ID: 1086203132

View in Genome Browser
Species Human (GRCh38)
Location 11:84227328-84227350
Sequence CTGTGTGATCAGAGGGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086203132 Original CRISPR CTGTGTGATCAGAGGGAATA AGG Intronic
900468353 1:2836937-2836959 CTGTGTGATGTGAGGGGATGAGG + Intergenic
901533260 1:9866818-9866840 CTGTGAGACAAGAGTGAATATGG + Intronic
901851013 1:12015594-12015616 CTGTGTAATCAGAGGCATAAGGG - Intergenic
902112046 1:14089073-14089095 GTGTGGGTGCAGAGGGAATATGG - Intergenic
902669145 1:17960519-17960541 CTGTGTGTGCAGAAGGAATGTGG - Intergenic
902792570 1:18778951-18778973 CTGGGAGTTCAGTGGGAATATGG + Intergenic
909226661 1:73033199-73033221 CTGAGTGATCACAGCCAATAAGG - Intergenic
911164618 1:94713725-94713747 CTGGGAGAACAGAGAGAATAAGG - Intergenic
915682497 1:157595256-157595278 CTATGTCATCAGTGGGAATGGGG + Intronic
916171765 1:162006540-162006562 CTGTGTGCTCTGAGCGAAGATGG - Intronic
917994125 1:180417281-180417303 GTGTTTGAGCAGAGGGAATGTGG - Intronic
918665407 1:187145033-187145055 GTGTGGGGTCAGGGGGAATATGG - Intergenic
918912820 1:190595529-190595551 CTCTGTTATGAGAAGGAATAGGG + Intergenic
920180518 1:204129455-204129477 GTGTCTCAGCAGAGGGAATAAGG - Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
1062919764 10:1271034-1271056 CTGTGTGACCAGCTGGGATATGG + Exonic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1068446064 10:57125308-57125330 CTGTGTGATAACATGGTATAAGG - Intergenic
1068959593 10:62853139-62853161 CTGTGTGGTCAGAGGAACTGAGG - Intronic
1072705153 10:97675693-97675715 CTCTGTGATCAGAAGGAAATTGG + Exonic
1076182188 10:128418944-128418966 CTCTGGGATCAGAGGGAATGAGG + Intergenic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1080551927 11:33379967-33379989 CTGTGTGATCAGAGCTAATGAGG + Intergenic
1081224480 11:40503123-40503145 CTGTGTGTTTAGAGGGAGAAAGG - Intronic
1082873209 11:57962552-57962574 CTGTGTGATCAGAAGAAAATTGG - Intergenic
1085602473 11:77867715-77867737 CTGTGTCAGCAAAGGGGATATGG - Intronic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1087982706 11:104635931-104635953 CCATGTGATCAGAGGAAAGATGG - Intergenic
1088305758 11:108405636-108405658 CTATGTGTTCAGTAGGAATATGG + Intronic
1089054348 11:115573074-115573096 ACGTGTGAACAGAGGGAAAACGG + Intergenic
1090022236 11:123138107-123138129 CTGTCTCATCCGAGGGAATTAGG - Intronic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090803644 11:130189539-130189561 CTGTGAGAGCAGAGGGCAAAGGG + Intronic
1091215725 11:133900255-133900277 CTGAGTGATGAGCAGGAATAAGG + Intergenic
1092059484 12:5536802-5536824 ATGTGAGAACAGAGGGAAAATGG + Intronic
1092740431 12:11623448-11623470 TTGTGTTGCCAGAGGGAATAGGG - Intergenic
1093722769 12:22463508-22463530 CTGTGTTATCACAGGGCAGAAGG - Intronic
1096795970 12:54077776-54077798 CTCTGTGCCCAGAGGGAATTAGG + Intergenic
1098869870 12:75804743-75804765 CTGTTTGATCAGATGAAGTATGG + Intergenic
1099347424 12:81520074-81520096 CTATGTGATAAGATGGAATGAGG + Intronic
1100955501 12:99903455-99903477 CTCTGTAATTGGAGGGAATAAGG + Intronic
1101919917 12:108924105-108924127 CTGTGTCCTCAGATGGCATAAGG - Intronic
1102667459 12:114587608-114587630 CTTTGAGAACAGAGGAAATAGGG + Intergenic
1103931131 12:124451688-124451710 GTGAGTGATCAGATGGAACAGGG + Intronic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1104907523 12:132221752-132221774 CTCTGTGATCAGAGGAATTCGGG + Intronic
1112646657 13:101340433-101340455 CTGTGTTATTTGAGGGAAAATGG - Intronic
1112911217 13:104486301-104486323 CTGTGTGATCGGAGGTATAAAGG - Intergenic
1113005589 13:105698446-105698468 CAGTGTGCTCTGTGGGAATATGG - Intergenic
1113396302 13:109950796-109950818 CTTTGGGATGATAGGGAATATGG - Intergenic
1114033541 14:18597938-18597960 CTGTGGGGTCAGTGGTAATATGG - Intergenic
1114078329 14:19177134-19177156 CTGTGGGGTCAGTGGTAATATGG - Intergenic
1114125160 14:19717413-19717435 CTGTGGGGTCAGTGGTAATATGG + Intergenic
1114903697 14:27099182-27099204 CTGGGTGACCAGAGGTACTATGG + Intergenic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1117785337 14:59278181-59278203 CTGTGTGATCAGATGAAGTGAGG + Intronic
1118295675 14:64566706-64566728 ATGTGTGTGCAGAGGGAATGGGG - Intronic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1120386099 14:83847819-83847841 CTGTTTGTTCAGAGGTACTATGG + Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1124367321 15:29081292-29081314 CTGTGGGACCAGAGGGGATGTGG + Intronic
1125065430 15:35479199-35479221 CTGTGTGACCAGAGGAAAACTGG + Intronic
1126333059 15:47554842-47554864 CTGTGTTCTCAGGGGGATTATGG + Intronic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129174826 15:73832463-73832485 CTTTGGGAGCAGAGGGAATATGG - Intergenic
1129538398 15:76332606-76332628 CTGTTTGCTCAAAGGGAATCTGG + Intergenic
1130144519 15:81263746-81263768 CTTTGGGTTCAGAGGGAATGAGG - Intronic
1133130425 16:3673299-3673321 CTGTGTGCTCAGAGGGCAGCAGG + Intronic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1134368882 16:13605161-13605183 CTTTATGATCAGAAAGAATAGGG + Intergenic
1135387781 16:22059287-22059309 CTGTCTGTTCAGATGTAATAAGG + Intronic
1135391977 16:22101278-22101300 CTGTGTCATCCAAGGGACTATGG - Intronic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140578614 16:76202368-76202390 ATGTATGATCAGATGGAACAGGG + Intergenic
1143741058 17:8954400-8954422 CTGTGTTTTCAGAGGGAGTAAGG - Intronic
1144798307 17:17907532-17907554 CTGTGAAATCAGAGAGAAAATGG + Intronic
1146297139 17:31659114-31659136 CTGTGTGCTCACATGGAATGGGG + Intergenic
1148521048 17:48275273-48275295 CAGGGAGATCAGAGAGAATAAGG - Intronic
1153063558 18:1019397-1019419 CTGTGGCCTCAGAGGAAATATGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1158010107 18:52718984-52719006 CTGAGTTTTCAGAGGGAAAATGG - Intronic
1160297880 18:77654580-77654602 CTGTGTGATGAGAGGGAGAGCGG - Intergenic
1160344311 18:78120208-78120230 CTGTGATATGAGAAGGAATAAGG + Intergenic
1162327107 19:10005986-10006008 CTGGGTGGGCAGAGGGAACAAGG + Intronic
1163371453 19:16903491-16903513 CTGTGTGATTGGAGGGAATGGGG + Intronic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
1164908032 19:31983611-31983633 CTATGTGATGGGAGGGAAAAAGG + Intergenic
1167790639 19:51677099-51677121 GTGTGTGATTAGGTGGAATAAGG - Intergenic
926052440 2:9753717-9753739 CTGTGTGCTAAGAGGGAAGCTGG + Intergenic
928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG + Intronic
929682454 2:44005229-44005251 TGGTGTGTTCAGAGGGCATAGGG - Intergenic
930393458 2:50790120-50790142 GTGTGTGGTGGGAGGGAATAAGG - Intronic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
935689837 2:105721033-105721055 CTGTGTGCTCACAGGGCAGAAGG + Intergenic
936625135 2:114140736-114140758 TTGTGTGATGAAAAGGAATAGGG - Intergenic
936789223 2:116131080-116131102 TTTAGTGATCAGAAGGAATAAGG - Intergenic
937251200 2:120524894-120524916 CTGTGAGGTCAGAGGGAACCAGG - Intergenic
939228416 2:139393805-139393827 CAGTGTGATCAGAGGATATTTGG - Intergenic
939575723 2:143892722-143892744 CAGTGTCATCAGTGGGAAAAGGG + Intergenic
939824395 2:146997548-146997570 CTGTTTGATCAGAGAGTATCAGG + Intergenic
939953991 2:148509656-148509678 CTGTGTGATCAGAGGAAGGGCGG - Intronic
945762469 2:213931018-213931040 CTGAGCGAACACAGGGAATAAGG - Intronic
946648585 2:221867724-221867746 TAGCGTTATCAGAGGGAATATGG + Intergenic
948304353 2:236935636-236935658 CTGTGTTCTCAGAGGAAATGGGG - Intergenic
1171150022 20:22819675-22819697 GTATGTGATAAGAGGGAATTTGG + Intergenic
1173507394 20:43598845-43598867 CTTTGTGCTGAGAGAGAATATGG + Intronic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1174548409 20:51343670-51343692 CAGTGGGATCAGAGGGGTTATGG + Intergenic
1175377802 20:58541421-58541443 CTGTGTGATCAGATATAATTTGG - Intergenic
1177551935 21:22634448-22634470 CTGTGTTTTCACAGGGAAAAGGG + Intergenic
1178134257 21:29609275-29609297 CTGAGTGGTCAGGGAGAATAAGG - Intronic
1180457655 22:15524997-15525019 CTGTGGGGTCAGTGGTAATATGG - Intergenic
1180678252 22:17603876-17603898 CTGTGTGACCAGTGTGGATAGGG - Intronic
1181884467 22:26009215-26009237 TTCTGAGACCAGAGGGAATATGG - Intronic
1183030920 22:35103944-35103966 CTGTGTGACCCCTGGGAATAGGG + Intergenic
1183989900 22:41590683-41590705 ATGTGTGGACAGAAGGAATAAGG - Intergenic
1184290994 22:43498168-43498190 CAGGGTGGTCAGAGGGAATGCGG - Intronic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
951161033 3:19422754-19422776 CTTTGTGAACATAGGGATTATGG - Intronic
951712038 3:25592898-25592920 CCGTGTGATCAGAGGCATCATGG + Intronic
952682988 3:36117303-36117325 CAATGTGATCAGAGGGAAAGAGG + Intergenic
954960204 3:54557917-54557939 CTCAGTGATCTGAAGGAATAAGG + Intronic
958263502 3:91409464-91409486 CTGGGAGCTCAGAGGGATTAGGG + Intergenic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961691037 3:128669692-128669714 CTGTATGATCACAGGGTAGATGG + Intronic
963990326 3:151645961-151645983 CTCTGTGAACAGAGGGAATAGGG - Intergenic
968248131 3:197176224-197176246 GTGTGTGAGCAGGGGGCATATGG - Intronic
970347707 4:15169652-15169674 TTGTTTGATCAAAGGGAACAGGG + Intergenic
971096320 4:23408803-23408825 CTGTGTGATCAGGAAGAAAATGG + Intergenic
971492091 4:27223887-27223909 TTGTGAGTTCAGAGGGAACACGG + Intergenic
972580521 4:40391715-40391737 TTTTGTGACCAGAGAGAATAAGG + Intergenic
976155789 4:82143468-82143490 TAATGTGTTCAGAGGGAATAGGG + Intergenic
976894044 4:90085708-90085730 CTGAGAGAGAAGAGGGAATAGGG - Intergenic
978144576 4:105356800-105356822 CTTTGTTATCACAGAGAATATGG - Intergenic
979166299 4:117535914-117535936 CTGTGTGATCAGAAAGATTTAGG - Intergenic
980903296 4:138925458-138925480 CTGGGAGATCAGATGGATTAAGG + Intergenic
981037391 4:140186835-140186857 CTGTGTCATCAGTGGGTATATGG + Intergenic
981602024 4:146500722-146500744 CTCTGTGATGAAAGGGAAAAGGG - Intronic
988921235 5:35944866-35944888 TTGTGTGGTCTGAGGTAATAAGG + Intergenic
989135381 5:38149305-38149327 CTGTGTGATCTTAGGCAACAAGG - Intergenic
989723315 5:44554991-44555013 CTGTGAAAACAGAGGGAATTAGG + Intergenic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
993147960 5:84120502-84120524 CTGTGTCATCTGAAGGAGTAAGG - Intronic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
996021534 5:118595948-118595970 CTGTGTGAAGACAGGGAACATGG - Intergenic
997430090 5:133831628-133831650 CTGAGTAATCAGAGGATATAAGG - Intergenic
998011991 5:138702854-138702876 CTGTGTGTTCTGAGGGAGTAAGG + Intronic
999148550 5:149411896-149411918 CTGTGTGCCCAGAGGGATAATGG - Intergenic
999791049 5:154939606-154939628 CTAGGTGATCAGAGGAAAAAGGG + Intergenic
999925024 5:156366178-156366200 CTGTGTGAAGAGAGGGCATGTGG + Intronic
1001723939 5:173880766-173880788 CTGTGTGATGACAGGGACTGTGG + Intergenic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002679771 5:180952066-180952088 CTGTGTGGGCAGAGGGTATATGG - Intergenic
1005042726 6:21613872-21613894 CTGTCTCATCAGAGGCAAAAAGG + Intergenic
1005818054 6:29573707-29573729 ATGTTTGATCAGAAGGAACAGGG + Intronic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006812198 6:36827224-36827246 GTGTGGGATCAGAGGGTGTAGGG - Intronic
1006960962 6:37929578-37929600 CTGTATGAAAAGAGGGAATGTGG + Intronic
1008513425 6:52298084-52298106 CTGTGTGAGCAAAGGCAATTGGG - Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1013424030 6:109994462-109994484 TTGTGGCATCAGAGGGAATCAGG + Intergenic
1013796603 6:113895851-113895873 CTCTGTGATCATGGGAAATAGGG - Intergenic
1014729755 6:125019073-125019095 CTCTGTGATCAGAGGCAAGCGGG - Intronic
1015118167 6:129671965-129671987 CTGTGTTCTCAGAGGCAAAATGG - Intronic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1017352253 6:153456217-153456239 CTGTGGGATCAGTGGTGATATGG + Intergenic
1021528487 7:21616830-21616852 CTCTGTCTTCAGAGGGCATACGG - Intronic
1022148244 7:27569804-27569826 CTCTCTGATCAGAGGAACTATGG - Intronic
1023728453 7:43167614-43167636 ATGTGTGTTCAGGAGGAATAAGG + Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023885352 7:44349960-44349982 CTGTGTGCTTATGGGGAATAGGG - Intergenic
1024634947 7:51279531-51279553 GTGTAAGGTCAGAGGGAATACGG - Intronic
1028321287 7:89463166-89463188 CTGTGGGATCAGTGGTGATATGG + Intergenic
1030292928 7:107890132-107890154 CTTTGTAATCAGATGGAATGAGG + Intergenic
1031136448 7:117889559-117889581 CTGTGTGATCAAACGGCATTTGG - Intergenic
1033514665 7:142094243-142094265 CTGCGTGATTGGAGGGAACACGG - Intronic
1034315357 7:150126034-150126056 CTGTGTCATCAGAGAGACTCTGG - Intergenic
1034791537 7:153974760-153974782 CTGTGTCATCAGAGAGACTCTGG + Intronic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1037017169 8:13923408-13923430 ATGTGGGAACAGAGGGCATAAGG - Intergenic
1037643291 8:20768329-20768351 CTGTGTTATCTGAGTCAATAGGG - Intergenic
1040448695 8:47522496-47522518 CTGTGAGCTCAGAGGGAAAGAGG + Intronic
1041403904 8:57474850-57474872 CTGTGTCGTCACATGGAATAAGG + Intergenic
1041854286 8:62432839-62432861 CTTTGGGATCAGTAGGAATAAGG - Intronic
1044566352 8:93664918-93664940 CTGTGATATTAGAAGGAATATGG - Intergenic
1045363436 8:101453894-101453916 CTCTGTGATCACTAGGAATAGGG + Intergenic
1048243188 8:132764824-132764846 CTGTGAGATCTCAGAGAATAAGG + Intergenic
1048754531 8:137722308-137722330 GTGTGTGGGCAGAGGGCATATGG + Intergenic
1051596338 9:18827658-18827680 CTGTGTTAGCAGAGACAATAAGG - Intronic
1051713906 9:19961722-19961744 CTATGTCATAAGAGGTAATATGG + Intergenic
1052998451 9:34564330-34564352 CTATGTTGTCAGAGGGAATAGGG + Intronic
1053010873 9:34632385-34632407 ATGTCTGATCAGAGGAAACATGG + Intergenic
1054812347 9:69444927-69444949 GTGTGTGATTAGAGAGAAAAGGG - Intronic
1056037947 9:82628891-82628913 CTTTGTGATCAAAGGTAATTGGG - Intergenic
1056408800 9:86303970-86303992 CTGGGAGTACAGAGGGAATAGGG + Intronic
1058621262 9:106885863-106885885 TTATGTGATGACAGGGAATAGGG - Intronic
1058982116 9:110179741-110179763 CTCAGTGATCAGAGGGTATTGGG + Intergenic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1060439838 9:123628177-123628199 ATGTGAGCTCAGTGGGAATAAGG + Intronic
1060622538 9:125081130-125081152 CTTTGTGAGCAGAGTGAAAATGG + Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1062713441 9:137989300-137989322 GGGTGTGATCAGAGAGAGTATGG + Intronic
1186383536 X:9086316-9086338 CTGTGTGATTTCAGGGAATTAGG - Intronic
1187437241 X:19283824-19283846 CTGTGTCATCAAAGAGAAAATGG + Intergenic
1187677829 X:21735532-21735554 CTGTGTGATTACAGGGAACAAGG - Intronic
1187921841 X:24211079-24211101 TTGTGTGAACTGAGAGAATATGG - Exonic
1189157218 X:38770666-38770688 ATTTGTGATCAGATGAAATATGG - Intergenic
1189311615 X:40022819-40022841 CTGTGAGCTCAGATGGAAAAAGG + Intergenic
1192170359 X:68851057-68851079 CCCTGTGATCAGAGGGACTCTGG + Intergenic
1197865758 X:131014984-131015006 GTGTGGGAGCAGAGGGTATATGG - Intergenic
1199356975 X:146874332-146874354 CCATGTAAGCAGAGGGAATATGG - Intergenic
1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG + Intergenic
1199604033 X:149562442-149562464 CTTTGGGATAAGAGGGAATGGGG + Intergenic
1200421966 Y:2979696-2979718 TTGTGTGAACTGAGAGAATATGG - Exonic
1200877090 Y:8168563-8168585 CTGTATGAACAAAGGGAATCAGG + Intergenic
1201353746 Y:13075067-13075089 CTGTGGGATCAGTGGTGATATGG - Intergenic
1202104088 Y:21343706-21343728 CTATGTGAACAAAGGGAATCAGG + Intergenic
1202602607 Y:26609670-26609692 ATTTGTGATCAAAGGGAAAATGG - Intergenic