTCCAGTGAGTAGAGGG + Intronic
1071725599 10:88195438-88195460 CATTGTTGCCAGGCAATGGAGGG - Intergenic
1073599049 10:104828952-104828974 CATTGCTCCCAGAAAGGAGAGGG + Intronic
1077782154 11:5342828-5342850 CATTGCCTCCAGAGAGGAGAGGG - Exonic
1078154645 11:8788773-8788795 AATTGTGGTCAGACAGTAGAGGG - Intronic
1079023471 11:16926980-16927002 CACTGATACCAGAGAGTGGAAGG - Intronic
1085065097 11:73488016-73488038 CAGTGTTGGCAGAGAGTAGACGG - Intronic
1085750536 11:79157093-79157115 AATTGTAGTCAGAGAGGAGATGG + Intronic
1085840940 11:80011320-80011342 CCTTGTTGCCAGACACTATATGG - Intergenic
1086181959 11:83962979-83963001 CATTGTTGCCAGAGAGTAGATGG + Exonic
1089417947 11:118308320-118308342 CATTGTTTCCTAAGAGTTGAGGG + Intronic
1089904446 11:122024020-122024042 GATGGTTGCCAGAGACTGGAAGG + Intergenic
1090660025 11:128875580-128875602 CATGGAGGCCAGAGAGTAAAGGG + Intergenic
1091143862 11:133260207-133260229 CATTGGGGCCAGTGAGTGGAGGG + Intronic
1091996826 12:5000464-5000486 CATCGTTACCAGAGAGGTGAGGG - Intergenic
1092306896 12:7310618-7310640 CATTGTGGCCAGTGAGGAGGTGG + Exonic
1092959129 12:13579190-13579212 TATTGTTGCCAGAGCCTAGCAGG + Intronic
1093056801 12:14564128-14564150 CATTGCAGCCTCAGAGTAGATGG - Intronic
1093698083 12:22185662-22185684 AGTGGTTGCCAGAGAGTAGGTGG + Intronic
1095170605 12:39031036-39031058 TATTGTTGACAGAGAGAAGAGGG + Intergenic
1098443159 12:70538952-70538974 CACTCTTGCCGGAGAATAGAGGG - Exonic
1099991439 12:89726361-89726383 CAGTGTTGTCAAAGATTAGATGG - Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1105777453 13:23676920-23676942 TATTTTTGTCAGAGAGTTGATGG - Intergenic
1109135905 13:58650288-58650310 CATTGTTGAAGGAAAGTAGAAGG + Intergenic
1111217652 13:85164934-85164956 CTTTGTTGCCATAAAGAAGAGGG + Intergenic
1115782676 14:36786922-36786944 CATAATTGCCAGAGAGGTGAGGG - Intronic
1119683096 14:76607433-76607455 GATTGTTGGCAGAGAGGAGCAGG - Intergenic
1119749815 14:77069103-77069125 CATTTTTGCCACTGAGTAAAGGG + Intergenic
1121153777 14:91664112-91664134 CGTGGTTGCCAGGGATTAGAGGG - Intronic
1124176144 15:27425965-27425987 CATTGTAGCCAGATGGGAGAGGG - Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126819742 15:52490604-52490626 AATGGTTGCCAGGGACTAGAGGG + Intronic
1128373109 15:67055220-67055242 CATTGTTGTCAGGAAGTAGAAGG - Intergenic
1128877256 15:71212638-71212660 CATTGTTGCTAGAAAACAGAAGG - Intronic
1131659736 15:94501029-94501051 CATTGTTTCCAGGGGCTAGAGGG - Intergenic
1132013860 15:98299268-98299290 CATAGTTGGCAGCGAGTAGCAGG - Intergenic
1132076057 15:98821495-98821517 CATTTTTGGAAGAGAGTCGAAGG + Intronic
1133367068 16:5218448-5218470 CTTTGTTGCCAGAAAGAAAATGG + Intergenic
1134571290 16:15293313-15293335 CATGGTTGCAAGAGAGCACATGG + Intergenic
1134731092 16:16462732-16462754 CATGGTTGCAAGAGAGCACATGG - Intergenic
1134936338 16:18249158-18249180 CATGGTTGCAAGAGAGCACATGG + Intergenic
1135231403 16:20711552-20711574 CATTGTGGCCAGTGAGGAGGTGG + Intronic
1135896369 16:26408327-26408349 AATAGTTGCCAGAGATTTGAGGG + Intergenic
1137455560 16:48615232-48615254 CATGGTTGTCAGAGAGATGATGG - Intronic
1138013835 16:53411830-53411852 CATTGTTGCCAGAGATTTGGAGG + Intergenic
1138521215 16:57572072-57572094 AATTGTTTCCTGAGAGGAGAGGG - Intronic
1140633542 16:76883280-76883302 CATTGATTCCAGAGAGTATATGG - Intergenic
1143490881 17:7284648-7284670 CATTGATGCCAGAGAGCTGCTGG - Exonic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1151922212 17:77165493-77165515 CATTTTTCTCAGTGAGTAGAGGG + Intronic
1153124997 18:1780292-1780314 CTTCTTTGCCAGAGAGTTGACGG - Intergenic
1155128106 18:22900872-22900894 CTTTGTTGCCAGAGATCACAAGG + Intronic
1155985139 18:32222304-32222326 AATGGTTGCCAGAGAATAAACGG - Intronic
1156890985 18:42189059-42189081 AGTGGTTGCCACAGAGTAGAGGG - Intergenic
1159090770 18:63846205-63846227 CATTTTTGCCTCAGAGAAGATGG + Intergenic
1159547755 18:69861711-69861733 CATAGGTGCAAAAGAGTAGAGGG + Exonic
1162310030 19:9900882-9900904 CCTTGTTTCAAGAGAGGAGAGGG + Intronic
1162855887 19:13468391-13468413 CACTATTGCCAGAGAGGAAAAGG - Intronic
1163015959 19:14454713-14454735 GATGGATGCCAGGGAGTAGAGGG + Intronic
1163322155 19:16581172-16581194 CGTTGTTGCCAAAGAGCAAATGG - Intronic
1164149757 19:22540997-22541019 CATGGTTGGCTGCGAGTAGACGG + Intergenic
1164293649 19:23889717-23889739 CATTCTTCCCATAGAGAAGATGG + Intergenic
1166335537 19:42104432-42104454 CATTCTGGCAAAAGAGTAGAAGG + Intronic
1167018448 19:46857049-46857071 CATGGTAGCCAGAGACTACATGG - Intergenic
926170921 2:10552197-10552219 AATTGTTGCCAGAACCTAGAGGG + Intergenic
928823641 2:35392247-35392269 CAGTTGTGCCAGAGAGTATAGGG + Intergenic
929168463 2:38907072-38907094 CTTGGTTGACAGAGAGCAGAGGG + Intronic
929535658 2:42782671-42782693 CATTTATGCCAGTGAGCAGAGGG - Intronic
930619456 2:53628774-53628796 CATTGTTCTTAGAGACTAGAGGG + Intronic
932598162 2:73107029-73107051 AATGGTGGCCAGAGAGGAGAGGG - Intronic
933805061 2:85992759-85992781 GGTTGTGGGCAGAGAGTAGATGG - Intergenic
933835249 2:86240602-86240624 CTTTGGTGCCAGTGAGTAAAAGG + Intronic
940281115 2:151990493-151990515 CATTGTTGCCTGAGTGAGGAGGG - Intronic
940584789 2:155633198-155633220 CTTTGTTCCCAGCAAGTAGATGG + Intergenic
942776229 2:179585783-179585805 CAGTGTAGCCATCGAGTAGAAGG - Intronic
946167604 2:217874600-217874622 GATGGTTCCCAGAGAGTAGAGGG + Intronic
946814207 2:223558974-223558996 AATTGTTGCCAGAGGCTGGAGGG + Intergenic
947183812 2:227436720-227436742 AATGATTGCCAGAGAGAAGAGGG - Intergenic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
1168916153 20:1490057-1490079 GATTGTTGCAATAGAATAGATGG - Intronic
1169109482 20:3022668-3022690 CACTGTAGCCAGAGAGCAGGGGG - Exonic
1170120732 20:12908982-12909004 CCTTATTGCAAGAGAATAGAAGG - Intergenic
1170787243 20:19478217-19478239 CATTTCTCCCAGGGAGTAGAGGG - Intronic
1170942144 20:20857181-20857203 CATTTTTGCCAAAGAAAAGAAGG + Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1172397471 20:34619081-34619103 CCTAGTTGACAGAAAGTAGAAGG + Intronic
1173783908 20:45778486-45778508 CCTTGTTGCAAGAGAGTATGGGG - Intronic
1176967179 21:15224475-15224497 AATTCTTGGCAGAGAGTAGAGGG + Intergenic
1177842465 21:26249719-26249741 CTTGATTGCCAGAAAGTAGATGG - Intergenic
1184393998 22:44221922-44221944 CATTGCAGGCAGAGAGGAGAGGG - Intergenic
1184570516 22:45321249-45321271 CATTTTTAAAAGAGAGTAGAGGG + Intronic
1184971358 22:48023222-48023244 CATTGCTGCCAGATATTAAAAGG + Intergenic
954792569 3:53144076-53144098 CACTGAAGCCAGAGAGAAGAGGG - Intergenic
954821226 3:53329990-53330012 CATTGTTGGGAAAGAGTATATGG - Intronic
955772827 3:62403557-62403579 CTTTGGTGCCAGAGAGATGAGGG + Intronic
955963974 3:64369096-64369118 CATTGTTGGCACAGGGCAGAGGG - Intronic
958491882 3:94785762-94785784 CATTGCTGCCATAGAGTAGGTGG - Intergenic
962288380 3:134107412-134107434 CAGTGTTGCCAGAGAAAAGGAGG - Intronic
964006386 3:151834406-151834428 CATCTTTCCTAGAGAGTAGAAGG + Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
964779082 3:160315283-160315305 CATTGTCTCCAGTGAGCAGAGGG + Intronic
965946228 3:174245014-174245036 AATTGTTGCTAGAAATTAGAGGG + Intronic
966058874 3:175731720-175731742 CTTTGTTGCCAGAAGGTAGTTGG + Intronic
966828690 3:183987569-183987591 CAGTGTTGCCAGAGAAGAAATGG - Intronic
967358119 3:188596392-188596414 CACTTTTGCCACAGAGTAGGAGG - Intronic
967787836 3:193516499-193516521 CATTGCTGCCAGTGTGTTGAGGG - Intronic
969338230 4:6524372-6524394 CATGGTTGCCAGGGACTAGAAGG + Intronic
970024954 4:11613873-11613895 AATTGATGGCAGAGATTAGAGGG + Intergenic
970380132 4:15499086-15499108 AGTGGTTGCCAGAAAGTAGAGGG + Intronic
971257382 4:25027887-25027909 CATTGCTCACAGAGAGGAGATGG + Intronic
971302963 4:25456916-25456938 CAGTGTTGACAGAGAGGAGGGGG - Intergenic
978155944 4:105489381-105489403 CATTATTGCCTGAGAGCACAGGG - Intergenic
979422518 4:120522936-120522958 TAATGTAGACAGAGAGTAGAAGG + Intergenic
979712873 4:123801627-123801649 CATGGTTGCCAGAGAATGGGGGG + Intergenic
982968991 4:161955934-161955956 CAGTGTTCCGAGAGTGTAGAAGG - Intronic
983824768 4:172245361-172245383 CACTGTTGCCATAGACTTGATGG + Intronic
983965977 4:173810476-173810498 AATATTTGCCAGAGAGAAGAGGG + Intergenic
984166185 4:176305386-176305408 CATTATAGCCAGAGAGAACAAGG - Intergenic
984713294 4:182903732-182903754 CATTGTTGCAGGAGCGGAGACGG - Intronic
986092601 5:4524816-4524838 CATTGTAGACAGAGAGGAAAAGG + Intergenic
986214425 5:5705685-5705707 CATTGTTCTCACAGAGCAGAAGG + Intergenic
986792415 5:11175024-11175046 CATTGTTTCCTGAGAATGGAAGG + Intronic
987054946 5:14182410-14182432 AATTGTTGTCAGAGTGTAGGTGG + Intronic
991146403 5:63310486-63310508 AGTGGTTGCCAGAGATTAGAGGG + Intergenic
992137364 5:73760911-73760933 CATTGTTGCCAGACAAAAGTAGG - Intronic
992892150 5:81213398-81213420 CATTGGTGCCAGAGAATAGAAGG + Intronic
993870857 5:93252534-93252556 CATGGATGCCACAGAGTACAGGG - Intergenic
994055870 5:95414366-95414388 CATTTATGCCAAAAAGTAGAAGG + Intronic
996211671 5:120818357-120818379 CAAAGCTGCCAGAGAGTGGAAGG - Intergenic
998485487 5:142498304-142498326 CATTGTTACCATAGCGTATATGG - Intergenic
998659271 5:144218176-144218198 CATTGTTGCCATGGAGCATATGG + Intronic
999269017 5:150285626-150285648 CATGGTTGACAGGGAGGAGAGGG - Intronic
1000545835 5:162600815-162600837 CAATGTTGTCAAAGATTAGATGG - Intergenic
1001121059 5:168980221-168980243 CATTTTAGCCAGGGAGGAGAGGG - Intronic
1001152148 5:169241178-169241200 TCTGGTTGCCAGAGAGTGGATGG - Intronic
1001636886 5:173216805-173216827 CATGGTTGCCAGAGGTTAGGGGG - Intergenic
1003481909 6:6542346-6542368 CAGTGGTGCCAGGGATTAGAGGG - Intergenic
1005298678 6:24450112-24450134 CAGAGATGCCAGAAAGTAGAGGG + Intronic
1005366044 6:25078101-25078123 AATGGTTGCCAGAGTGTAGTGGG - Intergenic
1005835951 6:29709794-29709816 CACAGTTGCCAGAGGGTAAAAGG - Intergenic
1006055329 6:31379680-31379702 CATAGTTGCCAGAGGGTGGAAGG + Intergenic
1008208669 6:48694201-48694223 GAATGTTGCCAGATATTAGATGG + Intergenic
1009355216 6:62735559-62735581 CATGGTTGTCTGAGAGTAGTTGG + Intergenic
1010722431 6:79298667-79298689 CAGTGCTGACAGAGATTAGATGG - Intergenic
1011095009 6:83651584-83651606 CATTGTGGTCTGAGAGCAGATGG + Intronic
1012894527 6:104933463-104933485 TATTGTTGCCAGAGAAAATAAGG + Intergenic
1016805649 6:148209675-148209697 CATTTCTCCCAGAGAGTACATGG - Intergenic
1016884021 6:148941560-148941582 TATTTTTGCCAGAGTGTGGAAGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018141659 6:160843765-160843787 CAGTGTACCCAGAGAATAGATGG - Intergenic
1018548684 6:164967011-164967033 CATTGCTGGGAGAGAGTACATGG - Intergenic
1018652387 6:166003072-166003094 CATTGTTTCAGGATAGTAGAGGG - Intergenic
1020993609 7:15233469-15233491 AAATGATGTCAGAGAGTAGAGGG + Intronic
1021403870 7:20241293-20241315 TATTGTTTCCTGAGAGAAGAGGG + Intergenic
1021692789 7:23247195-23247217 CATTCTTGCCAGACAGTGGTTGG + Intronic
1022592619 7:31680329-31680351 CATTGATGCAGGAGAATAGAAGG + Intergenic
1025067963 7:55874170-55874192 CATTGTTACCAGAGCGTAATTGG + Intergenic
1027534540 7:79380355-79380377 CATTGTTGTTATAGAGCAGAAGG - Intronic
1027909790 7:84235744-84235766 CTTTGTTGCCCAAGAGTAGAGGG - Intronic
1028199227 7:87941137-87941159 CTTTGTTGTCAGTGAATAGACGG + Intronic
1028399868 7:90413283-90413305 AATGGTTGCCAGAAAGGAGAAGG - Exonic
1030576986 7:111300454-111300476 CAATGTGGCTAGAGAGTACATGG - Intronic
1031323938 7:120367942-120367964 CTTTGTTGCCAGAGTGTAAAAGG + Intronic
1037311148 8:17558073-17558095 GATAGTTGCCAGAGAGCTGAGGG + Intronic
1038352577 8:26791613-26791635 CATTCTTGCCAAAGACTACAAGG + Intronic
1039225626 8:35385178-35385200 CCATGCTGCCAGAGAGTAAAGGG - Intronic
1042428978 8:68682001-68682023 GATGGTTGCCAGAGACTAAAGGG + Intronic
1042999352 8:74738261-74738283 TATTCTTGCCAGAGAGGAGTTGG - Intronic
1043786216 8:84403442-84403464 CAGTTTTGCCAAAGATTAGATGG + Intronic
1044449268 8:92314525-92314547 CATTCTTTGCAGAGAGTAGAGGG - Intergenic
1045011569 8:97963382-97963404 CATTGGTCACAGGGAGTAGATGG + Intronic
1045423838 8:102043375-102043397 AATTGTTTCCATAGAGTTGACGG + Intronic
1046583115 8:116117907-116117929 CATTTTTACAAAAGAGTAGATGG + Intergenic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1047537517 8:125733224-125733246 GCTTGTTCCCAGAGAGTAGGCGG + Intergenic
1047826598 8:128582648-128582670 CATTGCTGAAAGAGAGTAAAAGG - Intergenic
1048192368 8:132301550-132301572 CCTTGTTGCCACTTAGTAGATGG - Intronic
1048556006 8:135476632-135476654 CACTGTTACCATTGAGTAGATGG + Intronic
1049763034 8:144339353-144339375 CTTTGTTGCAGGAGAGGAGATGG + Intergenic
1050265648 9:3886886-3886908 CCTTGCTGCCAATGAGTAGAAGG + Intronic
1051604662 9:18907830-18907852 CAGTGTTGGCACAGACTAGATGG - Intronic
1053171928 9:35893258-35893280 CACTGATCTCAGAGAGTAGAAGG - Intergenic
1055222280 9:73950843-73950865 GATGGTTGCCAGTGACTAGAAGG - Intergenic
1055424804 9:76183219-76183241 CGTTGTTTCCAGAGCCTAGAAGG + Intronic
1056812895 9:89777934-89777956 CAGCTTTGCCAGAGAGCAGAAGG + Intergenic
1058254297 9:102742187-102742209 CATGGTTGCCAGAGATTAGGAGG - Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1186166037 X:6827082-6827104 CATTCTTGTTTGAGAGTAGAAGG - Intergenic
1186782793 X:12930193-12930215 CATTATTTCCAGTGAGTACAAGG + Intergenic
1187985825 X:24809446-24809468 CATTGAAGAAAGAGAGTAGATGG - Intronic
1189114503 X:38328849-38328871 CATTGGTGCCAGAGAGGAGCAGG + Intronic
1189747369 X:44183474-44183496 GAGTATTGCCAGACAGTAGAGGG + Intronic
1189808793 X:44761962-44761984 CACTGTTTCCTGTGAGTAGAGGG + Intergenic
1192246179 X:69373526-69373548 CATTGTAGCCAGAGTGGAGTGGG - Intergenic
1193744594 X:85260614-85260636 CATGGTTGCCTCAGAGTGGATGG - Intronic
1193920664 X:87421854-87421876 GATGGTTGCCAGAGACTGGATGG - Intergenic
1194226688 X:91269104-91269126 CATTGTTGCCAGAGGCTGGGAGG - Intergenic
1194815668 X:98438536-98438558 CACTTTTGCCAGAGAGTGGGGGG + Intergenic
1195892047 X:109705997-109706019 CATTGTTGCTAAAAAGTAAATGG - Intronic
1197203944 X:123773709-123773731 CATAGATCCCAGAGAGAAGAAGG + Intergenic
1199973296 X:152876330-152876352 CATTATTCCAAGAGAGTAGAAGG - Intergenic
1200428302 Y:3046363-3046385 CATTTTTTCCAGGGAGGAGATGG + Intergenic