ID: 1086208321

View in Genome Browser
Species Human (GRCh38)
Location 11:84286873-84286895
Sequence ATCTCTCTGCAGAAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 297}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086208317_1086208321 9 Left 1086208317 11:84286841-84286863 CCAAAGGCTGGGGTTGACGCCTA 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1086208321 11:84286873-84286895 ATCTCTCTGCAGAAGCAGAGAGG 0: 1
1: 0
2: 0
3: 36
4: 297
1086208313_1086208321 21 Left 1086208313 11:84286829-84286851 CCTTTACTGTTACCAAAGGCTGG 0: 1
1: 0
2: 3
3: 9
4: 115
Right 1086208321 11:84286873-84286895 ATCTCTCTGCAGAAGCAGAGAGG 0: 1
1: 0
2: 0
3: 36
4: 297
1086208318_1086208321 -10 Left 1086208318 11:84286860-84286882 CCTAAGCTTTCCCATCTCTCTGC 0: 1
1: 0
2: 1
3: 48
4: 410
Right 1086208321 11:84286873-84286895 ATCTCTCTGCAGAAGCAGAGAGG 0: 1
1: 0
2: 0
3: 36
4: 297
1086208312_1086208321 22 Left 1086208312 11:84286828-84286850 CCCTTTACTGTTACCAAAGGCTG 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1086208321 11:84286873-84286895 ATCTCTCTGCAGAAGCAGAGAGG 0: 1
1: 0
2: 0
3: 36
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086208321 Original CRISPR ATCTCTCTGCAGAAGCAGAG AGG Intronic
902412414 1:16219225-16219247 AACTCTCTGCACCAGCAGGGAGG - Intergenic
903287794 1:22287716-22287738 ATCTCTCTGCAGGAGAAAATGGG + Intergenic
903761819 1:25703803-25703825 ATCACACTTCAGAAGCAGTGAGG - Intronic
905503214 1:38455759-38455781 ATCTCCCTGCTGTGGCAGAGAGG + Intergenic
905839504 1:41162677-41162699 AGTTCTCTGCAGAGGCAGAGAGG - Intronic
906252802 1:44324241-44324263 AACTCTCCGCAGAATCAGAGAGG + Intronic
906576681 1:46897518-46897540 GTCCCACTGCAGAAGCACAGTGG - Intergenic
907544361 1:55246633-55246655 ACCCCTGTGCAGCAGCAGAGAGG + Intergenic
910799759 1:91133352-91133374 AAGTCTCTGCATAGGCAGAGAGG - Intergenic
911193067 1:94966916-94966938 ATCTTTCTGCAGGGGGAGAGGGG + Intergenic
913975930 1:143455429-143455451 ATCTCACTTAAGAAGCAGAATGG + Intergenic
914070326 1:144281051-144281073 ATCTCACTTAAGAAGCAGAATGG + Intergenic
914108829 1:144685303-144685325 ATCTCACTTAAGAAGCAGAATGG - Intergenic
914381549 1:147121006-147121028 ATCTCTGTGCAGCAGCTCAGCGG - Intergenic
914910699 1:151783626-151783648 ATCTCTCTGCGGTAGCAGGAAGG + Intronic
915109520 1:153554191-153554213 ATCTCTGTGCAGAGGCACAGAGG - Intergenic
915966052 1:160309171-160309193 AGCTCTCTGTAGAAGAAAAGGGG + Exonic
916121289 1:161530653-161530675 ACCCCTCTACAGAAGCAGAGGGG - Intergenic
916131056 1:161612258-161612280 ACCCCTCTACAGAAGCAGAGGGG - Intronic
918306450 1:183251099-183251121 AACTGTCTGCAGGAACAGAGAGG + Exonic
920191195 1:204194968-204194990 TTCTCTGTGCGGAAGCAGGGTGG + Intronic
920839571 1:209542877-209542899 ACCTCTCTGGACAAGCAGAGAGG + Intergenic
921081441 1:211741569-211741591 GTATCTCTGCAGCAGCTGAGAGG + Intergenic
922712959 1:227846595-227846617 AGCTCTTTCCAGAAACAGAGGGG + Intergenic
923034181 1:230272663-230272685 AGCTCTCAGCATCAGCAGAGGGG - Intronic
924386807 1:243506745-243506767 GTCTATTTGCAGAAGAAGAGAGG - Intronic
1063221164 10:3969545-3969567 AGCTCTCTGCAGAGGCTGATTGG + Intergenic
1065631970 10:27689836-27689858 ATCTTTCTCTAGGAGCAGAGTGG - Intronic
1067708972 10:48633767-48633789 ATCCATCTGCAGAAGGAGATGGG + Intronic
1068956364 10:62821465-62821487 ATTTGTCTGCAGAAGCTGAGTGG - Intronic
1069346459 10:67476388-67476410 CTCTCTCTGCATAAGAACAGTGG - Intronic
1069599246 10:69692805-69692827 ACCTCTCTGGAGAGGCACAGAGG + Intergenic
1069599394 10:69693758-69693780 ACCTCTCTGGAGAGGCACAGAGG - Intergenic
1069644404 10:69982042-69982064 TTCTCTCTACTGAAACAGAGGGG - Intergenic
1074400128 10:113134915-113134937 CTCTTTCTGCAGAAGCAAAATGG - Intronic
1074607638 10:114989483-114989505 ATGTCTCAGCTCAAGCAGAGAGG - Intergenic
1075609020 10:123836576-123836598 ATCTTTCTCCAGTTGCAGAGAGG - Intronic
1076058078 10:127391833-127391855 ATCTATCTGCAGGAGCGGAAGGG - Intronic
1076507825 10:130989644-130989666 CTCTCTCTGCATGAGCAGAGGGG - Intergenic
1077117747 11:892997-893019 CTCTCCCTCCAGAGGCAGAGAGG - Intronic
1077168861 11:1157589-1157611 ATCCCTCTGCAGCAGGACAGGGG - Intergenic
1078670094 11:13356939-13356961 ATCTCTCTGCAGACACACAAGGG - Intronic
1079934033 11:26596278-26596300 ATCCTTCTACAGAGGCAGAGAGG - Intronic
1081231924 11:40595853-40595875 ATTTCTCAATAGAAGCAGAGTGG + Intronic
1083856694 11:65396565-65396587 TGCTCTCGGCAGAAGCAGACAGG + Intronic
1084179836 11:67440760-67440782 GTCACTATGCAGAAGCAGAGAGG + Intronic
1085227987 11:74939995-74940017 ATCACTCTAGAGAAGCAGAGAGG + Intronic
1086208321 11:84286873-84286895 ATCTCTCTGCAGAAGCAGAGAGG + Intronic
1088034796 11:105298413-105298435 ATCTCTCTGCAGAAGATGACAGG + Intergenic
1088546064 11:110960229-110960251 ATCTCTCTGCAGAAAAATAGGGG - Intergenic
1088618618 11:111659521-111659543 ATGTGTCTCAAGAAGCAGAGAGG - Intronic
1089047278 11:115513167-115513189 CTTTCCGTGCAGAAGCAGAGGGG + Intergenic
1091988643 12:4936270-4936292 AGCACTCTGGAGAAGCAAAGGGG - Intergenic
1092898883 12:13040146-13040168 ATCTCTCTGCAGAGGGAGTGAGG + Intergenic
1094746769 12:33353727-33353749 ATTTCTCTGCACAAGCACAGAGG + Intergenic
1095871720 12:47035506-47035528 ATCGCACTGCTGAAGCAGGGAGG - Intergenic
1095960206 12:47829455-47829477 ATCTCTTTCCAGAAGCCCAGAGG - Intronic
1096026035 12:48362059-48362081 ATTTCTCTGGAGAAGGAGAGGGG - Intergenic
1097426870 12:59456731-59456753 ATATCTCTGAAGTAGAAGAGTGG - Intergenic
1097704521 12:62853835-62853857 ATCTCTCTACAGAAGGTAAGGGG + Intronic
1098179190 12:67828024-67828046 ACATCACTGCAGGAGCAGAGTGG + Intergenic
1099344363 12:81479750-81479772 ATCTCTCTGCAGAAGAGTGGAGG - Intronic
1100815814 12:98386108-98386130 AGCTCTCTGCAGAGAGAGAGAGG - Intergenic
1100819155 12:98414999-98415021 ACCACTCTGCAGAAGCAGGAGGG + Intergenic
1101155442 12:101923366-101923388 ATCTCTCTGCACAATTAGATTGG + Exonic
1102438913 12:112946665-112946687 AGCTCTCTGCATAACCAGACTGG - Intronic
1103310970 12:120007820-120007842 ATCACTCAACAGAGGCAGAGTGG - Intronic
1103557735 12:121776176-121776198 GGCTCACAGCAGAAGCAGAGTGG - Exonic
1105223308 13:18354304-18354326 ATCTCACTTAAGAAGCAGAATGG - Intergenic
1105441025 13:20415440-20415462 CGCTCTCTGCAGACGCAGGGCGG - Intronic
1106666982 13:31861955-31861977 CTCTGTCTTCTGAAGCAGAGAGG + Intergenic
1107062057 13:36170220-36170242 AGCTCTGAGTAGAAGCAGAGGGG + Intronic
1107425742 13:40291086-40291108 ATCTCTCAGGAGAAGCAGGAGGG + Intergenic
1108067612 13:46594475-46594497 GTCTCCCTGCAGAAGCAAAGAGG + Intronic
1109901705 13:68781175-68781197 ATGTATTTGCGGAAGCAGAGTGG - Intergenic
1110460517 13:75739851-75739873 TTCTCTCTTCAGGAGGAGAGGGG + Intronic
1112343258 13:98569741-98569763 ATCTCTCTGCTGGGGGAGAGCGG + Intronic
1113171622 13:107511100-107511122 TTCTTTCTGCAGCAGCAAAGAGG - Intronic
1113913622 13:113856829-113856851 CCGTCCCTGCAGAAGCAGAGAGG - Intronic
1115191303 14:30750128-30750150 AGCTCTCTGGAGAAGCAGATAGG - Intergenic
1116222868 14:42111386-42111408 ATCTCCGTGCAGAAACAGCGGGG + Intergenic
1119340870 14:73876425-73876447 ATCTCTCTGCACACCCACAGAGG - Intronic
1120031599 14:79647658-79647680 ATCTCTCTGAAGCAGCAGTTGGG + Intronic
1121048508 14:90804857-90804879 ATCTCTCCGCAAATGCAGATGGG - Intronic
1121868687 14:97387106-97387128 ATCTTTCTGCAGCAGCACTGAGG - Intergenic
1122202930 14:100133421-100133443 ACCTCAGTGCAGAATCAGAGAGG + Intronic
1202830769 14_GL000009v2_random:26913-26935 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1124420033 15:29513032-29513054 ATCTCACTGCAGATGAAAAGAGG - Intronic
1126131035 15:45341472-45341494 ATCTCTCTGGAGTAGAAGAATGG + Intergenic
1126435963 15:48637909-48637931 TTCTCCCTACAGCAGCAGAGTGG - Intronic
1126476498 15:49070343-49070365 ATCTCTCTGCAGACTAACAGTGG + Intergenic
1126543659 15:49848548-49848570 CTCTCTCTGGAGGAGCAGAGAGG + Intergenic
1126923174 15:53550596-53550618 TTTTCTCTGCTGGAGCAGAGTGG - Intronic
1129442489 15:75591876-75591898 TCCTCTGTGCAGCAGCAGAGAGG + Intergenic
1129610645 15:77052829-77052851 GTCTCTCTGCAGCAGCTAAGAGG + Exonic
1129689829 15:77706866-77706888 ATCTGGCTGGGGAAGCAGAGAGG - Intronic
1131702775 15:94957343-94957365 TTCTCTCTGGAGAGGCAGAGTGG - Intergenic
1132860331 16:2067902-2067924 TTCCCTCTGCAGAAGCAGAAAGG - Intronic
1133867980 16:9661559-9661581 GTTTGTCTGCAGAAGCAAAGAGG + Intergenic
1135934660 16:26769399-26769421 TTTCCTCTGCAGAACCAGAGTGG - Intergenic
1136777896 16:32881393-32881415 ACCTCTCTCCAGAAGAGGAGGGG - Intergenic
1136892726 16:33980121-33980143 ACCTCTCTCCAGAAGAGGAGGGG + Intergenic
1137706967 16:50542255-50542277 ATCTCTTTGCAGAATCTGAATGG - Intergenic
1139349935 16:66328578-66328600 AGCTCTCTTCTGAAGGAGAGAGG + Intergenic
1140209866 16:72961381-72961403 ATATTACTGCAGGAGCAGAGCGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141469821 16:84230710-84230732 ATGTCTCTGCAGAACCATGGTGG - Intronic
1141799595 16:86297875-86297897 CTCTGTCTGCAGAAGCAGATTGG + Intergenic
1141930030 16:87196151-87196173 TGCTCTCTGCAGCAGGAGAGGGG - Intronic
1142305947 16:89285751-89285773 GTGTCTCTGCAGAGGCAGGGTGG - Intronic
1203080314 16_KI270728v1_random:1143502-1143524 ACCTCTCTCCAGAAGAGGAGGGG - Intergenic
1143378521 17:6481087-6481109 CTCTCTCTGCAGGTGGAGAGTGG - Intronic
1143475665 17:7202505-7202527 ATCTCTATTCAGAAGCAAAACGG + Intronic
1143796175 17:9338591-9338613 ATCTCACTGCAGAAATGGAGTGG - Intronic
1144745683 17:17612642-17612664 CACTCTCTGCAGAATGAGAGTGG - Intergenic
1144787247 17:17838713-17838735 GTCCCTCTGCAGAGGCAGGGAGG + Intergenic
1151336157 17:73440913-73440935 ATCTCTCTCCAGATGTAGGGGGG - Exonic
1151893687 17:76966192-76966214 ATCCCTCTCCAGGGGCAGAGGGG - Intergenic
1152296325 17:79469322-79469344 ATCTCCCTGCAGCAGCACTGGGG + Intronic
1152503711 17:80731506-80731528 ATGTCTCTTCATTAGCAGAGCGG - Intronic
1152570998 17:81121243-81121265 CGCTCTCTGCAGAAGCAGGTGGG - Exonic
1152718813 17:81912523-81912545 GTCGCTGTGCAGAAGCAGAGAGG - Exonic
1154031122 18:10755498-10755520 ATCTGACTGCAGAGGCACAGTGG + Intronic
1154083411 18:11279709-11279731 ACATCTCTGCAGCAGCTGAGAGG + Intergenic
1157378553 18:47189808-47189830 ATCTGTTTGTATAAGCAGAGTGG + Intergenic
1157484580 18:48077927-48077949 ATGTCTATGCAGAATTAGAGGGG + Intronic
1157586088 18:48802235-48802257 AGCTCTCTGTGGAAACAGAGTGG - Intronic
1158378552 18:56902158-56902180 TTCTCTTCCCAGAAGCAGAGTGG - Intronic
1158450658 18:57561510-57561532 ACCTCTCTGCAGAATGAAAGAGG + Intronic
1158552334 18:58446627-58446649 ATCACCCTGCAGAGGGAGAGAGG + Intergenic
1159434811 18:68402226-68402248 ATCTCTCAGCAGATGCCCAGTGG + Intergenic
1159578994 18:70213861-70213883 TTCTCTCTGCACATGCATAGGGG - Intergenic
1163518288 19:17778128-17778150 ATCTCTCTGCACAGCTAGAGAGG - Exonic
1164037344 19:21466583-21466605 ATCTCGCCACAGAAGCAGTGGGG + Intronic
1164063541 19:21695167-21695189 CTCTCTCAGCAGGAGGAGAGGGG + Intergenic
1166269064 19:41702459-41702481 ACCTCACAGCAGGAGCAGAGTGG + Intronic
1167283656 19:48586442-48586464 CTCTGTATCCAGAAGCAGAGAGG + Intronic
1167422500 19:49412519-49412541 ATGTCTCTGGAGAAACCGAGAGG + Intronic
1167636038 19:50656320-50656342 GTCTCCATGCAGAGGCAGAGGGG - Exonic
1202641924 1_KI270706v1_random:100863-100885 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
925060620 2:887134-887156 ATCACTCTGCAGAGGCCAAGAGG - Intergenic
925733254 2:6938008-6938030 ATGGCCCTGCAGAGGCAGAGGGG + Intronic
925770934 2:7282584-7282606 AGGTCCCTGCAGAAGCAGTGTGG + Intergenic
925895695 2:8470325-8470347 ATGTTTCAGAAGAAGCAGAGAGG - Intergenic
926343870 2:11927804-11927826 AGCTCCCTGCAGAAGCTGGGTGG - Intergenic
927219560 2:20694678-20694700 TTCTCTCTGCAGGCACAGAGGGG + Intronic
927717646 2:25362918-25362940 ATGTCACTGCAGAAGCCCAGAGG + Intergenic
927997058 2:27494124-27494146 ATCTCCCTGCAGCGGCAGAATGG - Exonic
928024280 2:27727405-27727427 TGCTCTCAGCAGAGGCAGAGGGG + Intergenic
928180470 2:29065057-29065079 TTCTCTCGGCAGCAGCAGCGAGG - Exonic
928318651 2:30266164-30266186 ATCTCTCTGCAGAGGAAATGGGG + Intronic
928977820 2:37107120-37107142 ATCTTTCTGCAGAAACAGAAAGG - Exonic
929787855 2:45004961-45004983 AACTCGCTGCAGAAGCGGGGAGG - Intergenic
931097695 2:58960398-58960420 ATGTCTGTGAAAAAGCAGAGAGG - Intergenic
931714711 2:65019903-65019925 TGCTGTCTGCAGAATCAGAGGGG - Intronic
932196234 2:69786410-69786432 ATCTCTCTACAGCAGCCCAGGGG + Intronic
933892735 2:86786514-86786536 ACCTCTCTGTTGAAGCTGAGCGG + Intronic
933909515 2:86927541-86927563 ATCTAGTTGCAGAAGCAGATTGG + Intronic
934023210 2:87975838-87975860 ATCTAGTTGCAGAAGCAGATTGG - Intergenic
934180628 2:89616411-89616433 ATCTCACTTAAGAAGCAGAATGG + Intergenic
934290928 2:91690670-91690692 ATCTCACTTAAGAAGCAGAATGG + Intergenic
934975232 2:98797447-98797469 GTCACTCGGCAGAAGCGGAGGGG - Exonic
935283977 2:101547143-101547165 ATGTTTCTGCAGAAGCAGAATGG - Intergenic
936232523 2:110715769-110715791 ATCTCTCTCCAGAAGCTGTCTGG + Intergenic
936324566 2:111493768-111493790 GTCTCTCAGCAGAAGCCCAGAGG + Intergenic
936841958 2:116780208-116780230 ATCTCTCAACTGAAGCAGACAGG - Intergenic
937441473 2:121919601-121919623 ATAGCTCTGCAGGGGCAGAGAGG + Intergenic
937582066 2:123499196-123499218 AGTTCTCTGCAGAAGAAGACAGG + Intergenic
937851402 2:126639454-126639476 ATAGCACTGCAGAAGCACAGAGG - Intergenic
942077239 2:172367174-172367196 ATCCCTCTGCATAAGGAGGGAGG + Intergenic
942204966 2:173610952-173610974 GACCCTCTGCAGAAGAAGAGAGG - Intergenic
943266370 2:185738285-185738307 ATCAAGCTGCAGGAGCAGAGAGG + Intergenic
943727472 2:191267089-191267111 TTGTCTCTGCATAGGCAGAGAGG - Intronic
945120297 2:206450560-206450582 ATCTCTCCTCAGTAGCAGTGAGG - Intronic
945167916 2:206966035-206966057 ATTACTATGCGGAAGCAGAGAGG - Intronic
945895104 2:215472544-215472566 CTCTCCCTGAAAAAGCAGAGTGG + Intergenic
948871208 2:240799147-240799169 GTCTGTCTGCAGAAGGAAAGGGG + Intronic
948871216 2:240799185-240799207 GTCTGTCTGCAGAAGGAAAGGGG + Intronic
948871228 2:240799245-240799267 GTCTGTCTGCAGAAGGAAAGGGG + Intronic
1171086152 20:22239991-22240013 ATCTCTCTGCAAACGCACAGAGG + Intergenic
1171164341 20:22957207-22957229 ATGTCCCTGCAGAGGCTGAGAGG + Intergenic
1171889039 20:30691053-30691075 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1173109028 20:40168035-40168057 CTCTCTCTTCACATGCAGAGAGG - Intergenic
1173790010 20:45822444-45822466 ATCTCATTGTAGAAGCAGTGAGG + Intergenic
1175322615 20:58100132-58100154 ACATCTCAGCTGAAGCAGAGAGG + Intergenic
1176609956 21:8871751-8871773 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1176731858 21:10506739-10506761 ATCTCACTTAAGAAGCAGAATGG - Intergenic
1178121425 21:29473946-29473968 GTCACTCTGCAGAAGCAGAATGG - Intronic
1178429529 21:32506801-32506823 ACCTCTCTCCAGCAGCAGTGAGG - Intronic
1179721622 21:43319436-43319458 ATCTCTCTGTACACACAGAGGGG + Intergenic
1180360021 22:11881002-11881024 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1181184247 22:21090680-21090702 AGCTCTCTGCAAAAGCAGCGGGG + Intergenic
1181577425 22:23803770-23803792 CTCACACAGCAGAAGCAGAGTGG - Intronic
1182679512 22:32067877-32067899 ATTTTTCTGCAGCAGCTGAGGGG + Intronic
1185169667 22:49285503-49285525 TTCTCTCTGCAGGAGCAGACAGG + Intergenic
1185309687 22:50147196-50147218 CACTCTGTGCAGAAGCAGGGAGG + Intronic
1185309694 22:50147244-50147266 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309701 22:50147292-50147314 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309708 22:50147340-50147362 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309715 22:50147388-50147410 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309722 22:50147436-50147458 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309729 22:50147484-50147506 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309736 22:50147532-50147554 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309743 22:50147580-50147602 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
949089483 3:10980-11002 CCCTCTCTGCAGGCGCAGAGAGG + Intergenic
950092240 3:10304260-10304282 ACCTCTCTGCAGGAACAGGGTGG + Intronic
950443600 3:13023567-13023589 ACCTGTCTGCAGAAACAGGGAGG + Intronic
951085335 3:18506491-18506513 ATCTCTCATCCGAAGCAAAGCGG - Intergenic
951245537 3:20337284-20337306 ATCTTTCTGCAGAAACAAATGGG - Intergenic
952841198 3:37646965-37646987 ATCTCTCTGGAGCAGGAGGGTGG - Intronic
954301536 3:49703153-49703175 TTCACTCAGGAGAAGCAGAGAGG - Intronic
954708726 3:52494671-52494693 AGCTCACTGAAGGAGCAGAGAGG + Intergenic
956799012 3:72740022-72740044 CTCTCTCTTCAGAAGAGGAGTGG - Intergenic
956937909 3:74124821-74124843 ACCTCTCCGGAGAAGAAGAGAGG + Intergenic
957879938 3:86199514-86199536 ATATCTATGCAGGAGCAGCGTGG - Intergenic
958124861 3:89342937-89342959 AGTTCTCTGGAGAATCAGAGTGG - Intronic
960970763 3:123138603-123138625 AACTCTTTGCATAAGAAGAGGGG + Intronic
961985954 3:131134820-131134842 ATCTCACTGCAGAAGCCATGTGG + Intronic
962005177 3:131342171-131342193 CTCTCTCTCCAGAAGCAGGCAGG - Intronic
965686598 3:171309950-171309972 ATTTCTTTGCAAAAGCAGAGAGG - Intronic
966264188 3:178018302-178018324 AGCTCTCTGCATAAGCCGATAGG + Intergenic
966911947 3:184564698-184564720 ATCTCCCTGCAGCTCCAGAGAGG + Intronic
967081023 3:186049591-186049613 TTCTGTCTGGAGACGCAGAGGGG + Intronic
967906699 3:194507540-194507562 GGTTCTTTGCAGAAGCAGAGGGG - Intergenic
968009628 3:195265559-195265581 AGCTCTCTGCAGAGGCGGTGGGG - Intronic
1202736642 3_GL000221v1_random:6541-6563 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
968985090 4:3870709-3870731 AGCTTTCTGGAGAGGCAGAGCGG + Intergenic
969827740 4:9771364-9771386 AGGTCACTGCAGAAGGAGAGAGG + Intronic
974260320 4:59518068-59518090 ACCTCTCTGCACAAGCAGCCTGG - Intergenic
974609856 4:64203065-64203087 AACTCTTTTCAGAAGCAGACAGG + Intergenic
976844599 4:89473686-89473708 AGCTTATTGCAGAAGCAGAGGGG - Intergenic
977753179 4:100633877-100633899 ATGTCACAGCTGAAGCAGAGAGG + Intronic
977991588 4:103449413-103449435 CTCCCTCTGCTGCAGCAGAGTGG - Intergenic
978284626 4:107061648-107061670 ATCTTTGTGCAGGAGCAAAGAGG - Intronic
978617755 4:110613029-110613051 AACTCTCAGCGGAGGCAGAGAGG + Intergenic
979029731 4:115627731-115627753 ATTTCTCTACAAAAGCTGAGAGG + Intergenic
979150767 4:117311259-117311281 ATCTCTATGCAGGAACAGAGGGG + Intergenic
979527406 4:121731742-121731764 TTCACTCTGCAGAAGCAGGAAGG - Intergenic
979615752 4:122740522-122740544 ATCTCTCTGCACAATTAGATTGG + Intronic
982374674 4:154676952-154676974 ATCTCTCTGCTGCAGCTGAAGGG - Intronic
982638916 4:157932284-157932306 ATCTCTCTAAAGAAATAGAGAGG - Intergenic
983104015 4:163662925-163662947 ATCTCTCTGAAGAAGGGGTGAGG - Intronic
984269540 4:177534202-177534224 ACCTCTCTGGAGAAGCAGGAGGG + Intergenic
985227290 4:187775479-187775501 ATCTATCTCATGAAGCAGAGGGG + Intergenic
985267130 4:188160652-188160674 ATCTCACTGCAGAGGCAGCCAGG + Intergenic
1202769292 4_GL000008v2_random:186728-186750 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
985861622 5:2476024-2476046 AAAACTCAGCAGAAGCAGAGGGG + Intergenic
987380628 5:17282505-17282527 ATGTCTGTGCTGAGGCAGAGTGG - Intergenic
988282452 5:29167627-29167649 CTCTCTCTGCTGCAGCACAGAGG + Intergenic
990629266 5:57650504-57650526 GACTATCTGCAGAAGCAGATGGG + Intergenic
990978519 5:61580236-61580258 CTCTCTCTGCAGCTGCAGACCGG - Intergenic
991004024 5:61810275-61810297 ATCCCTCACCAGAAGCAGAGGGG + Intergenic
991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG + Intergenic
991554116 5:67876169-67876191 TTCTCTCTTCAGCACCAGAGGGG + Intergenic
991641388 5:68757840-68757862 TTCTCTCTGCAAAGGCAAAGAGG - Intergenic
992286715 5:75242998-75243020 ATGTTTCTTCAGAAGCAGAAAGG + Intergenic
992664565 5:78994445-78994467 ATCCCTCAGGTGAAGCAGAGTGG - Intergenic
992990658 5:82279585-82279607 ATCTCTGTGCAGATGTAGAATGG + Exonic
995225021 5:109691031-109691053 CTCTCTCTTCAGAGGCAGCGGGG - Intronic
995801757 5:116004162-116004184 TTCTCTCTTCTGAAGGAGAGTGG - Intronic
996488088 5:124059938-124059960 CTCTCTCTGCAGGAGCACAAAGG - Intergenic
996873329 5:128215823-128215845 ATCTCTCAGCAGAGGCGGAGGGG + Intergenic
997649116 5:135502439-135502461 ATTTTTCTGCAGAAGCAAGGGGG + Intergenic
998077886 5:139251102-139251124 ATCGCTCTCTAGAAACAGAGGGG + Intronic
998807165 5:145929813-145929835 ATCTCTCACCAGATGTAGAGTGG + Intergenic
999149746 5:149418902-149418924 ATCTGTCTCCAGAAGCAAGGGGG - Intergenic
999327248 5:150650889-150650911 AGCTCTCTGAAGCAGCGGAGAGG - Exonic
1001544892 5:172564967-172564989 CTCTCTCTGCAGAGGAATAGGGG + Intergenic
1002605905 5:180382575-180382597 ATCTCTGTGTAGATGCAGAATGG + Intergenic
1003333526 6:5149529-5149551 ATCTCTCTGGAGAAGCAATAAGG - Intronic
1006263660 6:32897143-32897165 GTCTCTTTGAATAAGCAGAGGGG - Intergenic
1008294143 6:49756256-49756278 CTCTCTCTGCAGTGGCAGAGAGG + Intergenic
1008711649 6:54234940-54234962 ATCTCAGTGGAGAAGCAGAATGG - Intronic
1011634617 6:89359664-89359686 AGCTCTCTGCAAAGCCAGAGGGG + Intergenic
1012709519 6:102581828-102581850 ATCTCTCGGCACAAACAGACTGG + Intergenic
1016679095 6:146807605-146807627 TTTTCTCTCCAGAAGCAGGGTGG - Intronic
1018659860 6:166076194-166076216 CTCTGTCTGCTGCAGCAGAGTGG + Intergenic
1019382367 7:730727-730749 CTCTCCCTCCAGCAGCAGAGTGG + Intronic
1019542865 7:1559403-1559425 GTCTCTCTGCAGATGCGGACAGG + Intronic
1020747645 7:12097995-12098017 CTCTCTCTGCAGTGGCACAGTGG - Intergenic
1021745429 7:23736046-23736068 ATATCCCTGCTAAAGCAGAGAGG - Intronic
1023135244 7:37044709-37044731 ATCTCGCTGCAGAAAGAGGGAGG - Intronic
1023274618 7:38504702-38504724 ATATCTATATAGAAGCAGAGAGG + Intronic
1023317043 7:38949544-38949566 CTCTCTCTGCACAGGCACAGAGG - Intergenic
1026065182 7:67065176-67065198 ATCTCTCTGCATGTGCACAGAGG - Intronic
1026211351 7:68308493-68308515 ACTCCTCTACAGAAGCAGAGCGG - Intergenic
1026711685 7:72746690-72746712 ATCTCTCTGCACGTGCACAGAGG + Intronic
1027744233 7:82053636-82053658 ACGTATCTCCAGAAGCAGAGTGG + Intronic
1029611324 7:101628001-101628023 AACTCTCTCCATAAGCAGACCGG - Intronic
1032475137 7:132206743-132206765 AGCTGTCTGCAGAGGCAGAGAGG - Intronic
1034866719 7:154648403-154648425 AACCCTCTGCAGGAGCACAGGGG - Intronic
1035048508 7:155984508-155984530 GTATCTCTGCAGAGGCACAGAGG - Intergenic
1037372094 8:18191024-18191046 GTCACTCAGCAGAAGCACAGTGG - Intronic
1037893052 8:22634102-22634124 AGCTGTCTGCAGAAGCAGGAAGG + Intronic
1041726217 8:61020023-61020045 CTCTCTCTGCACAAGCCAAGAGG - Intergenic
1043151613 8:76724311-76724333 TTCTCTCTTCTGAAGAAGAGAGG - Intronic
1045584017 8:103510624-103510646 ATATCTCTGAACAAGCAGTGGGG + Intronic
1045938519 8:107711132-107711154 ATCTCTCACCAGAAGCACATGGG - Intergenic
1045999135 8:108398157-108398179 ATTTCCTTGCAGCAGCAGAGGGG - Intronic
1047339134 8:123963375-123963397 TTCTCTTTGGAGAAGCTGAGGGG - Exonic
1047449971 8:124956397-124956419 ATCACAGGGCAGAAGCAGAGGGG - Intergenic
1048080545 8:131121875-131121897 CTCTCTCAGCAGAGGCAGAAGGG + Intergenic
1050182709 9:2937387-2937409 GTCTCTCTGGAGAAGGAGTGGGG - Intergenic
1053474490 9:38372330-38372352 ACCTCAGTGCAGAAACAGAGAGG + Intergenic
1054360421 9:64108911-64108933 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1054898652 9:70343012-70343034 ACCTCTCAGCAGGAGCAGATTGG - Intronic
1055194591 9:73573287-73573309 ATGTCTCTGCTTTAGCAGAGAGG - Intergenic
1056295410 9:85188347-85188369 ATCTCTCTCCAAAATGAGAGCGG + Intergenic
1056771653 9:89481915-89481937 ATCTCACTGCAGAAGGAAGGAGG + Intronic
1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG + Intronic
1059766394 9:117387728-117387750 ATTTCTCTCCAGAAACAAAGAGG - Intronic
1060342914 9:122792740-122792762 CTCTCTCTGCAGGAGCAGACAGG + Intergenic
1062255668 9:135619590-135619612 TGCTCTCTGCAGAAGCCCAGCGG + Intergenic
1203694180 Un_GL000214v1:80444-80466 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1203705374 Un_KI270742v1:36981-37003 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1203558635 Un_KI270744v1:28824-28846 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1203642093 Un_KI270751v1:23619-23641 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1187175279 X:16890692-16890714 ATCTCTCTGCAACAACAGAGCGG + Intergenic
1187254982 X:17634468-17634490 ATCTGTGTGCAGAAGCTGAAAGG - Intronic
1188528517 X:31112171-31112193 TTCTCTCTTCAGAAGAAGTGGGG + Intronic
1188846415 X:35077361-35077383 ATCTCCCAGCAGAGGCAGCGTGG - Intergenic
1190561165 X:51686685-51686707 CCCTCTCTGCTGAAGCAGAAAGG + Intergenic
1190563126 X:51706632-51706654 CCCTCTCTGCTGAAGCAGAAAGG - Intergenic
1191185127 X:57603304-57603326 CTTTCTCTGCAGCAGGAGAGGGG + Intergenic
1194398150 X:93411859-93411881 CTCTCTCTTCTCAAGCAGAGGGG - Intergenic
1194713552 X:97264187-97264209 ATATCTCTACAGCAGCTGAGAGG - Intronic
1197009070 X:121538722-121538744 ATCTCTCCTTACAAGCAGAGTGG + Intergenic
1197817193 X:130510312-130510334 ACCTCACTGTATAAGCAGAGGGG + Intergenic
1198811210 X:140538142-140538164 AGCTCTCTGCAGATGCAGGATGG + Intergenic
1199949307 X:152693974-152693996 CTCTCTCTGCACATGCACAGAGG - Intergenic
1199951475 X:152709573-152709595 CTCTCTCTGCACATGCACAGAGG - Intergenic
1199958208 X:152758887-152758909 CTCTCTCTGCACATGCACAGAGG + Intergenic
1199960369 X:152774475-152774497 CTCTCTCTGCACATGCACAGAGG + Intergenic
1200101938 X:153692643-153692665 ACCTCTCTCCAGAAGAGGAGGGG + Intronic