ID: 1086207306

View in Genome Browser
Species Human (GRCh38)
Location 11:84274925-84274947
Sequence ATGGAGAAGAAGCATGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 410}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086207306 Original CRISPR ATGGAGAAGAAGCATGTGGC TGG (reversed) Intronic
901435380 1:9244449-9244471 ATGGAGAAGAGGCAAGTGAGAGG + Intronic
902606026 1:17569815-17569837 ATGAGTCAGAAGCATGTGGCCGG - Intronic
903086225 1:20862027-20862049 AAGGAGAAGAAGCACGTAACTGG + Intronic
903806514 1:26009568-26009590 ATTGAAAAGAAGTTTGTGGCAGG + Intergenic
903857116 1:26344013-26344035 ATGATGAAGAAGCATGTAGCAGG - Exonic
904076891 1:27850087-27850109 CTGTAGAAGAAGCGTGTGGAGGG + Exonic
904832324 1:33312981-33313003 ATGCAGAAGAACCAGCTGGCTGG - Intronic
905430621 1:37920366-37920388 ATACAAAAGAAGAATGTGGCCGG + Intronic
907547456 1:55274699-55274721 ATGGAGAAGAGGGAGGTAGCAGG - Intergenic
907974317 1:59416174-59416196 GTGGGGAAGAAGCATGTATCAGG + Intronic
908783106 1:67709514-67709536 AGGAGGATGAAGCATGTGGCAGG + Intronic
909398515 1:75198059-75198081 ATGGTGAGGAAGCATGAGACAGG + Intergenic
910295559 1:85641842-85641864 ATGCAGAAAAAGCATGTGACAGG + Intergenic
910370724 1:86512787-86512809 TTGGGGAAGAGGCATGTGGATGG + Intergenic
910744760 1:90561521-90561543 ATGGAGATGAAACCTGTGACTGG + Intergenic
910790422 1:91044399-91044421 TTGGGGAAGAGGCATGTGGATGG + Intergenic
910793269 1:91072989-91073011 AAGAAGAAGAAGAATGTGACTGG + Intergenic
910831010 1:91462765-91462787 TTGGGGAAGAGGCATGTGGATGG - Intergenic
910948303 1:92617366-92617388 TTGGAGAAGAGGTATGTGGATGG + Intronic
910964228 1:92791938-92791960 ATGGAGAAGAAGAAAATGACTGG - Intronic
911738306 1:101361275-101361297 CTGGGGAAGAGGTATGTGGCTGG - Intergenic
912067108 1:105757612-105757634 TTGGGGAAGAAGTATGTGGTTGG + Intergenic
912703404 1:111895048-111895070 AGGGAGAGGAAGCATGAGGGAGG + Intronic
912731693 1:112112621-112112643 TTGGAGAAGATGCAAGTGGCTGG - Intergenic
912795166 1:112688945-112688967 ATGGAGGAGAAGCCAGGGGCGGG - Exonic
913196095 1:116457476-116457498 ATGAAGCAGCAGCAGGTGGCGGG - Intergenic
913539406 1:119804386-119804408 ATGGCATAGAAGGATGTGGCTGG - Intronic
916005427 1:160655065-160655087 ATGGAGAAGAGGCAAGTGGATGG - Intergenic
916652079 1:166842094-166842116 ATTGGGAAGAAGGATGTGGTGGG - Intronic
916883607 1:169046152-169046174 ATGCAGAAGGACCATGTGGTGGG - Intergenic
918183898 1:182110557-182110579 AAGGAAGAGAAGCATGTGACAGG + Intergenic
919241860 1:194924860-194924882 TTGGAGAAGAGGTATGTGGATGG + Intergenic
919811088 1:201409200-201409222 TTGGAGAAGAAGCATGAAGCAGG + Exonic
920249060 1:204610337-204610359 ATAAAGAACAAGCATGTGGATGG - Intergenic
920308542 1:205034274-205034296 ATGGAGAGGGAGCATGAGCCAGG - Intergenic
920326181 1:205166200-205166222 ATGGAGAAGAACTGGGTGGCTGG + Intronic
920841939 1:209562418-209562440 ATGAAGAAAAAGCAGGTGGGTGG + Intergenic
921220252 1:212968627-212968649 AAGGAGATGAAACATGTGCCTGG + Intronic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923253487 1:232198794-232198816 TTGGGGAAGAAGTATGTGGATGG - Intergenic
923419316 1:233797165-233797187 ATGCAGAAGAGTTATGTGGCAGG - Intergenic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
924248351 1:242106866-242106888 ATGGAGAAGAAGAGTGTTGTAGG + Intronic
1063359402 10:5439047-5439069 TTGGAGAAGAGGCATATGGATGG - Intronic
1063718438 10:8553716-8553738 ATGGAGAAGAAGAATTCGGGTGG + Intergenic
1064265744 10:13823888-13823910 CTGGAAAAGTAGCAAGTGGCTGG - Intronic
1068447288 10:57139252-57139274 GTGGGGAAGAGGCATGTGGATGG + Intergenic
1069946362 10:71988611-71988633 ATGTACAAGAAGCATGGTGCTGG - Intronic
1070313551 10:75291110-75291132 ATGGAGAAAAAGCATGTGTCAGG + Intergenic
1071112001 10:82170316-82170338 AGAGAGAGCAAGCATGTGGCCGG + Intronic
1071359999 10:84837217-84837239 ACCCAGGAGAAGCATGTGGCTGG + Intergenic
1072426418 10:95334441-95334463 ATGGAGAAGGGGCTTGTGCCAGG + Intronic
1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG + Intronic
1073918387 10:108431672-108431694 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1075719163 10:124574925-124574947 CTGGAGAAGCATCATCTGGCTGG - Intronic
1075922207 10:126223316-126223338 AGGGAGCAGAAGAATGTGACAGG - Intronic
1076007594 10:126960254-126960276 ATGGAGAAGATGCAGGTGTGAGG + Intronic
1076210005 10:128632676-128632698 GGGGAGAATAAGCAGGTGGCTGG + Intergenic
1078151219 11:8761083-8761105 GTGGAGAAGGACCATCTGGCAGG - Intronic
1079311086 11:19366486-19366508 TGGGTGAGGAAGCATGTGGCTGG + Intronic
1080609068 11:33888254-33888276 ATGGGGCAGAAGCATAAGGCTGG - Intronic
1080969223 11:37250063-37250085 AAGGAAAAGAAACATGTGGAAGG + Intergenic
1081962563 11:47149094-47149116 GTGGAGAAAGAGCACGTGGCTGG - Intronic
1082671779 11:56043675-56043697 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1084597226 11:70124174-70124196 ATGGGAAAGAAGCTTCTGGCAGG - Intronic
1084919061 11:72454441-72454463 CAGGGGAAGAATCATGTGGCTGG + Intergenic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1088360550 11:108984766-108984788 ATGGAGCAGAAGCATGGGCCTGG + Intergenic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1089733022 11:120531362-120531384 ATGGAGCAGGTGCCTGTGGCAGG - Intronic
1090119112 11:124005762-124005784 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1090275605 11:125417240-125417262 AAGGAGCAGAATCACGTGGCAGG - Intronic
1090905556 11:131071618-131071640 ATCAAGAAGAAGCTTGTGGCTGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091747369 12:3000939-3000961 ATGGTGAAGAAGCGGGGGGCAGG - Intronic
1091909514 12:4217661-4217683 ATGAAGAAGAACCATGTGTTGGG - Intergenic
1092052945 12:5485869-5485891 AGGCAGAAGAAACATGTGTCTGG - Intronic
1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG + Exonic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092140248 12:6178816-6178838 ATGGAGAAGCGTCATGGGGCAGG + Intergenic
1092222687 12:6725892-6725914 ATGAAAAAGAAGCACTTGGCTGG + Intronic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1094574347 12:31670236-31670258 AGGGAGCAGAAGCCTGTTGCTGG - Exonic
1095306716 12:40647140-40647162 ATGGATAAGAAGCCTGTTGGAGG - Intergenic
1095950385 12:47778481-47778503 GTGGAGGAGGAGCATGGGGCAGG + Intronic
1096072854 12:48785156-48785178 ATGGAGAAAAAGCATAAAGCTGG - Intronic
1096813005 12:54183566-54183588 GTGGAGAAGGAGCATGTGCATGG - Intronic
1097176951 12:57148838-57148860 ATGGGGAAGAAGGAGGTGGCTGG + Intronic
1097661746 12:62437563-62437585 TTGGAGAGGCAGCATGTGTCTGG + Intergenic
1097828942 12:64203375-64203397 CTGGAGAAGGAGCATGTATCAGG - Intronic
1098716185 12:73830441-73830463 TTGGGGAAGAGGTATGTGGCTGG + Intergenic
1098831817 12:75373397-75373419 TTGGAGAAGAGGTATGTGGATGG - Intronic
1098890962 12:76010531-76010553 GTGGAAAAGAAGGAGGTGGCAGG - Intergenic
1100011671 12:89961327-89961349 TTTGAGAAGATGCATGTGACAGG - Intergenic
1100401625 12:94235382-94235404 ATGGAGAAGAAGCATTTACTTGG + Intronic
1100450756 12:94703779-94703801 TTGGAGAGGAAGCATATGGGTGG + Intergenic
1100575135 12:95883860-95883882 ATGCAGAAAAGGCATTTGGCAGG + Intronic
1102606634 12:114072836-114072858 ATGGAGAATAAGCAGGTAACAGG - Intergenic
1103447424 12:121003320-121003342 AAGAAGTAGAAGCTTGTGGCCGG - Intronic
1103894425 12:124263703-124263725 AAGGAGATGAAGAATATGGCAGG - Intronic
1104311581 12:127658005-127658027 ATGTACAAGAAGCATGATGCTGG - Intergenic
1105572944 13:21621179-21621201 AGAGAGAAGAAGCAAGTGGTAGG - Intergenic
1105609523 13:21955767-21955789 ATGGAGATGAGGCATTTGCCGGG - Intergenic
1105985858 13:25566522-25566544 ATGGAAAAGGAGAAAGTGGCAGG + Intronic
1106792254 13:33167594-33167616 AGGCAAAAGAAGCATGTGACTGG - Exonic
1106878689 13:34105263-34105285 ATTGAAGAGAAGGATGTGGCCGG + Intergenic
1107618999 13:42205437-42205459 ATGGAAAAAAAGGATATGGCTGG - Intronic
1108152958 13:47555577-47555599 TTGGAGAAGCAGCATGGTGCAGG - Intergenic
1109142023 13:58725296-58725318 ATGGAGAAGGAGCTGGTGGCAGG + Intergenic
1109232092 13:59769748-59769770 ATGGGGAAGAAGTATATTGCGGG - Intronic
1110863971 13:80374494-80374516 ATGGAGAAGAAACATGAACCGGG + Intergenic
1111913980 13:94342105-94342127 AGTGAGAAGAAGCATCTGGGAGG - Intronic
1112460845 13:99602550-99602572 ATGGGAAAGAAGGATGGGGCGGG - Intergenic
1113139736 13:107133902-107133924 CTGGAGAAGAAGCATTTAGAAGG - Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113319613 13:109221040-109221062 TTGGGGAAGAAGTATGTGGATGG - Intergenic
1113639917 13:111949856-111949878 ATGGGGAAGAAGGATGAGCCAGG + Intergenic
1115023219 14:28708418-28708440 TTGCAGAAGAAGCATGTGGATGG + Intergenic
1116241299 14:42346557-42346579 TTGGAGAGGAGGCATGGGGCTGG + Intergenic
1116531374 14:45977607-45977629 TTGGAGAAGAGGCATGTGGATGG - Intergenic
1117488877 14:56226259-56226281 ATGGAGAAGCAGCCTGGGCCTGG - Intronic
1117642014 14:57810131-57810153 ATGGAGGAGGGGCATGTGACAGG - Intronic
1120464439 14:84838764-84838786 AAAGAGAAGCAGCATGTGGTTGG + Intergenic
1120826276 14:88958507-88958529 TTTGATAAGAATCATGTGGCAGG + Intergenic
1121378257 14:93433915-93433937 ATGAAGGAGAAGCTAGTGGCCGG + Intronic
1121436404 14:93923379-93923401 AGTGAGAAGAGGCATCTGGCAGG - Intronic
1121939263 14:98054129-98054151 ATGTAGAAGAATCATCTGGTTGG - Intergenic
1122268618 14:100558329-100558351 AGGGAGAGGCAGCATGTGCCTGG - Intronic
1122341134 14:101029212-101029234 GTGGTCAAGAAGCAGGTGGCTGG - Intergenic
1124337085 15:28865619-28865641 CTGTATAAGAAGCATGGGGCTGG - Intergenic
1124468104 15:29958323-29958345 CTGGATAAGTAGCATGTAGCTGG + Intronic
1127757339 15:62105346-62105368 AGGGAGAAGGAGCAGGTGGCAGG + Intergenic
1128355689 15:66925001-66925023 ATGGAAAAGAGGCGTGTGGGAGG + Intergenic
1128932780 15:71720345-71720367 ATGTTAAAGAAGCATATGGCTGG - Intronic
1129151855 15:73694145-73694167 CTGGAGATGAAGCACGTGGAGGG - Intronic
1130635142 15:85611372-85611394 ATGCAGCAGAAGTAGGTGGCAGG - Intronic
1130963680 15:88681838-88681860 ATGGATCAGCAGCCTGTGGCCGG + Intergenic
1131445467 15:92495206-92495228 GTGGGGAGGAATCATGTGGCAGG - Intronic
1131868820 15:96740514-96740536 ATGGAGTAGAAGGGTGTGGAAGG - Intergenic
1132305519 15:100809121-100809143 ATGGTAAAGAAGAATGTGTCTGG - Intergenic
1132906777 16:2286541-2286563 ATGGTGGAGGAGGATGTGGCAGG + Intronic
1134001591 16:10787139-10787161 ATGGAGCAGGAGCGTGGGGCTGG - Intronic
1134410274 16:13998208-13998230 ATGCAGAGGAAGCCTTTGGCAGG + Intergenic
1135791912 16:25404698-25404720 ATTGAGAAACATCATGTGGCAGG - Intergenic
1136398297 16:30004835-30004857 AGGGAGAGGAAGCTGGTGGCAGG + Intronic
1137610715 16:49815418-49815440 ATGAAGCAGAAGCAGGTGCCAGG - Intronic
1137738685 16:50743091-50743113 ATTGAGGAGAAGAAGGTGGCAGG - Intronic
1138033358 16:53578845-53578867 CTGGAGAAGAAGCATGGGAAGGG - Intergenic
1138552390 16:57754808-57754830 ATGGAGCAGGAGCATGGGGGAGG - Intronic
1139749980 16:69103936-69103958 ATGGAGAAGAAGCCTTAGGTTGG - Intergenic
1140918076 16:79511583-79511605 ATGCACAAGAAGCATGTTACTGG + Intergenic
1141535384 16:84676248-84676270 CTGGAGAAGAGACATGTGGATGG + Intergenic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143864259 17:9912439-9912461 ATGGACAAGAAGGCTGGGGCTGG - Intronic
1143988520 17:10936606-10936628 ATGGAAAAAAATCATGTGGGTGG + Intergenic
1144326020 17:14181056-14181078 ATGGAGACCAACCATGTGGAGGG + Intronic
1144474893 17:15577944-15577966 ATGGAGACCAACCATGTGGAGGG + Intronic
1144965153 17:19072501-19072523 ATGGATAGGAAGTATGTGGCTGG - Intergenic
1144982814 17:19179679-19179701 ATGGATAGGAAGTATGTGGCTGG + Intergenic
1144985409 17:19198560-19198582 ATGGATAGGAAGTATGTGGCTGG - Intergenic
1146775377 17:35609783-35609805 ATGGAGAATTAGAATTTGGCTGG + Intronic
1147253472 17:39167192-39167214 AGGGAGAAGCCCCATGTGGCTGG - Intronic
1148185668 17:45641714-45641736 AAGGCCAAGCAGCATGTGGCAGG + Intergenic
1148937273 17:51173476-51173498 ATGGACCAGATGCATGGGGCAGG - Intergenic
1149127076 17:53247862-53247884 ATGGAGAAAAAGTATTTGTCAGG + Intergenic
1149161694 17:53701346-53701368 ATGGAGATGGAGCAAGTGGTAGG + Intergenic
1149586426 17:57790744-57790766 GTGGAGAAGAAGAAAGTGGGTGG - Intergenic
1149952248 17:61001650-61001672 ATGGAGAAAAATCTTGTGGGGGG + Intronic
1151223989 17:72635024-72635046 ATGGACAAGCAGCATGGCGCTGG - Intergenic
1151243433 17:72776004-72776026 AGGGAGAGGGAACATGTGGCAGG - Intronic
1151249236 17:72820816-72820838 AGGGAGGAGAAACATGTGGATGG + Intronic
1151303856 17:73250114-73250136 GTGCAGAAGTAGCCTGTGGCAGG - Intronic
1151815392 17:76469163-76469185 ACGGAGATGAAGGCTGTGGCAGG - Exonic
1153519199 18:5936108-5936130 AAGCAGAAGAAGCATGCAGCCGG + Intergenic
1153886581 18:9473594-9473616 ATGGAGAAGAACCTTGTGTTTGG - Intergenic
1154146908 18:11874189-11874211 ATGGAGATGACGCATGCTGCTGG - Intronic
1154261935 18:12842633-12842655 AGGGACATGAAGAATGTGGCTGG + Intronic
1154266336 18:12882584-12882606 CTGGAGAAGATGCAGCTGGCAGG + Intronic
1154341954 18:13510858-13510880 ATGGAGAGGATTAATGTGGCTGG + Intronic
1155119629 18:22805070-22805092 AAGGAGAAGGAGCATGTGTAAGG + Intronic
1155740447 18:29282353-29282375 GTTCAGAAGAAGCATGTGGATGG - Intergenic
1156490214 18:37491647-37491669 AGGGAGAAGGAGTGTGTGGCAGG + Intronic
1156961092 18:43031944-43031966 ATGTAGCAGAAGCAGGTGGAAGG + Intronic
1157442843 18:47723512-47723534 ATGGAGAAGGAGGATGGAGCTGG - Intergenic
1158718492 18:59900851-59900873 ATTTAGAAAAAGCATGGGGCCGG - Intronic
1159978281 18:74743153-74743175 CTGGAGAAGAAGCAAGTTACAGG + Intronic
1160034342 18:75286917-75286939 AAGGAGAAGCCGCCTGTGGCTGG + Exonic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1160877910 19:1305945-1305967 CTGGGGAAGAAGCAGGTGTCAGG - Intergenic
1161044558 19:2128315-2128337 ATGGAGAAGAGTCTAGTGGCCGG + Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1164081136 19:21862346-21862368 ATGGAGGTGAAGGATGTGGAAGG - Intergenic
1164305927 19:24003856-24003878 AGGGAGGAGCAGCATTTGGCCGG + Intergenic
1164465865 19:28487093-28487115 CTAGAGAAGAGGCCTGTGGCTGG + Intergenic
1164870569 19:31640081-31640103 AGGGAGAAGACGGATCTGGCTGG + Intergenic
1165834256 19:38744593-38744615 ATGGAGAAGAAACATGAAGGCGG - Intronic
1165856815 19:38883878-38883900 AGGGAGGAGAAGCAAGTGGCAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167763090 19:51461728-51461750 AGGGAGAGGAACCATGGGGCTGG - Intergenic
1168132969 19:54332522-54332544 ATGGAGAAGGAGCCTATGGGTGG + Intergenic
1168133115 19:54333488-54333510 AAGGGGAAGAAGCATGGGTCAGG - Exonic
1168184268 19:54688145-54688167 ATGGAAAAGAAACATGGGGCAGG + Intronic
925242345 2:2342396-2342418 GTGCAGAAGAAGCATGTCTCAGG - Intergenic
925380382 2:3420827-3420849 ATACAGAAGAAGTGTGTGGCAGG + Intronic
925830562 2:7890034-7890056 ATGGACAAAAAGCATGTGTCGGG - Intergenic
925874754 2:8302275-8302297 TTGGAGAGGAAGCAGGTGGCCGG - Intergenic
926305942 2:11637299-11637321 ATGGAGCAAGAGCCTGTGGCTGG + Intronic
926538162 2:14140248-14140270 ATGGAGAGTAAGTATCTGGCAGG - Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926758539 2:16255308-16255330 ATGGAGAAAATGCATGTGTTAGG - Intergenic
926826854 2:16914297-16914319 TTGGGGAAGAAGTATGTGGATGG + Intergenic
927008798 2:18880353-18880375 TTGGGGAAGAAGTATGTGGATGG + Intergenic
927078788 2:19607506-19607528 ATGGAAGAGAAGCACGTGGTAGG - Intergenic
928374066 2:30760839-30760861 GGAGTGAAGAAGCATGTGGCTGG - Intronic
928385481 2:30863942-30863964 ATGGAGCAGAAATATGAGGCAGG + Intergenic
928407366 2:31024750-31024772 ATGGAGTAGAACCATATGCCAGG - Intronic
928708582 2:33979112-33979134 ATGGAGAATAAGTATGTTCCAGG + Intergenic
929089291 2:38198893-38198915 GTAGAGAAGTGGCATGTGGCAGG - Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
931552424 2:63461470-63461492 CTGTACAAGAAGCATGTTGCTGG - Intronic
931730819 2:65151884-65151906 CTGGAGAAGACGCAGGTGGGTGG + Intergenic
933258737 2:80108478-80108500 ATGGAGGAGTGGCATGTGCCAGG - Intronic
933264223 2:80165131-80165153 GAAGAGAAAAAGCATGTGGCTGG - Intronic
933323457 2:80806381-80806403 ATGTAGGAGGAGCCTGTGGCAGG + Intergenic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
935660221 2:105460464-105460486 ATGGAGAAGAAAAATGTAGGAGG + Intergenic
935816420 2:106850233-106850255 AAAGAGAAGAAGCACCTGGCAGG + Intronic
936772290 2:115928547-115928569 ATGGAGAAGAACCAAGTTGGAGG - Intergenic
937800460 2:126075754-126075776 TTGGAGAAGAGGTATGTGGATGG + Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938222210 2:129580151-129580173 CTGTACAAGAAGCATGGGGCTGG + Intergenic
938613844 2:132977441-132977463 TGTGAGAAGATGCATGTGGCAGG - Intronic
939619972 2:144406900-144406922 ATGGAGATGAAGGAAGTGTCTGG + Intronic
940004992 2:149002040-149002062 ATGGAGGAGGAGCCTGTGGAGGG + Intronic
941719649 2:168799773-168799795 AAGGACAAGGAGCAGGTGGCTGG - Intronic
943062459 2:183052877-183052899 CTGGAAAAGAAGCATCTGGAGGG + Intergenic
944195593 2:197050029-197050051 CTGTACAAGAAGCATGAGGCTGG + Intronic
945290853 2:208125960-208125982 ATGGAAAATAAACTTGTGGCTGG + Intergenic
945571033 2:211468018-211468040 ATGGAGATAAATAATGTGGCTGG + Intronic
946172991 2:217906300-217906322 GGGGAGAAGAAGGATGGGGCTGG - Intronic
946660944 2:221998706-221998728 ATGGGAAAAAAACATGTGGCTGG + Intergenic
947054071 2:226080449-226080471 AAGGGGAAGAAGGCTGTGGCAGG + Intergenic
947206779 2:227667986-227668008 ATGGAGAAAGGGCAGGTGGCAGG - Intergenic
947826957 2:233113084-233113106 ATGGGGAAGAAGCAGGAGCCAGG - Intronic
948787045 2:240358242-240358264 ATGGGGAACCAGCATGGGGCTGG + Intergenic
1168999467 20:2157063-2157085 ATGGAGAAGACACATGTGTTAGG + Intronic
1169044995 20:2528097-2528119 ATGGAGCAGAAGAAAGGGGCAGG + Intergenic
1169565214 20:6846658-6846680 AGGGAGAAAAAGCATATGGTTGG + Intergenic
1170874065 20:20234438-20234460 ATGGAGAAGAAGCAAGGGTTAGG + Intronic
1170879549 20:20284038-20284060 AAGGATAAAAAGCATGTGGTAGG - Intronic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1171489453 20:25506417-25506439 GTAGAGAAGAAGCCTGTGGCAGG - Intronic
1173670993 20:44798815-44798837 AGGGAGACGCAGCATGGGGCAGG - Intronic
1173781113 20:45758325-45758347 ATAGAAAGGAAGCATGTAGCAGG - Intronic
1176084639 20:63290382-63290404 ATGGGGAAGACGAAAGTGGCGGG + Intergenic
1177845126 21:26279914-26279936 ATGGATAATAAGGATGTGGGGGG + Intergenic
1178599392 21:33983085-33983107 ATGGAGAGCAAGCAGTTGGCTGG - Intergenic
1178661389 21:34510418-34510440 ATCGAGAAGGACCCTGTGGCTGG - Intergenic
1178889515 21:36509476-36509498 ATGGAGAAGATACATATGGTTGG + Intronic
1181989982 22:26829988-26830010 ATGGACATAAAGCAGGTGGCAGG + Intergenic
1182021847 22:27088323-27088345 ATGGAGAAGCCACATGTGGGTGG - Intergenic
1182835678 22:33339522-33339544 ATGAAGAAGATGCAAGTCGCAGG + Intronic
1183521852 22:38300229-38300251 ACAGAGAAGAAGCCTGAGGCAGG + Intronic
1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG + Intergenic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184434978 22:44466669-44466691 ATGCAGAAAAAGCATTTGACAGG - Intergenic
1185273319 22:49938439-49938461 ATGGAGAAGGCGGATGGGGCAGG + Intergenic
949215479 3:1562140-1562162 ATGGAAAAGAACCATGGGGGTGG - Intergenic
949329094 3:2901480-2901502 ATGGAGAAGGTGCATGAGGCAGG - Intronic
950595674 3:13979160-13979182 ATGGAGCAGAAGCAGGAAGCAGG - Intronic
951836482 3:26988907-26988929 TTGGAGAAAAAGCAAATGGCAGG + Intergenic
954301467 3:49702894-49702916 GTGGAGAAGCCGCCTGTGGCTGG - Intronic
954383671 3:50233139-50233161 ATGGAGAAGGAGCAGCTAGCAGG + Intronic
954539661 3:51385187-51385209 ATGGGGAAGTGGCATGTGGGAGG + Exonic
957223513 3:77413829-77413851 ATGGACAAGTAAAATGTGGCAGG + Intronic
959502066 3:107118179-107118201 ATGGGGAAGCAGCAGTTGGCAGG - Intergenic
959537573 3:107503961-107503983 AAGGAGAAAAAGCAGGTTGCTGG + Intergenic
959554666 3:107702889-107702911 ACTGCGCAGAAGCATGTGGCGGG + Intronic
960349610 3:116576331-116576353 TTGGGGAAGAAGTATGTGGATGG + Intronic
960696625 3:120402702-120402724 ATGGAGAAGAGGGCGGTGGCTGG - Intronic
961530006 3:127534828-127534850 CAGGAGAAAAAGCAAGTGGCAGG - Intergenic
961555923 3:127696708-127696730 ATGAAGAAGCATCATGGGGCCGG - Intronic
962009046 3:131376036-131376058 CTGGAGAACAAGGATGAGGCAGG + Intergenic
962944677 3:140156335-140156357 ATGGAAAAGAAGCATATTCCTGG - Intronic
963021860 3:140879438-140879460 CTGAGGAAGAGGCATGTGGCTGG + Intergenic
963281553 3:143389515-143389537 AAGAAGGAGAAGCATGTGCCTGG + Intronic
963923687 3:150929325-150929347 AGGGAGCAGAAGCAGGTGGCAGG + Intronic
963970229 3:151421325-151421347 TTGGGGAAGAGGTATGTGGCTGG - Intronic
964990307 3:162802601-162802623 ATAGAGAAGAGGCAAGTGGATGG + Intergenic
965226677 3:166000143-166000165 TTGGGGAAGAAGTATGTGGCTGG - Intergenic
965500757 3:169453660-169453682 ATGCCGAGGAAGCATATGGCAGG + Intronic
966365755 3:179185772-179185794 ATGAAGAAGATGCATAGGGCAGG + Intronic
966631849 3:182084869-182084891 AAGGAAGAGAAGCATGTGACTGG + Intergenic
966730812 3:183150025-183150047 ATGAATAAGGAACATGTGGCTGG + Intronic
966912342 3:184566480-184566502 CTGGAGAAGATGCATGTTGTGGG - Intronic
967355272 3:188562603-188562625 AAGGAGAAGATCCATCTGGCAGG - Intronic
969345276 4:6565915-6565937 ATGTAGTACAAGCATGTGGGAGG + Intergenic
969509596 4:7610255-7610277 GTGGAGAGGACACATGTGGCAGG - Intronic
969728195 4:8938308-8938330 GTGGAGAAGGGGCATGCGGCAGG + Intergenic
969836186 4:9843776-9843798 ATTCAGAAGAAGCATGTTCCAGG + Intronic
970522458 4:16899361-16899383 TTGGAGAAGAGGGAGGTGGCTGG - Intergenic
970966624 4:21935491-21935513 ATTGAGAAGAAGCATTTAGTGGG - Intronic
971542121 4:27832488-27832510 ATGAAAAAGAAGCTTGTGGCCGG + Intergenic
972408675 4:38769966-38769988 ATGGAGACAAAGCATGGGGAAGG - Intergenic
972806004 4:42529959-42529981 CTGGGGAAGAAGTATGTGGATGG + Intronic
972828666 4:42788957-42788979 ATGGGGAAGAGGCATATGGATGG + Intergenic
973269282 4:48244782-48244804 TTTGAGAAGAAGGATGTTGCAGG - Intronic
973744648 4:53951203-53951225 ATGTAGACAAAGCATGTGACTGG - Intronic
974495094 4:62615844-62615866 ATGGAGATGAAGCATTTGTTGGG - Intergenic
978157454 4:105506095-105506117 ATTGAGAAGGAGCATGTTGTGGG - Intergenic
978685362 4:111435840-111435862 TTGGAGAAGAGGAATGTGGCTGG - Intergenic
978833771 4:113121867-113121889 ATGAACAAGAAGAATGTGGTGGG - Intronic
978839198 4:113189714-113189736 ATTGAGAAGAAAGAGGTGGCAGG - Intronic
979025707 4:115571853-115571875 ATGGAGAAGAAGGATGTACATGG + Intergenic
979973699 4:127169434-127169456 ATGGAGAAGAAGGTATTGGCTGG - Intergenic
980327779 4:131370787-131370809 ATGGAAAAGAATCATGTTTCGGG - Intergenic
980387656 4:132107219-132107241 ATGGGTAAATAGCATGTGGCTGG - Intergenic
980855695 4:138436661-138436683 AAAGAGGAGAAGCATGTGGAAGG + Intergenic
981400056 4:144303352-144303374 ATGGATAAGCAGCAATTGGCTGG - Intergenic
982327505 4:154143983-154144005 ATAGGGAGGAAGCATGTGCCTGG - Intergenic
982961953 4:161850545-161850567 GTGGAGAAGAATCATGTTTCTGG + Intronic
983582766 4:169325442-169325464 TTGGGGAAGAAGTATGTGGATGG + Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
985655345 5:1128926-1128948 ATGGGGATGGAGCACGTGGCAGG - Intergenic
986609254 5:9550483-9550505 ATGGAGATGAAGCCTCTGGATGG + Intergenic
987295847 5:16550602-16550624 AAGGGGAAGAAGCATGCAGCAGG - Intronic
987466172 5:18274900-18274922 TTGGAGAAGAGGTATGTGGATGG - Intergenic
987657060 5:20821020-20821042 TTGGGGAAGAGGTATGTGGCTGG - Intergenic
988766491 5:34382928-34382950 TTGGGGAAGAGGTATGTGGCTGG + Intergenic
989307413 5:39973993-39974015 TTGGGGAAGAGGCATGTGGATGG - Intergenic
989457561 5:41661138-41661160 TTGGGGAAGAAGTATGTGGATGG - Intergenic
989497263 5:42124009-42124031 ATGTACAGGAAGCATGAGGCTGG + Intergenic
989983636 5:50670768-50670790 ATGGAGAAGAAGGAGGTCTCAGG - Intronic
990654230 5:57936559-57936581 ACGGAGATGAAGCTTGGGGCTGG - Intergenic
991033639 5:62106553-62106575 TTGGGGAAGAGGTATGTGGCTGG + Intergenic
992483296 5:77172137-77172159 ATGGGGAAGAAGCCTCTGACTGG + Intergenic
993071198 5:83166181-83166203 ATGGATAAGAAAAATGTGGCCGG - Intronic
993818313 5:92581282-92581304 AAGGAGAAGAATCCTGTGCCAGG + Intergenic
994154412 5:96486775-96486797 ATGGAGAAGAATCAAGGAGCAGG - Intergenic
995197922 5:109394342-109394364 GTCGAGAACTAGCATGTGGCTGG - Intronic
995236979 5:109840509-109840531 AAGGAAAAGAAGCTTATGGCAGG - Intronic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
995777050 5:115734899-115734921 AAGGAGAAAAAGGATGTGCCAGG + Intergenic
998696728 5:144649289-144649311 AGGAAGAAGAATCATGTGGGAGG + Intergenic
998698482 5:144668702-144668724 GGGGTGAAGAAGCATGGGGCTGG + Intergenic
1000228145 5:159289814-159289836 ATGGAGAAGAATATTGTGGAAGG + Intergenic
1000330188 5:160199674-160199696 ATGGAGACGAAGGAGGGGGCAGG - Intronic
1000417055 5:160994530-160994552 TTGGGGAAGAAGTATGTGGATGG + Intergenic
1001100647 5:168811008-168811030 TAGGAGAAGAACAATGTGGCTGG - Intronic
1001956506 5:175851457-175851479 GTGGAGAAGAAACACGTGACTGG + Intronic
1002104578 5:176873829-176873851 AGGGAGCAGACGCTTGTGGCAGG - Intronic
1003016611 6:2473096-2473118 ATGGAGAAAAATCATGTAGGGGG + Intergenic
1003695808 6:8405520-8405542 TTGGGGAAGAAGTATGTGGAGGG - Intergenic
1003822762 6:9918284-9918306 ATGGAGGAGCAGCATGTGGTGGG - Intronic
1004095184 6:12547206-12547228 CTGGAGAGGAAGCATATGGTGGG + Intergenic
1004266676 6:14154112-14154134 ATGGACAATAAGCAGGAGGCAGG - Intergenic
1004272814 6:14210815-14210837 ATGGATAAGCAACAAGTGGCTGG + Intergenic
1005365790 6:25075532-25075554 ATGGAGGAATAGCATGTGGGTGG + Intergenic
1006583607 6:35090838-35090860 GTGGACAAGAAGCCTGTGGCTGG - Exonic
1006835793 6:36998218-36998240 ATAGAGAAGGAGCCTGTCGCTGG + Intergenic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007573280 6:42908664-42908686 ATGGACCAGAAGCAGCTGGCTGG + Intergenic
1008079291 6:47177940-47177962 TTGGGGAAGAGGCATGTGGATGG - Intergenic
1008400371 6:51056095-51056117 TTGGGGAAGAAGTATGTGGATGG + Intergenic
1013391100 6:109687272-109687294 CTGGGGAAGAAGCATGTGATTGG + Intronic
1014417074 6:121196018-121196040 TTGGGGAAGAAGTATGTGGATGG + Intronic
1014762563 6:125373266-125373288 ATGGAGAAGAAGAGTTTGGGAGG - Intergenic
1015475837 6:133658113-133658135 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1018163231 6:161068448-161068470 AAGGAGAAGAAGGTGGTGGCAGG + Intronic
1018986382 6:168640346-168640368 ATGGAGAGGAAGCATGGGGCAGG + Intronic
1019153801 6:170025753-170025775 ATGGGGAGGGAGCATGTGGACGG + Intergenic
1019230317 6:170554785-170554807 ATGGAGAAGAAGCGGATGGCAGG - Intronic
1019468092 7:1201535-1201557 AGGAAGAAGATGCATGTGGCTGG + Intergenic
1019477895 7:1252756-1252778 AGGGACAAGAAGCAGGTGGCCGG + Intergenic
1020160299 7:5765645-5765667 ATGAAAAAGAAACATGGGGCTGG + Intronic
1020932343 7:14413582-14413604 AAGGAGAAGAAGCCTGAAGCGGG + Intronic
1021312569 7:19111948-19111970 AGTAAGAAGGAGCATGTGGCAGG - Intronic
1021380800 7:19963611-19963633 ATGATGAAGAAGCATGAAGCAGG - Intergenic
1021862228 7:24917207-24917229 ATGGAGAACAAGGAAGAGGCAGG - Intronic
1022818700 7:33937926-33937948 TTCCAGAAGGAGCATGTGGCTGG - Intronic
1023192140 7:37594068-37594090 TTGGACAAGAAGCATGATGCTGG - Intergenic
1023210978 7:37804452-37804474 ATACAGAGGAACCATGTGGCTGG + Intronic
1023474199 7:40559209-40559231 AAGGAGATGGAGCATCTGGCTGG - Intronic
1024117319 7:46206390-46206412 ATGGAGACCAAGCATGCTGCAGG - Intergenic
1024427849 7:49248232-49248254 GTGGTGCAGAAGCTTGTGGCCGG - Intergenic
1028237913 7:88383452-88383474 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1029276710 7:99409390-99409412 ATCGAGAAGAAAGATGTGCCGGG - Intronic
1029520253 7:101056309-101056331 AAGGAGAAGAAGAAAGTCGCAGG - Intronic
1029951070 7:104586364-104586386 AGGGAGAAGAAACTTGTGGGTGG - Intronic
1031806684 7:126316191-126316213 ATGCTTAAAAAGCATGTGGCAGG - Intergenic
1031913609 7:127542508-127542530 CTGGGGAAGAGGCATGTGGCTGG + Intergenic
1031925329 7:127633176-127633198 AGGAAGAAGGAGCATGTGGGAGG + Intergenic
1032919467 7:136528719-136528741 CTGCATAAGAAGCATGGGGCTGG + Intergenic
1033349541 7:140551002-140551024 ATGAAAAAAAAGCTTGTGGCCGG + Intronic
1034653521 7:152711350-152711372 ATGAAGAAGAATCAGATGGCCGG - Intergenic
1035575355 8:701144-701166 CTGGAGAAGAACCAGGTGGACGG + Intronic
1035726660 8:1829047-1829069 TTGGAGAGGAAGCAGGCGGCAGG + Intronic
1036012928 8:4748151-4748173 ATGGAGTAGAAACATGTTGTGGG - Intronic
1036386039 8:8282831-8282853 GAGCAGAAGAAGCCTGTGGCTGG + Intergenic
1039039078 8:33389896-33389918 ATGAATAAGAAGCATGTGGCCGG + Intronic
1039324087 8:36465916-36465938 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1039968756 8:42303801-42303823 ATGCAGAAGAAAAATGGGGCTGG - Intronic
1041373767 8:57191994-57192016 CTAGAGAAGAAGCATAGGGCTGG + Intergenic
1041646054 8:60253728-60253750 ATGGGAAAGTAGCATGAGGCAGG - Intronic
1041882496 8:62767777-62767799 ATAGAGAGAAGGCATGTGGCAGG + Intronic
1042317803 8:67442989-67443011 AGGGAAAAGAAGGATGGGGCTGG - Intronic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1043140765 8:76587094-76587116 GTGGAGAAGAAACATGTGAAAGG + Intergenic
1043300581 8:78726060-78726082 ATGGAGAAAAAGCATGGGGGTGG + Intronic
1043461621 8:80466207-80466229 ATGGAGAAAAAGTAAGTGGTGGG - Intergenic
1043662039 8:82755629-82755651 GAGGAGAAGAAGCAAGTGTCTGG - Intergenic
1045250229 8:100476706-100476728 TTGGAGAAGGAGCATCTGGTTGG + Intergenic
1045416590 8:101973621-101973643 AAGGAGAAGAAGCTGGTGGTGGG + Intronic
1045632033 8:104135660-104135682 ACAGAGAAGCAGCATGTGGTAGG + Intronic
1045803403 8:106127945-106127967 CTGTAGAAGAAGCATGGTGCTGG - Intergenic
1046492863 8:114975792-114975814 CTGTACAAGAAGCATGAGGCTGG + Intergenic
1047475225 8:125221538-125221560 ATGGATAAGACACATCTGGCTGG - Intronic
1048118609 8:131553802-131553824 ATGAAGAAGAAGGCAGTGGCTGG + Intergenic
1048502860 8:134994503-134994525 AAGGAGAAGATGCCTGTGGAAGG + Intergenic
1052643308 9:31197857-31197879 ATGGTGACTGAGCATGTGGCTGG + Intergenic
1053423658 9:37997200-37997222 ATGGAGATACAGCCTGTGGCCGG - Intronic
1055119198 9:72638626-72638648 ATAGAGAAGACACATATGGCAGG - Intronic
1056266485 9:84901760-84901782 ATGGAGAAGAAGCCAGGGGAGGG - Intronic
1058937586 9:109783189-109783211 ATGGAGGTGAAGCACCTGGCAGG + Intronic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1060070686 9:120544474-120544496 CTGGAGAAGAAGCCTGGGCCTGG + Intronic
1060451216 9:123742484-123742506 ATTGAGCAGAAACATGTGGAAGG - Intronic
1060513808 9:124253319-124253341 AGGGATAAGAACCAGGTGGCTGG + Intergenic
1060862588 9:126967153-126967175 AAGGAGATGATGCATGTGCCAGG - Intronic
1062627992 9:137451709-137451731 AAGGGGAAGAGGCGTGTGGCGGG - Intronic
1062628031 9:137451830-137451852 AAGGAGAAGAGGCGTGTGGCGGG - Intronic
1062628067 9:137451956-137451978 AAGGGGAAGAGGCGTGTGGCTGG - Intronic
1062628076 9:137451987-137452009 AAGGAGAAGAGGCGTGTGGCGGG - Intronic
1185648532 X:1632083-1632105 ATGGACAAGGAGCATGGGGCTGG + Intronic
1186055530 X:5645652-5645674 ATGGAGGAGAAGTTAGTGGCTGG + Intergenic
1186495240 X:10007738-10007760 ATGGAGAAGAAGCCAGCTGCAGG - Intergenic
1187096197 X:16151024-16151046 ATGGAGACAAAGCAGGAGGCTGG + Intronic
1187489353 X:19736542-19736564 ATGCAGAGGAAGCTTCTGGCTGG + Intronic
1188377031 X:29444043-29444065 ATTGAAAAGAGACATGTGGCTGG + Intronic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1190750457 X:53357521-53357543 ATGGATGGGAAGCATGTGGCAGG + Intergenic
1190801659 X:53794976-53794998 ATGGATGGGAAGCATGTGGCAGG + Intergenic
1190996666 X:55616856-55616878 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1191747850 X:64509564-64509586 ATTGAGATGAATCATGTGGGTGG + Intergenic
1191946434 X:66539647-66539669 CTGGGGAAGAGGTATGTGGCTGG + Intergenic
1192446366 X:71214536-71214558 GTGGACAATAAGCAAGTGGCCGG + Intergenic
1194593224 X:95826768-95826790 ATGGAGACTATGCATGTTGCAGG + Intergenic
1195013469 X:100755574-100755596 ATGGGGAAGAGGTATGTGGATGG - Intergenic
1195494249 X:105511520-105511542 ATGGAGAGGACACATGTGGGTGG - Intronic
1196050096 X:111295865-111295887 ATGGAGAAGAAGAAAGGGCCAGG + Exonic
1196732852 X:118958633-118958655 ATGCAGAAAAAGCATTTGACAGG + Intergenic
1197591956 X:128420012-128420034 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1197849017 X:130837037-130837059 AAAGGGAAGAAGCATATGGCAGG + Intronic
1199512477 X:148638068-148638090 ATGGAAAACAAGGATATGGCAGG - Intronic
1199706066 X:150426472-150426494 ATGGAGAAGAAGCAATCGGAAGG - Intronic
1200745969 Y:6904244-6904266 TTGGGGAAGAAGTATGTGGATGG - Intergenic