ID: 1086193739

View in Genome Browser
Species Human (GRCh38)
Location 11:84111782-84111804
Sequence CATGGGGAACAGCATGAGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086193739 Original CRISPR CATGGGGAACAGCATGAGTA CGG Intronic
900018678 1:171833-171855 GAGGGGGAACAGCATGAGCCAGG + Intergenic
900288866 1:1915410-1915432 CACGGGGAACAGCGTGTGTGAGG + Intronic
900951483 1:5860431-5860453 GACGGGGAACAGCAGGAGCAGGG + Intergenic
901650331 1:10739417-10739439 CATGGGGCACAGCATGTGTGTGG + Intronic
902408462 1:16199299-16199321 CAGGGGGAGGAGCATGGGTAGGG + Intronic
903219529 1:21861328-21861350 CAGAGGGAACAGCATAAGCAAGG + Intronic
903316463 1:22511786-22511808 CCTGGGGAACAGAATGATCAAGG + Exonic
906952918 1:50349220-50349242 CAAGGGGAACAGCATATGTTTGG - Intergenic
908000405 1:59673354-59673376 GACAGGGAACAGCATGGGTAAGG + Intronic
908056610 1:60293877-60293899 CAAGGAGAGCAGCATGCGTAAGG + Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
912029702 1:105225056-105225078 CATGGGCAGCAGCATGGGAATGG - Intergenic
912509246 1:110177038-110177060 CAAAGGGAACTGCATGAGCAAGG + Intronic
912921966 1:113877148-113877170 CATAGGGAACAGTAGGAGGAGGG + Intergenic
913421570 1:118675629-118675651 CATGGAGACCAGGATAAGTAAGG + Intergenic
914431598 1:147624296-147624318 CCTGGGGAACAGCATGCCTTCGG + Exonic
916043431 1:160980870-160980892 CATGAGGAATAGCAAGAGGATGG - Intergenic
916161957 1:161925873-161925895 CATAGGGAACAGTATAAGTAGGG + Intronic
917626380 1:176850701-176850723 CACAGGGAACAGCAAGTGTAAGG + Intergenic
918439244 1:184549568-184549590 CATAGGGAAAAGTATGAGTAAGG - Intronic
919526307 1:198656475-198656497 CATGGGCAAAAACTTGAGTAGGG - Intronic
920809355 1:209267801-209267823 CATGGCGAAGAGGATGAGAAAGG + Intergenic
921137113 1:212271494-212271516 TAAGGGAAACAGCATGAGCAAGG - Intergenic
921657836 1:217761979-217762001 GAGGTGGAACAGCATGAGGACGG - Intronic
922229270 1:223671639-223671661 CAAGGGGAACAGCAAGAAAATGG + Intergenic
1063560547 10:7122297-7122319 CATGGCACACAGCATGAGTGAGG - Intergenic
1063641363 10:7833858-7833880 CCTGGGGAAGAGGATGAGTTTGG + Intronic
1063936963 10:11088260-11088282 CAGAGTGAACAGCATGAGTGAGG + Intronic
1069561391 10:69432972-69432994 CATGGCGAAGAGGATGAGGAAGG + Intergenic
1069991357 10:72318544-72318566 CAGAAGGAACAGCATGAGTGAGG + Intergenic
1073654747 10:105401662-105401684 CATGAGCAACTGCATGAGCATGG + Intergenic
1074773178 10:116746328-116746350 CATGATGCACAGCATGGGTAGGG + Intergenic
1075153266 10:119953862-119953884 CCTGGGCAACAGCGTGAGAAAGG - Intergenic
1076029580 10:127146002-127146024 CATGGGGAATAGAGTGACTAGGG - Intronic
1076828027 10:132980021-132980043 CCTGGGGGAGAGCATGAGTGTGG + Intergenic
1080643984 11:34174822-34174844 CAGAGAGAACAGCATGAGTGAGG - Intronic
1081700585 11:45150138-45150160 CAGAAGGAACAGCATGAGGAAGG - Intronic
1082629847 11:55529103-55529125 CAAGGACAACAGCATGAGCAAGG - Intergenic
1084426375 11:69086616-69086638 CATGGAGAACAGCCTGGGTGGGG - Intronic
1084697005 11:70761738-70761760 CATGGAGCACAGCATGGGCATGG - Intronic
1085394935 11:76202467-76202489 CATGGGCACCAGCATGAGGTGGG - Intronic
1085712421 11:78842054-78842076 CCTGGTGGACAGCATGAGTGTGG - Intronic
1086193739 11:84111782-84111804 CATGGGGAACAGCATGAGTACGG + Intronic
1088134462 11:106537450-106537472 CAGAGGGAACAGTATGAGCAGGG - Intergenic
1090334767 11:125954937-125954959 CAGGGGGAACTGGATGAGCAGGG + Intergenic
1090641641 11:128734388-128734410 CATAGGGAAAAGCATGTCTAAGG + Intronic
1091592747 12:1854751-1854773 CAAGGGAAACAGCATGTATAGGG - Intronic
1091716165 12:2777645-2777667 TAGAGGGAACAGCATGAGCATGG - Intergenic
1092249425 12:6884349-6884371 CCTGGGGAAGAGGATGAGTGAGG - Intronic
1094179189 12:27573469-27573491 CAAAGGGTACAGAATGAGTATGG + Intronic
1096462472 12:51829533-51829555 CAAGGGGCCTAGCATGAGTAGGG + Intergenic
1096587090 12:52629842-52629864 CAAGGGGAACAGATTGAGAAGGG - Intergenic
1097296855 12:57974870-57974892 CATGGGGAACAGCTTCATCAAGG - Intergenic
1097508072 12:60501409-60501431 CATGAGAAACAGAATGAATATGG + Intergenic
1097680795 12:62647259-62647281 CAGGGAGCACAGCATGAGAATGG + Exonic
1101416671 12:104514414-104514436 CATGGTGAAGAGGATGAGGAAGG - Intronic
1101421405 12:104554318-104554340 CAGAGGGAACAGCATGTGCAAGG + Intronic
1101574322 12:105983451-105983473 CATGGAGAACAGCAAGAGCAAGG + Intergenic
1103405961 12:120675451-120675473 CAGAGGGAACAGCATGTGTGAGG - Intergenic
1104284996 12:127417191-127417213 CATGGTGAGCAGCATGGGAATGG - Intergenic
1104348796 12:128026902-128026924 CAGGTGGGACAGCGTGAGTAGGG - Intergenic
1104756537 12:131273191-131273213 CTCGGGGAACACCATGAGTTGGG + Intergenic
1111407804 13:87832645-87832667 CATGGCTTACAGCATGAGAAGGG - Intergenic
1111601028 13:90474348-90474370 GATGGAGAACAGCTTGACTACGG + Intergenic
1115248404 14:31320227-31320249 CATGGCGAACAGGATGAAGAAGG + Intronic
1116781369 14:49241062-49241084 CCTGGAGAACTGCCTGAGTATGG + Intergenic
1117021825 14:51578853-51578875 CATGGGGAATAGTACGAGTTTGG + Intronic
1118090112 14:62465303-62465325 AATGGAGAACAGCATGACTGTGG - Intergenic
1118299917 14:64606078-64606100 CATGAGGAACAGCCTGAGGGAGG + Intergenic
1120927374 14:89811127-89811149 CAGAGGGAACAGCATGTGCAAGG + Intronic
1121026614 14:90620979-90621001 CAAGAGGAACAGCATGAGAGAGG + Intronic
1123508061 15:20965737-20965759 AAAGGGGAGCAGGATGAGTAAGG - Intergenic
1123565280 15:21539478-21539500 AAAGGGGAGCAGGATGAGTAAGG - Intergenic
1123601543 15:21976762-21976784 AAAGGGGAGCAGGATGAGTAAGG - Intergenic
1123699446 15:22903592-22903614 GATGGGGAGCAGCAAGAGCAGGG + Intronic
1126903877 15:53343742-53343764 CATGGTGAGCAGCATGACCAGGG - Intergenic
1127629523 15:60814167-60814189 CAAAAGGAACAGCCTGAGTAAGG - Intronic
1129961957 15:79695014-79695036 CATGGGGCACAGCATCTGGAGGG - Intergenic
1202973651 15_KI270727v1_random:266585-266607 AAAGGGGAGCAGGATGAGTAAGG - Intergenic
1132699925 16:1217985-1218007 CACGCGGAACAGCGTGAGGAAGG - Exonic
1133357418 16:5146910-5146932 CAGAGGGAACAGCATGTGTGAGG - Intergenic
1133692367 16:8229165-8229187 CATGGGGAACAGTGTGACAATGG + Intergenic
1134296921 16:12954469-12954491 CATGGGGAACAGTGTGTGTGTGG + Intronic
1136411866 16:30082462-30082484 CCTGGGGAACAGGAAGAGTGGGG - Exonic
1137546575 16:49408614-49408636 GATGGGAAACAGGATGAGAAGGG + Intergenic
1137918173 16:52455741-52455763 CAGAGGGAACAGCATGTGCAAGG + Intronic
1137981232 16:53071837-53071859 TATGGGGAAATGCCTGAGTAGGG - Intronic
1139243623 16:65419502-65419524 CATGGGGAGCAGTCTGTGTAGGG + Intergenic
1140303785 16:73783363-73783385 ACTGGGGAACAACATGACTAAGG - Intergenic
1142347257 16:89561696-89561718 CCTGGGGAAGAGGATGAGTTTGG - Exonic
1143580115 17:7820493-7820515 CATGAGCAAAAGCATGAGAAGGG - Intronic
1143663917 17:8345358-8345380 AATGGGGAATAGCATGAGGGTGG - Exonic
1143863053 17:9905159-9905181 CATGGGGAACAGCAAAAGTGGGG - Exonic
1144477007 17:15597019-15597041 CATGGCATACAGCTTGAGTAGGG + Intronic
1144708148 17:17383626-17383648 CCTGGGGAAGAGGATGAGTTTGG + Intergenic
1144921233 17:18766335-18766357 CATGGCATACAGCTTGAGTAGGG - Intronic
1146301628 17:31694063-31694085 CCTGGGGAAGAGCAGGAGTTAGG + Intergenic
1146566505 17:33917505-33917527 CAAGGGGAAGAGAATGGGTATGG - Intronic
1147645152 17:42028870-42028892 CGTGGGAAGCAGCATGAGTGGGG - Exonic
1148031126 17:44621821-44621843 CATGGGACAGAGGATGAGTATGG - Intergenic
1148601248 17:48895744-48895766 CATGGCGAAGAGGATGAGGAAGG - Exonic
1158341149 18:56468029-56468051 CATGTTGAACAGCATGTGGAAGG + Intergenic
1159060702 18:63511184-63511206 CCTGGGGGAGAGCATGAGTGAGG + Intergenic
1159251082 18:65877599-65877621 CATGTTGAACAGCATAATTAAGG - Intronic
1159717328 18:71841876-71841898 CATGGGAGACAGCATGTGTTGGG + Intergenic
1166057895 19:40304302-40304324 CCTGGGGAACAGCAAGGGCAGGG + Intergenic
1166966100 19:46530137-46530159 AATGGGGAACAGGATGTCTAAGG - Intronic
926692505 2:15747327-15747349 CATGGGGAACAGCATGTGCCAGG + Intergenic
931267649 2:60674702-60674724 CATGGGGACCTGCGTGAGCACGG - Intergenic
931431768 2:62214224-62214246 CTGTGGGAACAGCATGAGCAGGG + Intronic
932753591 2:74389094-74389116 CCTGGGAAACAGCATTAGGAAGG + Intronic
934511240 2:94946337-94946359 GATGGTGAGCAGCAGGAGTAGGG - Intergenic
936159086 2:110070620-110070642 CGCTGGGAACAGCATGAGGAAGG - Intergenic
936185575 2:110300712-110300734 CGCTGGGAACAGCATGAGGAAGG + Intergenic
938286242 2:130120167-130120189 CAGGGGGAGCAGCAAGAGCAAGG - Exonic
939304200 2:140388744-140388766 GAGGGGGAACTGTATGAGTAAGG + Intronic
941049403 2:160715398-160715420 CATGTGAAACAACATGAGTTGGG + Intergenic
941324228 2:164093231-164093253 GAGGGGGAATAGCGTGAGTAAGG - Intergenic
941678411 2:168368866-168368888 CATTGGGAACAACATGAAAACGG + Intergenic
944216707 2:197263510-197263532 CATGGGGAAGAGGATGAGAAAGG - Intronic
944505924 2:200410603-200410625 CATAGAGAACAGCATGAGTGAGG - Intronic
944580069 2:201124703-201124725 CAGGGGGAACAGAATGGCTAGGG + Intronic
946272533 2:218606225-218606247 CATGGGGAACAGGAAGATTGGGG - Intergenic
946863189 2:224019537-224019559 CATGGTGAACAGGATGAACAAGG - Intronic
948868880 2:240788472-240788494 CAGAGGGAACAGCATGTGAAAGG + Intronic
1170881319 20:20298723-20298745 ATTTGGGAACAGCATGAGGAAGG + Intronic
1171170953 20:23015042-23015064 GATGGGGAACACCATGAGCATGG + Intergenic
1172422497 20:34829079-34829101 CAGGGGGATCAGCATGTGCAAGG - Intergenic
1173552721 20:43944470-43944492 CAGAGGGAACAGCATGAAAAAGG + Intronic
1173940850 20:46909963-46909985 CATGGGGAAGAGCATGTGGAGGG - Intronic
1174498250 20:50965032-50965054 CAAGGGGAACAGCAAGTGCAAGG + Intergenic
1177019487 21:15836508-15836530 TGTGGGGATCAGAATGAGTAGGG + Intronic
1177019496 21:15836590-15836612 TGTGGGGATCAGAATGAGTAGGG + Intronic
1177019505 21:15836672-15836694 TGTGGGGATCAGAATGAGTAGGG + Intronic
1177796516 21:25784478-25784500 TTTGGGGAGGAGCATGAGTAGGG + Intergenic
1180117978 21:45724659-45724681 GATGGGGAACAGCAAGGGTGGGG + Intronic
1180647388 22:17350768-17350790 CAAGGGGAACAGCATCAGAGAGG - Intergenic
1182104526 22:27679956-27679978 CATGCGGAACAGCATTAGCAAGG - Intergenic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1183252875 22:36742838-36742860 CAGGGGGAACAGCCTGGGCAAGG + Intergenic
1183256202 22:36764042-36764064 CAAGAGGGACAGGATGAGTATGG + Intronic
1183693291 22:39403578-39403600 CATGGGGAGCAGATTGAGTAGGG + Intronic
950167079 3:10809429-10809451 CATGGGCCACAGCAGGAGTGAGG + Intergenic
952130680 3:30358056-30358078 CATGGGCAAAAGCATGGGTGTGG - Intergenic
953367547 3:42359049-42359071 AATTGGGAACAGCAGGACTAGGG + Intergenic
953391222 3:42534989-42535011 CAGGGGGATCAGCAGGAGTGTGG - Exonic
954387223 3:50250480-50250502 CAAAGAGAACAGCATGAGCAGGG + Intronic
955118518 3:56031247-56031269 CATGGGGATCAGCTTGGGTTGGG - Intronic
955202606 3:56864335-56864357 CCTTGGGAACAGCATGTGCAAGG - Intronic
955317030 3:57947779-57947801 CAGTGGGAACAGCATGTGCAAGG + Intergenic
957061988 3:75489739-75489761 CAGAGGGAACAGCATGTGTGAGG - Intergenic
957506584 3:81129119-81129141 CATGCGTCACAGAATGAGTAAGG - Intergenic
958750395 3:98188216-98188238 CCTTGGGGACAGCATGACTATGG - Intronic
959392280 3:105790980-105791002 CAGGGAGAACTGCATGAGTGGGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961291415 3:125849662-125849684 CAGAGGGAACAGCATGTGTGAGG + Intergenic
961656283 3:128443927-128443949 CAGAGGGAACAGCATGTGCAAGG + Intergenic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
962731823 3:138290426-138290448 CAAGGGGTACAGGAGGAGTAGGG + Intronic
967383272 3:188883980-188884002 CATGGGGAAGACCATGATTGTGG + Exonic
967609935 3:191492239-191492261 CCTGGGGAAGAGCATGAATAGGG - Intergenic
968986167 4:3875681-3875703 CCTGGGGACCAGCATGGGCAGGG - Intergenic
969005882 4:4019830-4019852 CAGAGGGAACAGCATGTGTGAGG - Intergenic
969293147 4:6253242-6253264 CAGAGGGAACAGCAAGTGTAAGG + Intergenic
969642754 4:8408937-8408959 CCAGGTGAACAGCATCAGTATGG + Intronic
969807067 4:9617460-9617482 CAGAGGGAACAGCATGTGTGAGG + Intergenic
970422485 4:15918526-15918548 CAGAGAGAACAGCATGAGCAAGG - Intergenic
970518745 4:16861795-16861817 CAGGGGGAACAGCATGTGCAAGG - Intronic
971046241 4:22808364-22808386 CAAGGGGAACAGCTTGACAAAGG + Intergenic
971235411 4:24837420-24837442 CCTGAGGAACATCTTGAGTAAGG - Intronic
971637408 4:29079270-29079292 CATTGGAGACAGAATGAGTATGG + Intergenic
972064499 4:34923602-34923624 CATGGGCATCAGCATGATTCAGG - Intergenic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
974025974 4:56733478-56733500 CATGGGGGATAGCATGAGACAGG + Intergenic
975269814 4:72418595-72418617 AATGGTGAATACCATGAGTAGGG - Intronic
975939487 4:79625271-79625293 CATGAGGAGCAGCTTGAATATGG + Intergenic
977761746 4:100746121-100746143 CCTGGCGATCTGCATGAGTATGG - Intronic
979033026 4:115676888-115676910 TATGGGAAACAACATGAATACGG + Intergenic
980553266 4:134368448-134368470 CATAGGGAACAGCATATGTCAGG - Intergenic
981404742 4:144355160-144355182 CAGGGAGAACAGCATGACTTAGG + Intergenic
981423014 4:144572652-144572674 CTTGGAGAACAGCCTGAGTGAGG + Intergenic
985071604 4:186171187-186171209 CATGGGGAAGGGCATCAGGAAGG - Intronic
985619148 5:944572-944594 CATGGGGAACAAGAGGAGTATGG - Intergenic
985650030 5:1103111-1103133 CAAGGGGCACAGGATGAGAACGG + Intronic
986667584 5:10116777-10116799 GATGGGGAACAGCCTGGGTCAGG + Intergenic
987744796 5:21956876-21956898 CATGTGGTACAGCATGGGTTTGG + Intronic
990356101 5:54967625-54967647 GATGGGGCACAGCATATGTAGGG + Intergenic
990417989 5:55605121-55605143 CATGGGGTACAGAATCAGAATGG - Intergenic
991406477 5:66305397-66305419 CAGAGGGAACAGCATGTGCAAGG + Intergenic
991765003 5:69967006-69967028 CATGTGGTACAGCATGGGTTTGG + Intergenic
991782322 5:70151147-70151169 CATGTGGTACAGCATGGGTTTGG - Intergenic
991844235 5:70842077-70842099 CATGTGGTACAGCATGGGTTTGG + Intergenic
991874765 5:71151462-71151484 CATGTGGTACAGCATGGGTTTGG - Intergenic
992568928 5:78031648-78031670 CATCAAGCACAGCATGAGTAGGG - Intronic
997581281 5:135018965-135018987 CAAGGGTGACAGCATGAGAAAGG - Intergenic
997941294 5:138159851-138159873 CATGGGAGAAATCATGAGTAGGG - Intronic
998133146 5:139661075-139661097 CATGGGGAAGAGCATGAGGGCGG - Intronic
998554743 5:143112303-143112325 AATGGGGATCAGCATTAGGAAGG + Intronic
999521986 5:152360076-152360098 CGTGGGGAAGATAATGAGTAGGG + Intergenic
999758944 5:154685408-154685430 TATGAGGAACAGCATGTGCAAGG - Intergenic
999813081 5:155146581-155146603 ACGAGGGAACAGCATGAGTAGGG - Intergenic
1001628880 5:173159987-173160009 CATGGGGATCAGCAGGATGATGG + Exonic
1002061893 5:176630236-176630258 GATGGGGAACGGGATGAGGATGG - Intronic
1003137659 6:3445731-3445753 CAAGTGGAATAGCATGAGCAAGG + Intronic
1007260346 6:40559062-40559084 CATGGGGAAGAGCATATGTTGGG + Intronic
1007712991 6:43836393-43836415 CCTGGGGAACTGCAGGAGCAAGG + Intergenic
1008087473 6:47259814-47259836 CCTGGAGAAAAGCATGAGGATGG + Intronic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1010579231 6:77573829-77573851 CATGGGGAAGGGCGTGAGTTTGG - Intergenic
1013533992 6:111046812-111046834 CCTGGGCAACAGGCTGAGTATGG + Intergenic
1015128479 6:129782778-129782800 CATGTGGAACAGTATGAATCAGG + Intergenic
1015701527 6:136040451-136040473 CATCAGGAATAGGATGAGTAAGG - Intronic
1015729406 6:136333039-136333061 CATGGGGAACAAGAGGAGCAGGG + Intergenic
1016209120 6:141506525-141506547 CAATGAGAACAGCATGAGAAAGG + Intergenic
1017180517 6:151547525-151547547 GAGAGGGAACAGCATGAGTTGGG + Intronic
1033335867 7:140451915-140451937 GATGGGGAAGAGCCTGAGAATGG - Intergenic
1033604706 7:142918339-142918361 AATTGGGAACTGAATGAGTAAGG - Intronic
1034243357 7:149625915-149625937 CATCGGCAACACTATGAGTAAGG - Intergenic
1034817145 7:154182387-154182409 CATGGCAACCAGCATGAGGAGGG - Intronic
1040580488 8:48694961-48694983 CATGGGGAGCTGCCTGAGCAAGG + Intergenic
1041683096 8:60613267-60613289 CATGGGGAACAACAGGAGAAGGG - Intronic
1041684000 8:60625713-60625735 CATGGGCAAAAGCCTGAGAAAGG + Intergenic
1042601845 8:70506501-70506523 CCTGGGGAAGAGGATGAGTTTGG + Intergenic
1043835279 8:85038230-85038252 CATGGGCAAGAGCCTGAGCAAGG + Intergenic
1043963345 8:86443803-86443825 CATAGGGAACAGCAAGACAAAGG + Intronic
1047353945 8:124102503-124102525 CATGGGCAAAAACATGAGAATGG - Intronic
1048495383 8:134931243-134931265 CATGGGGGTCAGGATGGGTAGGG - Intergenic
1049287479 8:141783660-141783682 AATGGGAAACAGCAGGAGAAGGG + Intergenic
1049433039 8:142574095-142574117 CATGGGAAACACCAAGAGCACGG - Intergenic
1049666361 8:143845152-143845174 CCTGGGGCACAGCCTGAGTGAGG - Intergenic
1052484317 9:29076499-29076521 CAGAAGGAACAGAATGAGTATGG + Intergenic
1054740723 9:68803543-68803565 CTTGGGAGACAGCATGAGCAGGG - Intronic
1055708797 9:79036722-79036744 CTTGGGGAACAGCCTGAGGGAGG - Intergenic
1056722708 9:89085430-89085452 CATGGGGAACTGCGAGAGCACGG - Intronic
1057282762 9:93724816-93724838 CACAGGGAAGAGCATGAGCAAGG + Intergenic
1057873634 9:98736402-98736424 CAAAGGGAACAACATGACTAAGG + Exonic
1058965741 9:110036809-110036831 CATAGGGAACAGCAGGTGTGGGG - Intronic
1059383277 9:113945176-113945198 CAATGGGAACAGCATGTGTGAGG - Intronic
1061055552 9:128220604-128220626 CATGGGGAAGAGCTTGGGTTTGG + Intronic
1062481282 9:136753723-136753745 CTGGGGGAACAGCCCGAGTAGGG - Intergenic
1187195844 X:17082790-17082812 CAAGGGGAACAGTATGACTGAGG + Intronic
1192435247 X:71139358-71139380 CATGGGGACCAGAATGAGGATGG + Intronic
1192543777 X:71996227-71996249 AATGGGGAACTGCAGGAGTGAGG - Intergenic
1194165316 X:90507831-90507853 CTTGGGGAAGAGCATGAATCTGG + Intergenic
1196064907 X:111453468-111453490 TGTCTGGAACAGCATGAGTAAGG + Intergenic
1196847210 X:119905684-119905706 CAGAGGGAACAGCAAGAGCAAGG - Intronic
1197896292 X:131319123-131319145 CATGTGCAACAGCATGACAAGGG + Intronic
1200511585 Y:4085641-4085663 CTTGGGGAAGAGCATGAATCTGG + Intergenic
1201850131 Y:18471142-18471164 CATGGGGTACGGCTTGCGTAGGG - Intergenic
1201883187 Y:18849235-18849257 CATGGGGTACGGCTTGCGTAGGG + Intergenic