ID: 1086196322

View in Genome Browser
Species Human (GRCh38)
Location 11:84144368-84144390
Sequence GAAGTAAGGAACCCTGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086196322_1086196327 -2 Left 1086196322 11:84144368-84144390 CCAGATACAGGGTTCCTTACTTC 0: 1
1: 0
2: 1
3: 6
4: 155
Right 1086196327 11:84144389-84144411 TCGTGCTCATAGAGAAGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 79
1086196322_1086196325 -6 Left 1086196322 11:84144368-84144390 CCAGATACAGGGTTCCTTACTTC 0: 1
1: 0
2: 1
3: 6
4: 155
Right 1086196325 11:84144385-84144407 TACTTCGTGCTCATAGAGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 67
1086196322_1086196326 -3 Left 1086196322 11:84144368-84144390 CCAGATACAGGGTTCCTTACTTC 0: 1
1: 0
2: 1
3: 6
4: 155
Right 1086196326 11:84144388-84144410 TTCGTGCTCATAGAGAAGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 104
1086196322_1086196324 -7 Left 1086196322 11:84144368-84144390 CCAGATACAGGGTTCCTTACTTC 0: 1
1: 0
2: 1
3: 6
4: 155
Right 1086196324 11:84144384-84144406 TTACTTCGTGCTCATAGAGAAGG 0: 1
1: 0
2: 0
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086196322 Original CRISPR GAAGTAAGGAACCCTGTATC TGG (reversed) Intronic
903081790 1:20816570-20816592 GAAGTGAGGACCCCTCTGTCTGG + Intronic
906063829 1:42965832-42965854 GAAGTAAGGAAACGTGTATCAGG + Intergenic
906918617 1:50038914-50038936 GAAGTTATGCTCCCTGTATCTGG + Intergenic
908248991 1:62250346-62250368 GAAGGAAGGGGCCCTGCATCAGG - Intronic
908588168 1:65597305-65597327 GAAGTAAGGAAGACTTTATTTGG - Intronic
911101909 1:94101994-94102016 GAAGTAAGAAACACTGGATTAGG + Intronic
911542972 1:99181199-99181221 GACGAAAGGAAGCATGTATCTGG - Intergenic
912159599 1:106965673-106965695 GAGGTAAGAAATCCTGTACCAGG - Intergenic
913030640 1:114898964-114898986 CAGGTCAGGAACCCTGTATGGGG + Intronic
916810460 1:168301162-168301184 GAAGTAAAGAACTCTGCAGCTGG - Intronic
916954404 1:169816718-169816740 CAGGTAAGGAACCCTGTACAGGG + Intronic
921973964 1:221180885-221180907 GAATTTAGAAACCCTGTATCAGG - Intergenic
922569230 1:226623711-226623733 CTAGTAAGGACCCTTGTATCTGG - Intergenic
1064108236 10:12519154-12519176 GAAGTGAGGACCCCTCTGTCTGG - Intronic
1064175349 10:13070522-13070544 CAGGTTAGGAACCCTGTATGGGG - Intronic
1064292686 10:14050488-14050510 GAAGACAGGAGCCCTGTACCAGG - Intronic
1064437486 10:15323784-15323806 GAAGGAAGGAACACGGTATTAGG + Intronic
1065176006 10:23075972-23075994 GAAGTTAGGAAGCATGAATCAGG + Intergenic
1067515908 10:46943380-46943402 GAAGGAAGGAAACGTGTATGTGG + Intronic
1067646342 10:48108430-48108452 GAAGGAAGGAAACGTGTATGTGG - Intergenic
1069187049 10:65436943-65436965 GTAGTAAGAATCCCTTTATCTGG + Intergenic
1069357060 10:67598413-67598435 GAAGTTGGGAACCCTGCATGGGG - Intronic
1071889888 10:89992449-89992471 GAAGGAAAAAACCCAGTATCTGG + Intergenic
1074010018 10:109468753-109468775 AAAGTAGGGAACCCTGGAGCAGG - Intergenic
1079235814 11:18689373-18689395 CAAGTCAGGAACCCTGTACAGGG - Intergenic
1079856193 11:25608703-25608725 GAAGTCAGTAACCAAGTATCTGG - Intergenic
1080255069 11:30281653-30281675 GAAGTTAGGAACCCTGCACGGGG + Intergenic
1080289207 11:30652193-30652215 GAAGGAAGGAAGGCTGTATGGGG + Intergenic
1080607331 11:33874594-33874616 GAAGTAATCACCACTGTATCAGG + Intronic
1081191036 11:40103367-40103389 GAGGTGAGGAACCCTGCATAGGG - Intergenic
1083660485 11:64249724-64249746 GAAGGAAGGAGCCCTGTAATGGG + Intergenic
1086196322 11:84144368-84144390 GAAGTAAGGAACCCTGTATCTGG - Intronic
1091375289 12:21207-21229 GAAGTGAGTAAACTTGTATCAGG + Intergenic
1093351598 12:18109107-18109129 GAAGTAATCAACCTGGTATCAGG + Intronic
1097253491 12:57654498-57654520 CAAGTCAGAAACCCTGTATGGGG - Intergenic
1097499983 12:60389715-60389737 GAGGTCAGGAACCCTGTACAGGG + Intergenic
1097844242 12:64350578-64350600 CAAATTAGGAACCCTGTATGGGG - Intronic
1098985635 12:77009199-77009221 GAAGAAAGGAACCCAGAATTTGG - Intergenic
1101333179 12:103773627-103773649 CAATCAAGGAACCCTGTGTCTGG + Exonic
1108143156 13:47447714-47447736 GAATGCAGGAATCCTGTATCTGG - Intergenic
1112788099 13:102973768-102973790 GTATTTAGGAACCCTGTGTCTGG + Intergenic
1113288031 13:108875080-108875102 GAAGGAAGGAACCTGTTATCTGG + Intronic
1114969397 14:28006218-28006240 GAAGCTGGGAACCCTGTATGGGG - Intergenic
1118535543 14:66759286-66759308 CAGGTTAGGAACCCTGTATAGGG + Intronic
1119352531 14:73977887-73977909 GACTTAAGGAATCCTGTTTCAGG + Intronic
1123809246 15:23906776-23906798 GAAGAAGGAAACCCTGTACCAGG - Intergenic
1124344489 15:28913207-28913229 TCAGCAAGGATCCCTGTATCAGG - Intronic
1125986452 15:44057682-44057704 GAAGTAAAGAACCTTGGATTAGG + Intronic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1131100365 15:89684000-89684022 GAAGATAGAATCCCTGTATCAGG + Intronic
1135077356 16:19404975-19404997 CAAGTCAGGAACCCTGTACAGGG + Intergenic
1137736174 16:50725570-50725592 GAAGTAAGGAACCCATAAGCAGG + Exonic
1139778734 16:69333466-69333488 GAAGTTAAGAACCATGTATTGGG - Intronic
1143177091 17:4961946-4961968 GAAGTAGGGACTACTGTATCTGG + Intronic
1146233177 17:31131432-31131454 GAAGTAAGGAACCCTGCACAGGG - Intronic
1147983413 17:44289347-44289369 ATAGTATGGAACCCTGTATGTGG + Intergenic
1150188744 17:63215370-63215392 GTATTTAGGAACCCTGTGTCAGG - Intronic
1153085195 18:1278286-1278308 GAAGCTGGGAACCCTGTATGGGG + Intergenic
1154163434 18:11996646-11996668 GAAGTGAGCACCCCTGCATCAGG + Intronic
1155713929 18:28916535-28916557 TAAGTCAGGAACCCTGTACAGGG - Intergenic
1156098320 18:33562934-33562956 CAAGTTAGGAACCCTGTACAGGG + Intergenic
1157912848 18:51635405-51635427 CATGTCAGGAACCCTGTACCAGG - Intergenic
1158382575 18:56949913-56949935 GAATTTTGGAAGCCTGTATCTGG - Intronic
928205330 2:29279614-29279636 AAAGTAGGGAAACCTGAATCTGG - Intronic
1168775408 20:443314-443336 GAAATAGGGAAGCCTGTCTCAGG + Intronic
1169044990 20:2528068-2528090 GAAGTAAGGAACTTTGCAGCAGG + Intergenic
1169102697 20:2965317-2965339 GAAGTAATGAAACCTGTATGTGG + Intronic
1171983422 20:31643021-31643043 GAAGTGAGGACCACTGTAGCTGG - Intronic
1172327666 20:34049265-34049287 GTTGTAAAGAACCCTGGATCTGG + Intronic
1179956619 21:44743996-44744018 CAGGTTAGGAACCCTGTATGGGG - Intergenic
950653871 3:14424637-14424659 GAAATAAGGATTCCTGTTTCTGG - Intronic
951255924 3:20449090-20449112 CAGGTTAGGAACCCTGTATGGGG + Intergenic
952454371 3:33458718-33458740 CAAGTTAGGAACCCTGTGTGGGG + Intergenic
953374757 3:42419323-42419345 GAAGTCAGGAGCCCTGAATTGGG + Intergenic
958259517 3:91364313-91364335 GAAGTTGGGAACCCTGCATGGGG + Intergenic
959311086 3:104738279-104738301 GAAGTGGGGAACGCTGTAGCAGG - Intergenic
959431458 3:106259708-106259730 CCAGTCAGGAACCCTGTATAGGG - Intergenic
959970346 3:112401961-112401983 CAAGTCAGGAACCCTGTACGGGG + Intergenic
962048350 3:131785359-131785381 GAGGTAATGAAGCCGGTATCTGG - Intronic
963251556 3:143108816-143108838 CAGGTTAGGAACCCTGTATAGGG - Intergenic
963970694 3:151426317-151426339 GAAGAACTGAACCCTGTATGTGG - Intronic
964980146 3:162668491-162668513 TAAGTCAGGAACCCTGTACAGGG - Intergenic
965403398 3:168240821-168240843 GCAGTTAGGAATCCTGCATCAGG + Intergenic
967639729 3:191847505-191847527 GAATTCAGCAACCCTGTAGCAGG + Intergenic
969722469 4:8900034-8900056 GAAGTGAGGAAGGCTGTACCCGG - Intergenic
976971745 4:91111782-91111804 GAAGCAAGAAATACTGTATCAGG + Intronic
977697376 4:99981657-99981679 GAAGGAGGTAACCCTGTCTCAGG - Intergenic
981570686 4:146147678-146147700 GATTTCAGGAACCCTATATCTGG + Intergenic
982028558 4:151276784-151276806 GAGGAAATGAACCCAGTATCTGG - Intronic
985028151 4:185759776-185759798 TAACTAAGGAACCCTGTTACAGG - Intronic
986500129 5:8390043-8390065 GAAATAAGGAGCCCAATATCTGG + Intergenic
987588975 5:19897860-19897882 GAAGTCAGGAACCTTGTAGGGGG + Intronic
990173095 5:53076987-53077009 TAGATAAGCAACCCTGTATCTGG - Intronic
992321399 5:75616524-75616546 GAAGTCAGTAACCTGGTATCTGG - Intronic
992819201 5:80478277-80478299 GAAGTAAAAAAACCTGTTTCAGG - Exonic
994021429 5:95030150-95030172 GAAGTCATGAACCCTGCAACAGG + Intronic
994377359 5:99030221-99030243 GAAGAAAGGAAAGCAGTATCAGG - Intergenic
997348431 5:133210907-133210929 GAACGAAGGAACCCTGGAGCTGG - Intronic
998166362 5:139846647-139846669 GAAGGAAGTGACCCTGTCTCCGG - Intergenic
1000319562 5:160123443-160123465 GAAGTAAATAAACCTGTAACTGG + Intergenic
1001159893 5:169303402-169303424 GCAGTAAGGAAACCTGTTTAAGG + Intergenic
1003583318 6:7362497-7362519 GAAGTCAAGGACCCTGTCTCAGG + Intronic
1006828691 6:36955773-36955795 GAAGTAACCAACCCTAAATCTGG - Intronic
1007117120 6:39350666-39350688 CAGGTAGGGAACCCTGTCTCAGG - Intronic
1008995717 6:57656053-57656075 GAAGTTGGGAACCCTGCATGGGG - Intergenic
1009184244 6:60554822-60554844 GAAGTTGGGAACCCTGCATGGGG - Intergenic
1009563337 6:65276568-65276590 GAGGTAAGGAAGGCTATATCTGG + Intronic
1009632054 6:66212814-66212836 CAGGTTAGGAACCCTGTATGGGG - Intergenic
1009726913 6:67546922-67546944 CAAGTAAGGAACTCTGTACAAGG - Intergenic
1010140665 6:72610844-72610866 GAAGTAGGTAAACCTGTAACAGG + Intergenic
1011844841 6:91551049-91551071 GAAGTTAGGAACATGGTATCTGG + Intergenic
1012402859 6:98858774-98858796 GAAGTAAGGAAGCGTATGTCTGG - Intergenic
1012694005 6:102354767-102354789 GCAGTCAGGAACCCTGTATAGGG + Intergenic
1014476635 6:121881176-121881198 TAAGTATGGAACCCTGCATTAGG - Intergenic
1014921849 6:127222815-127222837 GAAGTAGGGAAGCTTGTATTTGG - Intergenic
1018409083 6:163523085-163523107 GAAGTAAGGCAGACTGTATGTGG + Intronic
1021648063 7:22806266-22806288 CAAGTCAGGAACCCTGTACAGGG - Intergenic
1025634649 7:63311901-63311923 CAGGTTAGGAACCCTGTATAGGG - Intergenic
1025648047 7:63436269-63436291 CAGGTTAGGAACCCTGTATAGGG + Intergenic
1026899769 7:74030327-74030349 CAAGGAAGGAACCCTGTTGCGGG + Intronic
1027831847 7:83186972-83186994 AAAGTAATTAATCCTGTATCTGG + Intergenic
1028352137 7:89861975-89861997 CAAGTCAGGAACCCTGTATGGGG - Intergenic
1028360467 7:89961137-89961159 GAGGTAAGGAAGAATGTATCAGG - Intergenic
1032887275 7:136154373-136154395 GAAGCAAGGACCCCGATATCTGG + Intergenic
1036138204 8:6181363-6181385 GAAGGAAGTAACCCTGTGTTGGG - Intergenic
1038061981 8:23923926-23923948 GAAGAAAGGTACCCTGTCTGAGG - Intergenic
1039037327 8:33373971-33373993 GAGTTGAGGACCCCTGTATCAGG - Intronic
1040006037 8:42621643-42621665 GAAGCAAAGAACCCTGGTTCCGG - Intergenic
1040658938 8:49546072-49546094 GAAGACAGGAAGCCTGTCTCAGG - Intronic
1042959343 8:74286681-74286703 GAAATAAGTAAGCATGTATCTGG - Intronic
1043231558 8:77808596-77808618 GAAGTTGGGAACCCTGCATGGGG + Intergenic
1048688306 8:136929294-136929316 GAAGTAAGAAACTGTGTATCTGG + Intergenic
1049495398 8:142928679-142928701 GAAATCAGGAACCCTGGACCTGG + Intergenic
1049716758 8:144096555-144096577 GAACTAAGGAGCCATGGATCTGG + Intronic
1050191299 9:3029388-3029410 GAGGGAAGGAAGCCTGTTTCTGG + Intergenic
1050475240 9:6034277-6034299 GAAGTTGGGAACCCTGTGTGAGG + Intergenic
1050508834 9:6373285-6373307 CAGGTCAGGAACCCTGTATAGGG + Intergenic
1051437175 9:17045109-17045131 GAAGAGAGGGATCCTGTATCTGG + Intergenic
1053075740 9:35132875-35132897 CAGGTTAGGAACCCTGTATAGGG - Intergenic
1053270585 9:36746806-36746828 GGAGAAAGCAGCCCTGTATCTGG - Intergenic
1054635441 9:67485358-67485380 GAAGTTGGGAACCCTGCATGGGG - Intergenic
1056677719 9:88690091-88690113 CAAGTCAGAAACCCTGTATAGGG - Intergenic
1058265670 9:102896759-102896781 TAGGTAAGCAACCCAGTATCAGG - Intergenic
1187252100 X:17607879-17607901 GAAGAAACGAAACCTGGATCAGG - Intronic
1189159342 X:38794715-38794737 GAAGCAAGGAAAACTGTTTCAGG + Intergenic
1190134307 X:47781499-47781521 GAACTACTGAAACCTGTATCTGG + Intergenic
1190549069 X:51559997-51560019 CAAGTAAGGAACGCTGTACAGGG + Intergenic
1191170834 X:57445551-57445573 GAAGTGAAGAACCCAGTACCAGG - Intronic
1192983390 X:76370581-76370603 GAAGCTAGGAACCCTGAATGGGG - Intergenic
1193265296 X:79462267-79462289 CAGGTAAGGAACCCTGTACAGGG - Intergenic
1193392914 X:80949662-80949684 GAAGTTAGAAACCCTGCATGGGG - Intergenic
1193797673 X:85896452-85896474 GAAGTAGGGAACACTGGATGAGG + Intronic
1194066530 X:89268325-89268347 TAAGTCAGGAACCCTGTACAAGG + Intergenic
1195172977 X:102286707-102286729 GAAGCTGGGAACCCTGCATCAGG - Intergenic
1195185889 X:102400388-102400410 GAAGCTGGGAACCCTGCATCAGG + Intronic
1195337198 X:103867120-103867142 CAGGTTAGGAACCCTGTATGGGG + Intergenic
1195617453 X:106923626-106923648 GAGGTAAGGAACACTGCATGAGG + Intronic
1197236435 X:124070585-124070607 ATAGTAAGCAGCCCTGTATCTGG + Intronic
1197384194 X:125783232-125783254 CAAGTCAGGAACCCTGTACAGGG + Intergenic
1198112680 X:133515412-133515434 GCAGCAAGGAACCCTTGATCAGG - Intergenic
1200720698 Y:6602446-6602468 CAAGTCAGGAACCCTGTACAAGG + Intergenic
1202143007 Y:21748372-21748394 GAAGTAAGCATTCCTGTATTAGG + Intergenic
1202143821 Y:21757444-21757466 GAAGTAAGCATTCCTGTATTAGG - Intergenic