ID: 1086209187

View in Genome Browser
Species Human (GRCh38)
Location 11:84297721-84297743
Sequence CTGGGGGCATGGAAGGAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 726
Summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 662}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086209187 Original CRISPR CTGGGGGCATGGAAGGAAGT CGG (reversed) Intronic
900477167 1:2881462-2881484 CTGGGGCCAGGGCAGGGAGTGGG + Intergenic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
901739607 1:11333739-11333761 AGGGGGGCAGGGAGGGAAGTGGG + Intergenic
901811490 1:11769168-11769190 GTGGGGGCAAGGCAGGAAGTTGG - Intronic
901951330 1:12749670-12749692 CTTGGAGCCTGGAAGGCAGTGGG + Intronic
902220801 1:14963466-14963488 ATGGTCGCAGGGAAGGAAGTTGG + Intronic
902402377 1:16165348-16165370 GTGGAGGCTTGGAAGGAAGAAGG + Intergenic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
902692758 1:18120323-18120345 TTGGGGGCCTGGCAGGAAGCTGG + Intronic
902763395 1:18599141-18599163 CCGGGTTCATGGAAGGCAGTTGG - Intergenic
903669286 1:25025968-25025990 CTGGGGCCAGGGCAGAAAGTTGG - Intergenic
903693861 1:25193262-25193284 CTGGGGGCAAGGGAGGGAGGAGG + Intergenic
904696421 1:32334310-32334332 GTGGGGACAGGGAAGGAGGTAGG + Exonic
904702449 1:32365988-32366010 CTGGAGGAAAGGAAGGAGGTGGG + Intronic
904874173 1:33641281-33641303 CAGAGGGCATGGCATGAAGTAGG + Intronic
904894094 1:33801159-33801181 GAGGGGGCATGGAAGGAAGAGGG - Intronic
905261207 1:36720738-36720760 CTGGAGTGATGGAAGGAACTGGG + Intergenic
905709584 1:40089834-40089856 CTGGGGGAGGGGAAGGAAATGGG - Intronic
905897365 1:41557584-41557606 TTGGGGGGATGGCAGGGAGTGGG + Intronic
906059172 1:42937117-42937139 GTGGGAGCAGGGAAGGAAGAGGG - Intronic
906649677 1:47503723-47503745 CTGGGGTCAAGGAAGAGAGTTGG + Intergenic
906671327 1:47657108-47657130 CTGGAGCCATGGAAGTAAGGAGG + Intergenic
906990618 1:50733636-50733658 ATGAGGACATGGCAGGAAGTTGG + Intronic
907071471 1:51539483-51539505 GTGGGGGCATAAAAGGAAGAGGG - Intergenic
907261985 1:53225702-53225724 CTTGGGGCAATGAAGCAAGTTGG - Intergenic
907313719 1:53554404-53554426 CTGAGGTCATGGCAGGCAGTTGG + Intronic
907603640 1:55794309-55794331 CTGGGGTCATGAATGGCAGTGGG + Intergenic
907923507 1:58934599-58934621 TGGGGGGAATGGAAGGAAGGTGG + Intergenic
908389108 1:63669469-63669491 CTGGGGGCATTGAAGGAGGGCGG - Intergenic
909099051 1:71328022-71328044 GTGGGGGCATGGAAGGGAGGTGG - Intergenic
909218827 1:72927929-72927951 ATCTGGGCAAGGAAGGAAGTAGG - Intergenic
909398538 1:75198241-75198263 CTGGGTGCAGGGATGGTAGTGGG + Intergenic
909720821 1:78767510-78767532 CATGGGGCCTGCAAGGAAGTTGG - Intergenic
910138340 1:83998881-83998903 GTGGGGACATGGAAGGGGGTCGG + Intronic
910827668 1:91427042-91427064 CAGGGAGAATGGAATGAAGTTGG - Intergenic
911094989 1:94047795-94047817 GAGGGGGCATGGGAGGAAGAAGG - Intronic
911242277 1:95479523-95479545 CTGGGGGCTTGGAAGGCATTGGG - Intergenic
911242936 1:95484713-95484735 CTGAGGGAATGGAACCAAGTTGG + Intergenic
911689948 1:100821483-100821505 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
911871823 1:103108560-103108582 CTGGGAGCAGGGAGGGGAGTGGG - Intergenic
912382972 1:109257565-109257587 CTGGGGGCATAGCAGGCATTTGG + Intronic
912451448 1:109770078-109770100 CTGGGCGCATGGCAGGAGGGCGG + Intronic
913078127 1:115358867-115358889 CTGGGAGAATGGAACCAAGTTGG + Intergenic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
913509512 1:119549153-119549175 CTGAGGGCAATGAAGGAAGCAGG - Intergenic
915046301 1:153019859-153019881 CTGGGAGAATGGAACCAAGTTGG + Intergenic
915131242 1:153697182-153697204 CTGGGAGCTGGGGAGGAAGTGGG + Intergenic
916076599 1:161203570-161203592 CTGGGGGCAGGGATGGGTGTGGG - Intronic
916389584 1:164316919-164316941 CAGGAGGCCTGGAAGGAAGAAGG + Intergenic
917041727 1:170812283-170812305 CGGGGAGCATGGAACCAAGTTGG + Intergenic
917162984 1:172079216-172079238 CGGGGAGAATGGAATGAAGTTGG - Intronic
917267167 1:173233372-173233394 CTGGGAGAATGGAACCAAGTTGG + Intergenic
917460848 1:175227859-175227881 GTGGGAGCAGGGAAGGACGTTGG - Intergenic
917573536 1:176295672-176295694 CTGGGAGAATGGAACCAAGTTGG - Intergenic
919793282 1:201305972-201305994 CTGGGGCCATGGAAGGGAGATGG + Intronic
919818285 1:201455861-201455883 CAGGGTGCCTGGAAGGATGTGGG - Intergenic
919858370 1:201720956-201720978 GTGGGGGCATGGAATGCAGGGGG + Intronic
920732769 1:208503386-208503408 CTGGGAGCAAGGAGGGGAGTTGG + Intergenic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
922412496 1:225390039-225390061 TTGGGGTGAGGGAAGGAAGTGGG - Intronic
922716172 1:227873697-227873719 CGGGGAGAATGGAATGAAGTTGG + Intergenic
922790523 1:228308482-228308504 CTGGGGGCCTGGCAGGGAGGTGG + Intronic
922860256 1:228810398-228810420 ATGGGGGCAGGTAAGGAAGAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923659483 1:235945918-235945940 CTGGGGGAGAGTAAGGAAGTGGG + Intergenic
923731113 1:236551169-236551191 CTGTGGGCAAGGAATGAAGGCGG - Exonic
924142288 1:241037952-241037974 TTGGGGACATGGGAGGAGGTGGG + Intronic
1063528621 10:6808742-6808764 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1063637721 10:7799791-7799813 CTGGTGGCATTCAAAGAAGTGGG + Exonic
1063694773 10:8323493-8323515 TTGGGTGAAAGGAAGGAAGTAGG + Intergenic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064225814 10:13483821-13483843 CTGGGGGTACGGGAGGAAGGGGG + Intronic
1065127200 10:22584980-22585002 CTGGGGGCCTGGTAGAAAGGCGG + Intronic
1065161490 10:22927526-22927548 TGGGGGGCATGGGAGGAAGAAGG + Intergenic
1065300346 10:24315411-24315433 CTGTCTGCAAGGAAGGAAGTAGG + Intronic
1065490559 10:26277758-26277780 CTGGAGGCCTGGAAGGAAAATGG + Intronic
1066077246 10:31891679-31891701 CGGGGAGAATGGAACGAAGTTGG - Intronic
1066297691 10:34069027-34069049 CGGGGAGAATGGAAGCAAGTTGG + Intergenic
1067471775 10:46543000-46543022 CTGGGTGAATGGAAGGACTTTGG - Intergenic
1067761969 10:49055191-49055213 CAGGGGGCCTGGAAGGATGTTGG - Intronic
1068253579 10:54476977-54476999 CTGGAGGCAAAGAAGGAAGTTGG - Intronic
1069504827 10:68988581-68988603 CAGGGGGCGGGGAAGGAGGTGGG + Intergenic
1069583283 10:69579380-69579402 CTGGGGGCAATGATGGTAGTGGG + Intergenic
1069749137 10:70734556-70734578 CTGGGGCCAAGGATGGGAGTGGG - Intronic
1069773584 10:70914313-70914335 CTGGGGCAATGGCAGGCAGTGGG + Intergenic
1069819779 10:71220307-71220329 GTGGGGGCAGGGCAGAAAGTAGG - Intronic
1069888035 10:71636203-71636225 CTGGAGTCATGGAAAGCAGTTGG + Intronic
1070140171 10:73732895-73732917 CTGGGGGCGTGGGGGGCAGTGGG - Intergenic
1070456984 10:76626972-76626994 CTGGCTGCCTGGAAGGAGGTGGG + Intergenic
1070505844 10:77112010-77112032 CTGGGGACAAGGTTGGAAGTTGG - Intronic
1071110167 10:82146684-82146706 GTTGGGGTATGGAAGGAGGTGGG + Intronic
1071211008 10:83341968-83341990 CGGGGAGAATGGAAGCAAGTTGG - Intergenic
1071766655 10:88673899-88673921 CTGGGGTGATGGAAGGATGCTGG - Intronic
1071900653 10:90117664-90117686 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1072485277 10:95848587-95848609 ATGGCGGCATGGAAGCAAGCTGG - Intronic
1073004932 10:100316053-100316075 CTGGGACCATGGTAAGAAGTGGG - Intronic
1073480429 10:103783184-103783206 CTGGGGGCAGGCAAGGAGTTTGG + Intronic
1073661317 10:105479606-105479628 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074690033 10:115996332-115996354 TTGGGAGCATAGAGGGAAGTTGG + Intergenic
1075131058 10:119740269-119740291 GTGGGGGCAGGGCAGGAAGTTGG + Intronic
1075182249 10:120222141-120222163 CTGTGGGCATGGCAGGAGCTGGG - Intergenic
1075205774 10:120446592-120446614 CGGGGAGAATGGAAGCAAGTTGG + Intergenic
1075444055 10:122501529-122501551 CTGCCAGCAGGGAAGGAAGTTGG - Intronic
1075576359 10:123580557-123580579 CTGGGGCAATGGGAGGAAGTTGG - Intergenic
1075708354 10:124516471-124516493 CTGGAAGCATCGAAGGCAGTAGG + Intronic
1075995120 10:126870881-126870903 AAGGGGGCAGGGGAGGAAGTGGG + Intergenic
1076079391 10:127565116-127565138 CTGGGGACAGGGAGGAAAGTCGG - Intergenic
1076216306 10:128696271-128696293 CTGAGGGCATGGAGGGCTGTGGG - Intergenic
1076936048 10:133567999-133568021 CTGTGGGCAAGGGAGGAAGGGGG + Intronic
1077020984 11:417107-417129 CTGGGGGAAGGGAGGAAAGTGGG - Intronic
1077279217 11:1734554-1734576 CTGGGGGGACGGAAGGGGGTGGG - Exonic
1077546101 11:3170708-3170730 CTGGAGGCAAGGAGGGAGGTTGG + Intergenic
1078433773 11:11308029-11308051 CTGGGAGGATTGGAGGAAGTGGG - Intronic
1078646012 11:13141951-13141973 CGGGGGAAATGGAAGGAAGCCGG + Intergenic
1078836456 11:15035130-15035152 CTGGGGGCATGAATGCCAGTGGG - Intronic
1080061050 11:27957354-27957376 CTGGGGTGATGGAAGAGAGTAGG - Intergenic
1082112659 11:48293964-48293986 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
1082225893 11:49706342-49706364 CTGGGTTAATGGAAGGCAGTAGG - Intergenic
1082279619 11:50257756-50257778 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1082684488 11:56220989-56221011 CGGGGGGAATGGAACCAAGTTGG + Intergenic
1082779350 11:57274430-57274452 CTGGGGGCAGGGCAGGAATATGG - Intergenic
1082824574 11:57568179-57568201 CTGGGCCCATGGAGGGAAGGCGG - Intronic
1082907220 11:58321777-58321799 GTGGGGGCATGGAAGAAAATGGG - Intergenic
1083317096 11:61822535-61822557 CTGAGGGCCTGGGAGGAAGAAGG - Intronic
1083869352 11:65477456-65477478 CTGGGGACACGGCAGGAAGAAGG + Intergenic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1084321387 11:68375338-68375360 GTGGGGGCCAGGAAGGGAGTCGG - Intronic
1084955874 11:72691325-72691347 CCCTGGGCATGGAAGGAAGGAGG - Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085293636 11:75417978-75418000 CTAGAGGCCAGGAAGGAAGTGGG + Intronic
1085741642 11:79082467-79082489 CTGAGGCCGTGGAAGGAAGCAGG - Intronic
1085823603 11:79819207-79819229 CAGAAAGCATGGAAGGAAGTGGG - Intergenic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1086342851 11:85864969-85864991 CTGGGGACATGGAAGCAATCAGG + Intronic
1086457154 11:86970466-86970488 CTGGGGAGATGGAAGGATGCTGG - Intergenic
1086567385 11:88242006-88242028 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
1086622765 11:88907343-88907365 GTGGGGGCATGGAAGGCAAGAGG - Intronic
1087513650 11:99129506-99129528 CAGGGAGAATGGAAGCAAGTTGG + Intronic
1088648251 11:111935305-111935327 CTTGGGCCAAGTAAGGAAGTTGG + Intronic
1088693875 11:112349819-112349841 CTGGGGACAGGAAAGGAAGGGGG + Intergenic
1088824599 11:113483216-113483238 CTGGGGGCATGGAGGGACACAGG - Intergenic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089519592 11:119055061-119055083 CTGAGGGGAAGGAAGGTAGTTGG + Intronic
1090384296 11:126347711-126347733 CTGGGGTCTTGGCAGGAGGTTGG + Intergenic
1091681821 12:2532890-2532912 CTGGGGGCATGACAGGAAGTGGG - Intronic
1091714923 12:2770231-2770253 CTGCAGGCATGGAGGGCAGTGGG - Intergenic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1092480625 12:8855975-8855997 TTTGGGGCAAGGGAGGAAGTGGG + Intronic
1092905942 12:13101041-13101063 CTTGGGGCCTGGAAGAAAGGCGG - Intronic
1093082811 12:14832602-14832624 CTAGGTGCAGGGAAGGAAATAGG - Intronic
1093887684 12:24481273-24481295 GTGGGGGGTTGGAAGGATGTAGG + Intergenic
1094381704 12:29849984-29850006 CGGGGAGCATGGAACCAAGTTGG + Intergenic
1095847832 12:46765615-46765637 GTGGGGGCAGGGAATTAAGTTGG - Exonic
1096020870 12:48324646-48324668 ATGGGGGAATGGAACCAAGTTGG - Intergenic
1096394174 12:51253034-51253056 AAGGGGCCATGGAAGGAAGGTGG + Intronic
1096589142 12:52645695-52645717 CTGGCAGCATAGAAGAAAGTGGG - Intronic
1096806268 12:54143034-54143056 GTGGGTGCAAGGAAGGAAGAAGG + Intergenic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1098550204 12:71754382-71754404 GTGGGGGAATGGAAGGATGGGGG + Intergenic
1098839834 12:75465706-75465728 CGGGGAGCATGGAAGCAAGTTGG - Intergenic
1099550877 12:84042356-84042378 CGGGGAGAATGGAAGCAAGTTGG - Intergenic
1100116628 12:91313408-91313430 CAGGAGGCATAGAAGCAAGTAGG + Intergenic
1100188998 12:92170625-92170647 CTGTAGCCATGGATGGAAGTGGG - Intergenic
1100392816 12:94158823-94158845 CTGGGAACATGGGAGGAAGCAGG + Intronic
1101206440 12:102492992-102493014 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1101421985 12:104557716-104557738 ATGGTGGGAGGGAAGGAAGTGGG + Intronic
1101649143 12:106659040-106659062 CAGGGGTCAGGGAAGGAAGTGGG - Intronic
1101736654 12:107468291-107468313 CTGTGGGCCTGGCAGGAGGTAGG + Intronic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102440892 12:112963290-112963312 CTGGGGGCACAGCAGGAAGGTGG - Intronic
1102571895 12:113831825-113831847 CGTGGGGAGTGGAAGGAAGTAGG + Intronic
1102723258 12:115035820-115035842 CTGGAGGGAGGGAAGGAAGGGGG - Intergenic
1102741791 12:115213927-115213949 CTGGGGATATGGCAGGAACTGGG - Intergenic
1102878604 12:116466964-116466986 GTGGGGACAGGGAAGGAATTTGG + Intergenic
1102950427 12:117027379-117027401 CCGGGTGCCTGGAAGGCAGTGGG - Exonic
1103151958 12:118648483-118648505 CTGGGGGAAGGGAAGGAAGCAGG + Intergenic
1103235026 12:119364963-119364985 CAGTGGACATGGAAGGCAGTTGG + Intronic
1103239011 12:119397997-119398019 GTGGGGGGATGGGAGGAAGGGGG + Intronic
1103728864 12:123012922-123012944 ATGGGGGCAGGGAAGGATTTAGG + Intronic
1103889385 12:124227378-124227400 CTGGGGGAAGGGAAGGAATGAGG + Intronic
1103939845 12:124495693-124495715 CGGGGGCCATGGAGTGAAGTTGG - Intronic
1104731054 12:131105559-131105581 GTGTGGGCATGGAAGGAGCTGGG + Intronic
1105072873 12:133246467-133246489 CGGGGAGAATGGAACGAAGTTGG + Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1106149846 13:27088601-27088623 TTGGGGGCATGGTAGGCAGAGGG + Intronic
1106570663 13:30924493-30924515 CTGGGGGGAGGGTAGGAGGTGGG + Exonic
1108001704 13:45910445-45910467 CTGAGGGCATCCAAGGAAGTGGG - Intergenic
1108068979 13:46607949-46607971 CTGAGGGCAGGGAGGGATGTGGG + Intronic
1108173815 13:47772089-47772111 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1109737326 13:66503990-66504012 CAGGTGGCATGAAATGAAGTTGG - Intronic
1110631107 13:77709304-77709326 CTGGGAGAATGGAACCAAGTTGG + Intronic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112601572 13:100860722-100860744 CTGGGGGCAGGGGAGGAAATGGG - Intergenic
1112653036 13:101418979-101419001 CTGGGGACATGGAGGCAAATGGG - Intergenic
1113294337 13:108941335-108941357 TTTGGGGCATGGCAGGAAGTAGG - Intronic
1114845050 14:26310460-26310482 CGGGGAGAATGGAAGCAAGTTGG + Intergenic
1116225145 14:42141040-42141062 ATTGGGGTATGGAAGGTAGTAGG + Intergenic
1117635768 14:57741630-57741652 CTGGGAGAATGGAACCAAGTTGG + Intronic
1117677356 14:58168282-58168304 CTGGGGGAATGGAATGAACTAGG + Intronic
1119154803 14:72399931-72399953 CTGGGAGAATGGAACCAAGTTGG + Intronic
1119195454 14:72714154-72714176 CAGGAGGCATGGCAGGAGGTGGG + Intronic
1119706953 14:76788947-76788969 CTGGATACATGGAAGGAAGGGGG + Exonic
1120931752 14:89855772-89855794 GTGGGGGCATGCCAGGAAATGGG - Intronic
1121125717 14:91405410-91405432 CTGAGGGCTTGGAATGAAGTGGG - Intronic
1121322215 14:92998533-92998555 TTGGGGGCAGGGACAGAAGTAGG + Intronic
1121456342 14:94041106-94041128 CAGTGGGCATGGCAAGAAGTGGG + Intronic
1122050754 14:99058126-99058148 CTAGGGTCATGGTAGGAACTTGG - Intergenic
1122779959 14:104139349-104139371 CTTGGGGCTTGGAGGGAAGCAGG + Intronic
1122877754 14:104676758-104676780 CAGGGGGCAGGGAAGGTAGCCGG - Intergenic
1122981534 14:105194359-105194381 CTTGGGGGATGGAAGGAAGAGGG - Intergenic
1124184975 15:27517080-27517102 CTGGGCGCATGCATGGAGGTGGG - Intronic
1124824981 15:33084708-33084730 CTTGGGGAATGGCAGGAGGTGGG - Intronic
1125190441 15:36986518-36986540 CTGGGAGCACTGAAGGAAGCTGG - Intronic
1125257196 15:37778629-37778651 CTGGGAGAATGGAAATAAGTTGG + Intergenic
1126326469 15:47483124-47483146 TTGGGGGCATGGAGGGAATTTGG + Intronic
1128334619 15:66777980-66778002 TTGGGGGGATGGAAGGAGTTTGG + Intronic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128784806 15:70386958-70386980 AGGGGGGCGTGGAAGGAAGAAGG + Intergenic
1128803653 15:70514319-70514341 CCTGGGGCATGGAAGGAGGCAGG - Intergenic
1128852353 15:70972582-70972604 CGGGGAGAATGGAAGCAAGTTGG - Intronic
1128990773 15:72258210-72258232 CTGGGAGGATGGAGGGTAGTTGG - Intronic
1129468727 15:75738540-75738562 CTGGGGGCACGGCGGGGAGTCGG + Intergenic
1129563374 15:76594370-76594392 CTGGGAGAATGGAACCAAGTTGG + Intronic
1129574321 15:76724524-76724546 CAGGGAGAATGGAAGCAAGTTGG - Intronic
1129709698 15:77814314-77814336 CTGAGGGCACGGTGGGAAGTGGG - Intronic
1130452754 15:84073614-84073636 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1130884461 15:88081641-88081663 CTGGGGGCTCAGAAGGAAGGGGG - Intronic
1131477900 15:92756152-92756174 CTGGGAGAATGGAACCAAGTTGG + Intronic
1132095556 15:98981914-98981936 CTGGGGGCCATGTAGGAAGTAGG + Intronic
1132618247 16:852751-852773 CAGGGGGCATGGAGGGCTGTTGG + Intergenic
1132655727 16:1041011-1041033 CTGGGGGTCTGGGAGGAGGTGGG - Intergenic
1132655843 16:1041370-1041392 CTGGGGGTCTGGCAGGAGGTGGG - Intergenic
1132683355 16:1152764-1152786 TTGGGGGCAGGGAAGGACGTAGG + Intergenic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1132836087 16:1954149-1954171 CTGGGGGGCAGGAAGGAAGGAGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133401927 16:5494458-5494480 CTGGGGGCATTGATGGATCTTGG + Intergenic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1135046880 16:19163204-19163226 CTGTGGGCATGGCTGGAAATAGG - Intronic
1136016773 16:27405727-27405749 CTGGGGCCAGGGCAGGGAGTGGG - Intronic
1136647451 16:31634466-31634488 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1137356290 16:47768454-47768476 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1138700142 16:58854057-58854079 CGGGGAGATTGGAAGGAAGTTGG + Intergenic
1139797565 16:69495888-69495910 CTGGGGACCTGGGAGGAACTTGG - Intergenic
1140092923 16:71852037-71852059 CCTGGGGCAAGGAAGGAAGGGGG + Exonic
1140218641 16:73028023-73028045 CTGGCGGCCTGGGAGGAGGTGGG - Intronic
1140352869 16:74279515-74279537 TTGGGGGAAGGGATGGAAGTGGG + Intergenic
1141268720 16:82520081-82520103 GTGGAAGCATGGAAAGAAGTGGG - Intergenic
1141421570 16:83921172-83921194 ATGGGTGGATGGAAGGAAGATGG + Exonic
1141604383 16:85144574-85144596 CTGGGGGTAGGGAAGGGAGGAGG + Intergenic
1141946011 16:87310713-87310735 CTGGCTGCATGGAGGGAGGTGGG - Intronic
1142589724 17:997411-997433 CTGAGGGCCTGGACGGCAGTGGG + Intronic
1143963157 17:10737308-10737330 GTGCGGGCATGGAACGAAGGAGG + Intergenic
1144213135 17:13032042-13032064 AAGGGAGCAAGGAAGGAAGTTGG - Intergenic
1144824529 17:18098346-18098368 CTGGGGTCATTGAAGTAAGTGGG + Exonic
1145831655 17:27921235-27921257 CTGGGTGCATGGGAGGCAGGTGG - Intergenic
1146103522 17:30009386-30009408 CTGGAGGTTTGGAAGGAAATGGG - Intronic
1146340013 17:32010787-32010809 CTGGGGGCTGGGAAGCAGGTAGG - Intronic
1146658839 17:34651403-34651425 CTGGGGGCATTGAGGGCACTTGG - Intergenic
1146974096 17:37096317-37096339 CTGGGTGCCTGGTAGGAAGAAGG - Intronic
1147160924 17:38569064-38569086 CTGGGGGCAGTGAAGGGAGTTGG + Intronic
1147241407 17:39093177-39093199 CTGGGGGCAGGGACTGAAGTGGG - Intronic
1147316214 17:39621652-39621674 CTGGGTGAATGGGAGCAAGTTGG + Intergenic
1147320022 17:39640490-39640512 TTGGGGGGATGGAAGGGAGCCGG - Intronic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149535702 17:57431817-57431839 CTGGGGGCAGAGAGTGAAGTGGG - Intronic
1150219333 17:63487250-63487272 ATCGGGGCATGGTATGAAGTAGG - Intronic
1150645712 17:66976389-66976411 ATGGAGGGATGGAAAGAAGTTGG - Intronic
1150977556 17:70105777-70105799 CTGAAGGCATGGAATGTAGTAGG - Intronic
1151210994 17:72543593-72543615 CAGGGGACATGGAAGGGAGAGGG - Intergenic
1151969576 17:77450826-77450848 CTGGGACCATGGAAGGGAGAAGG - Intronic
1152336888 17:79703750-79703772 CTGTGGGCATGGAAAGATGCTGG - Intergenic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1153722671 18:7922716-7922738 ATGGTGGCATAGAAGCAAGTTGG - Intronic
1155852062 18:30786396-30786418 CTGGGGGGCAGGAAGGGAGTGGG - Intergenic
1156570227 18:38244183-38244205 GTGTGTGCATGGCAGGAAGTAGG - Intergenic
1156612224 18:38738373-38738395 CTGGGGGCAGTGATGGAAATAGG + Intergenic
1157492054 18:48130343-48130365 CTGGGGGCTTTAAGGGAAGTGGG + Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158348569 18:56540743-56540765 GTGGGGACATGGCAGGAAGTGGG + Intergenic
1158900311 18:61956266-61956288 ATGGGGCAATGGAAGGAGGTAGG - Intergenic
1160326240 18:77951282-77951304 CTGGGGTTATGGATGGAACTTGG + Intergenic
1160767888 19:816517-816539 CTGGGGGCATGGGTGGAGGATGG - Intronic
1161233139 19:3185581-3185603 CTTGCGACCTGGAAGGAAGTTGG - Exonic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1161279052 19:3435190-3435212 CGGAGGACATGGAAGGAGGTAGG + Exonic
1162095340 19:8306728-8306750 CCGGGGGCGGGGAAGGAAGCAGG - Intronic
1162555776 19:11384440-11384462 TTGGGGGCAGGGGAGGGAGTTGG + Intronic
1162564975 19:11441014-11441036 CTGGGGTCAGGGAAGGGACTAGG - Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163639568 19:18454004-18454026 CTGGGAGCATGGGAGGGAATGGG + Intronic
1164553532 19:29232494-29232516 ATGGGGGCATGGAAGAAGGCAGG + Intergenic
1164576728 19:29409440-29409462 GTAGGGGCATGGATGGGAGTCGG + Intergenic
1164895930 19:31877691-31877713 CTGAGGACATGGAAAGGAGTAGG + Intergenic
1165455468 19:35908099-35908121 CTTGGGGCAGGGCAGGGAGTGGG - Intronic
1165781066 19:38434606-38434628 CTGGGGGCAGGGATGGGAATTGG + Intronic
1165843219 19:38801949-38801971 CTGAGGCCCTGGAAGGAAGTGGG + Intronic
1166077957 19:40425085-40425107 GTAGTGGCATGGAAGGAAGTCGG + Intronic
1166147766 19:40849179-40849201 ATGGAGGAAGGGAAGGAAGTGGG + Intronic
1166178266 19:41089695-41089717 ATGGAGGAAGGGAAGGAAGTGGG - Intronic
1166283813 19:41811362-41811384 CTGGGGGCAGGGAGGGATGGGGG + Exonic
1166293319 19:41877211-41877233 CGGGGGGCTGGGCAGGAAGTAGG + Exonic
1166667898 19:44692247-44692269 TTGGTGGCAGGGAAGGAAGTGGG + Intergenic
1166730975 19:45058917-45058939 ATGGAGGCAAGGAAGGAAGGAGG - Intronic
1167963858 19:53128078-53128100 ATAGGGGCATGGAAGCAAGGTGG - Intronic
1168108951 19:54181204-54181226 CAGGGAGCTTGGAAGGAAGGTGG + Intronic
1168497894 19:56869516-56869538 CTGGGGAAATGAAAGGAAGTGGG - Intergenic
1168692632 19:58386188-58386210 CTGGGGGAAGGGACAGAAGTTGG + Intergenic
1168726178 19:58583360-58583382 CTGGGGGCATGGCAGGAGTCCGG - Intergenic
925120769 2:1416010-1416032 CTTGGGGCATGGATGGAAGCTGG - Intronic
925319020 2:2947889-2947911 CTAGGGGCAGGGAAGGCACTAGG - Intergenic
925859110 2:8157825-8157847 CTGGGGTCCTGGAAGGGAGAGGG - Intergenic
925916923 2:8613589-8613611 ATGGAAGCATGGATGGAAGTAGG + Intergenic
926051832 2:9750041-9750063 GTGGTGGCATGGAATGAACTGGG + Intergenic
927013538 2:18931496-18931518 CTGGGGCCATGGAAGGGGATGGG + Intergenic
927339541 2:21966651-21966673 CTGGGAGCATGGCAGGGAGGTGG + Intergenic
927458388 2:23276892-23276914 CTGGAGGCAAGGAAGCCAGTAGG + Intergenic
927757491 2:25720604-25720626 CTGGGGGAAGGCAAGGAACTGGG + Intergenic
927894852 2:26775154-26775176 CTGGGGGCAGGAAAAGAAGAGGG - Exonic
928487807 2:31750051-31750073 CTGGGAGAATGGAACCAAGTTGG + Intergenic
929272329 2:39986071-39986093 CTGGGAGAATGGAACCAAGTTGG + Intergenic
929580487 2:43079045-43079067 TTGAGGGCATGTAAGGAAATGGG - Intergenic
929779570 2:44949191-44949213 CTAGGGGCAGGGACGGAAGAGGG - Intergenic
929882310 2:45847674-45847696 CTGGGGCCATGAATGGAAGCAGG - Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930232501 2:48857456-48857478 CTGGGGTCCTGTCAGGAAGTAGG - Intergenic
930911549 2:56635837-56635859 CGGGGAGAATGGAAGCAAGTTGG - Intergenic
932019204 2:68065292-68065314 CTGGGAGAATGGAACCAAGTTGG + Intronic
932405647 2:71511223-71511245 CTGGGGGGCAGGAAGGAAGAGGG + Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932776533 2:74531270-74531292 CTGGGGGCATACCAGGATGTAGG - Intronic
935631102 2:105212940-105212962 CTGGGAGAATGGAACCAAGTTGG - Intergenic
935922856 2:108034001-108034023 TTGGGGTCATGGAAAGAGGTGGG - Intergenic
936859752 2:117002661-117002683 CGGGGAGAATGGAACGAAGTTGG + Intergenic
937002737 2:118482999-118483021 CTGGGGTTCTGGAAGGAAATGGG + Intergenic
937094437 2:119226221-119226243 CTGGGGCAAGGGAAGGAAGCAGG + Intronic
937564143 2:123263005-123263027 CTGTGGGGATTGAAGAAAGTAGG + Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
938003693 2:127769579-127769601 CTGAGGGCTTTGAAGGAATTGGG - Intronic
939101538 2:137899983-137900005 CTTGGGGCAAAGATGGAAGTTGG + Intergenic
939686987 2:145212423-145212445 ATGGGAGAATGGAAGCAAGTTGG - Intergenic
939814587 2:146877927-146877949 CTGGAACCATGGTAGGAAGTGGG + Intergenic
939983153 2:148805104-148805126 CTGGCCTCATGGAATGAAGTGGG + Intergenic
940030393 2:149256237-149256259 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
941425993 2:165346304-165346326 CTGGGAGAATGGAACCAAGTTGG - Intronic
941435568 2:165467006-165467028 CTGGGGGTATGGGAAGATGTAGG - Intergenic
942044071 2:172088818-172088840 CTGGGGGCATTGGAGGGAGGGGG + Exonic
942458806 2:176155638-176155660 CTTAGGGCAGGGAAGGAAATGGG + Intronic
942989339 2:182180683-182180705 CTGGGAGAATGGAATCAAGTTGG - Intronic
943409955 2:187534112-187534134 CAGGGAGAATGGAAAGAAGTTGG + Intronic
943919003 2:193677935-193677957 CTTGGGGCAGTGAAGAAAGTAGG + Intergenic
943961185 2:194265102-194265124 CTGGGGCCATGGATGGCAGCAGG + Intergenic
944119672 2:196227551-196227573 CTGGGGGCATTGATGGTAGAAGG - Intronic
945522180 2:210842656-210842678 CTAGGGTCATGGAATGAATTGGG + Intergenic
946048768 2:216843289-216843311 CAGGGGGCCTGGAAGGAAGGGGG + Intergenic
946178368 2:217935591-217935613 CTGGAGGCTTAGAAGGAATTCGG - Intronic
946410616 2:219513531-219513553 GTGGGGGCGTGGAAGGGAGCAGG - Intergenic
946659135 2:221980491-221980513 ATGGGGGCAGGGAATGAAGATGG + Intergenic
948869256 2:240790087-240790109 CTGGGGGCAAGGATGGAAGGTGG - Intronic
948908600 2:240991785-240991807 CTGAGGGCACGGAATGAAGCCGG - Intronic
1168788117 20:557190-557212 GTGGGGGCAGGGGAGGCAGTGGG + Intergenic
1169966101 20:11219126-11219148 CTGTGGGCATGGTAGGACTTCGG + Intergenic
1171053549 20:21883743-21883765 CTGGGGGCCAGGAATGAATTTGG + Intergenic
1171281303 20:23901445-23901467 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171397756 20:24849273-24849295 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1171522482 20:25786431-25786453 CTGGGGGCCTGCAGGGAGGTCGG + Intronic
1171554345 20:26069452-26069474 CTGGGGGCCTGCAGGGAGGTCGG - Intergenic
1171990729 20:31694330-31694352 ATGGGGGTGGGGAAGGAAGTGGG + Intronic
1172097637 20:32468057-32468079 CTGGGGGCATGCCAGGATGAGGG + Intronic
1172936252 20:38622680-38622702 CTGCAGGCATGGAGGGATGTGGG - Intronic
1172946545 20:38693670-38693692 CTGGGGTCAGGGAAAGAACTAGG - Intergenic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1174406419 20:50306032-50306054 CTGGGGACATGGCAGGACATAGG + Intergenic
1174884379 20:54316125-54316147 CTGGGTGCATGGATCCAAGTGGG + Intergenic
1175117256 20:56691370-56691392 CTGGGGGCAGGGAAAGGAGCTGG - Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175332772 20:58176433-58176455 CTAGGGGGTTGGAAGAAAGTGGG - Intergenic
1175528833 20:59659997-59660019 CTGGGGGCAGGGAAGACAGCTGG - Intronic
1176263334 20:64194750-64194772 CTGGGGGCAAAGGTGGAAGTTGG + Intronic
1176453411 21:6884670-6884692 CTCGGGGCAAAGATGGAAGTTGG + Intergenic
1176831586 21:13749718-13749740 CTCGGGGCAAAGATGGAAGTTGG + Intergenic
1177132279 21:17272818-17272840 CAGGGAGCATGGAACCAAGTTGG + Intergenic
1177694735 21:24556366-24556388 CAGGGAGAATGGAACGAAGTTGG + Intergenic
1177763923 21:25435000-25435022 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1178529777 21:33366140-33366162 CTGCAGGCATTGAAGGAAGAGGG - Intergenic
1178838866 21:36122336-36122358 ATGAAGGCATGGAAGGAAATGGG + Intergenic
1178924408 21:36762797-36762819 CTGGAGGCCAGGATGGAAGTGGG - Intronic
1179179868 21:39036061-39036083 CAGGAGGCATGGATGGAAGAGGG - Intergenic
1179771269 21:43619382-43619404 ATGGTGGCATAGAAGCAAGTTGG + Intronic
1179884328 21:44306997-44307019 CTGGGGGCAGGGAAGGAGCTGGG + Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181469194 22:23127531-23127553 CTGGGTCCATCGAAGGAAGCTGG + Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181907415 22:26210322-26210344 CTGGGGGCAGAGAAGGAAACAGG - Intronic
1182098924 22:27644603-27644625 CTGAGTGGATGGACGGAAGTAGG + Intergenic
1182427592 22:30283068-30283090 CTGGGGGCCTGGATGGGACTAGG + Intergenic
1182865465 22:33600580-33600602 ATGGGGGAAAGGAAGGAGGTTGG + Intronic
1182881781 22:33739839-33739861 ATGAGGGCATGGAAGGAGGCGGG + Intronic
1183272481 22:36870828-36870850 CTGGGTGCCTGGAAAGAATTGGG + Intronic
1183306474 22:37085706-37085728 GTGGGGGCTGGGAAGGCAGTGGG + Intronic
1183738506 22:39657139-39657161 CTGGGGGCAGTGGGGGAAGTTGG - Intronic
1184320879 22:43741368-43741390 CTTGGTGCATGTAAGGAAGAAGG - Intronic
1184941547 22:47769793-47769815 AGGAGGGCATGGCAGGAAGTGGG - Intergenic
1184969215 22:48003221-48003243 CAGGGGACCTGGAAGGAAGGTGG + Intergenic
1185176905 22:49333025-49333047 CTGGGGGCAAGGGAGGAGGCAGG + Intergenic
1185195079 22:49464351-49464373 CTGGGGGCAGGGTGGGGAGTGGG - Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949206031 3:1439856-1439878 TTGGGAGCATGGAATGAACTAGG + Intergenic
949374293 3:3370040-3370062 CTCGGGGAAAGGATGGAAGTGGG - Intergenic
949535668 3:4994682-4994704 TTGGGGAGATGGAAGGAAGCTGG - Intergenic
949588183 3:5464238-5464260 CTGGGGGAGTAGAAGGAAGTGGG + Intergenic
950569082 3:13788903-13788925 CCTAGGGCAGGGAAGGAAGTGGG + Intergenic
951071058 3:18329881-18329903 CAGGGGGAATGGAACCAAGTTGG - Intronic
951183014 3:19681274-19681296 CTGGGAGAATGGAACCAAGTTGG - Intergenic
951450121 3:22827863-22827885 CGGGGAGAATGGAAGCAAGTTGG + Intergenic
951949378 3:28182490-28182512 CTGGGAGAATGGAACCAAGTTGG - Intergenic
952552955 3:34499698-34499720 TTAGGGACATGGAAGGAAGTTGG + Intergenic
952587074 3:34905654-34905676 CTGGGAGAATGGAACCAAGTTGG + Intergenic
953047388 3:39306073-39306095 CAGGGAGAATGGAACGAAGTTGG + Intergenic
953303860 3:41807808-41807830 CTGGCTGCATTGAAGGAAATGGG - Intronic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
954349096 3:50027498-50027520 CTGGGGGTAGAGAAGGAAGTAGG - Intronic
954519747 3:51214261-51214283 CTTGGGGCTGGGAAGGAAGATGG + Intronic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
955047403 3:55373031-55373053 AAGGGGGCATTGAAGGAAGCTGG - Intergenic
955060754 3:55489642-55489664 CTGGGGGAAAGAAAGCAAGTTGG - Intronic
955088146 3:55722703-55722725 AGGTGGGCATGGAAAGAAGTAGG - Intronic
955966046 3:64390308-64390330 CTAGGGGCATGGCAGGGAATAGG - Intronic
956302226 3:67784624-67784646 CTGGGGGCAGGGGAAGAATTAGG + Intergenic
956386681 3:68726643-68726665 GTGGGGGCATGGGTTGAAGTAGG - Intergenic
956589338 3:70897410-70897432 CTGGGAGAATGGAACCAAGTTGG - Intergenic
956725694 3:72154905-72154927 GTGGGGGCATGGAGAGAAGCAGG - Intergenic
956857245 3:73287257-73287279 CTGGGAGCATGAAATGAAGTGGG + Intergenic
957727652 3:84088165-84088187 CTGGGAGAATGGAACCAAGTTGG + Intergenic
958767603 3:98388205-98388227 CTGAGGGCATTGTAGGATGTGGG + Intergenic
958826438 3:99036321-99036343 CAGGGAGCATGGAAACAAGTTGG + Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959354529 3:105308891-105308913 CTGGGAGAATGGAACCAAGTTGG - Intergenic
959506077 3:107157540-107157562 CTGGGAGAATGGAACCAAGTTGG + Intergenic
960278328 3:115752419-115752441 CTGGGAGAATGGAATCAAGTTGG + Intergenic
960339438 3:116456722-116456744 CTGGGAGAATGGAACCAAGTTGG + Intronic
960797799 3:121506402-121506424 CTGGGGGAATGTGAGGAGGTTGG - Intronic
961003405 3:123389012-123389034 CAGGAGTCATGGAAGGAAGGAGG + Intronic
961563169 3:127745533-127745555 CTGGAGGCGTGGAAGGATGGGGG + Intronic
961821747 3:129578812-129578834 CTGGGGGCATCTCAGGGAGTGGG - Intronic
962287577 3:134100662-134100684 CGGGGAGAATGGAAGCAAGTTGG - Intronic
962387541 3:134944120-134944142 CTGGGGCCATAGAGGGAAATGGG - Intronic
962902799 3:139775752-139775774 GTGGGGACATGGCAGGAAGGTGG + Intergenic
963050587 3:141139932-141139954 CTGGGAGAATGGAACCAAGTTGG - Intronic
963692884 3:148526649-148526671 CTGGGGGCTGTGAGGGAAGTGGG + Intergenic
963769824 3:149378566-149378588 ATGGGGGGAGGGAAGGAAGGAGG + Intergenic
964277926 3:155027476-155027498 CTGAGGGCAGGGAAGGTGGTTGG - Intronic
964421671 3:156510438-156510460 CTCGGGGCTGGGAAGGAAGAGGG - Intronic
964473976 3:157082351-157082373 CTGGAGACATGGAAGAAACTGGG + Intergenic
965883410 3:173414108-173414130 GTGGGGGCCTGGAAGGGAGAGGG + Intronic
966158199 3:176940901-176940923 CTGGGGGAAGGAAAGGGAGTAGG + Intergenic
966399490 3:179534216-179534238 CTGGGGGCAAGGGTAGAAGTGGG + Intergenic
966679577 3:182627246-182627268 GTGGGGGAATGGGAGGAAGCAGG + Intergenic
966714960 3:183005664-183005686 CATGGGGCATGGAAAGTAGTTGG + Intergenic
967105525 3:186252110-186252132 CTGGGGGCAGGGGAGGGAGTGGG + Intronic
967220275 3:187242720-187242742 CTGGGGGTTTGGGAGGAACTGGG - Intronic
968548018 4:1208380-1208402 CGGGGGCCTTGGCAGGAAGTTGG - Intronic
968573383 4:1353957-1353979 CAGGGGGCTTGGGAGGAAGCTGG - Intronic
968646536 4:1743962-1743984 CTGGGGGCACTGCAGGAAGAAGG + Intronic
968878220 4:3285474-3285496 ACGGGGGCCTGGAAGGAAGGGGG + Intergenic
969123231 4:4924916-4924938 CTGGGAGAATGGAACCAAGTTGG - Intergenic
969172543 4:5375877-5375899 AGGAGGGCAGGGAAGGAAGTAGG + Intronic
969932549 4:10645069-10645091 CTGGAGTCATTAAAGGAAGTGGG + Intronic
970546237 4:17133275-17133297 CTGAGGACATGGCAAGAAGTCGG - Intergenic
970775574 4:19670092-19670114 CTGGGAGAATGGAATCAAGTTGG + Intergenic
972203881 4:36747865-36747887 CTGGGGCCATGAATGGCAGTGGG + Intergenic
972755726 4:42043612-42043634 CTGGGAGAATGGAACCAAGTTGG + Intronic
974491473 4:62570537-62570559 CAGGGAGCATGGAAGCAAGTTGG - Intergenic
974960058 4:68687334-68687356 CTGGGGGCATGGGGGTAAGCAGG + Intergenic
975484026 4:74914791-74914813 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
975518213 4:75270143-75270165 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
975704195 4:77095640-77095662 ATGGGGGAGTGGAATGAAGTGGG + Intergenic
976532370 4:86169607-86169629 CTGGGAGAATGGAACCAAGTTGG + Intronic
977038097 4:91979618-91979640 CTGGGAGAATGGAACCAAGTTGG + Intergenic
977108539 4:92920946-92920968 CTGGGAGAATGGAACCAAGTTGG - Intronic
977164498 4:93678320-93678342 CTGGGAGAATGGAACCAAGTTGG + Intronic
977539082 4:98293676-98293698 GCGGGGGCGTGGAGGGAAGTAGG - Intronic
977591480 4:98832203-98832225 CTGGGGGCGTGGACAGAAGGAGG + Intergenic
977897277 4:102379350-102379372 CTGGGAGAATGGAACCAAGTTGG - Intronic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
979669102 4:123343574-123343596 CTGTGTGCTTGGAAGGAGGTGGG - Intergenic
980370594 4:131864469-131864491 CTTGGGGCATGGAGGGAAAGGGG + Intergenic
980669814 4:135990267-135990289 GTGGGGGGTTAGAAGGAAGTGGG - Intergenic
981337097 4:143580555-143580577 CTGGGGGCATGTGAGGCAGCAGG - Intronic
981439833 4:144770083-144770105 CTGGGAGAATGGAACCAAGTTGG + Intergenic
981749039 4:148075919-148075941 ATGGGCACATGGTAGGAAGTGGG + Intergenic
981869547 4:149469516-149469538 CGGGGAGAATGGAAGCAAGTTGG + Intergenic
982297423 4:153844070-153844092 TGGGTGGCATGGAAGGAAGAGGG + Intergenic
983140474 4:164143215-164143237 CTGGGAGAATGGAACCAAGTTGG + Intronic
983182847 4:164668908-164668930 CTGGGAGAATGGAAACAAGTTGG + Intergenic
984251697 4:177343518-177343540 CTGGGGGCAGGGGAGGGAGCTGG + Intronic
984533885 4:180948427-180948449 GTGGGGGATTGGAAGGAAGCAGG - Intergenic
984762715 4:183376713-183376735 CTGGGGGCGGGTAAGGAAGAGGG - Intergenic
985295221 4:188430664-188430686 CTGGGAGCATGGCTGGGAGTGGG - Intergenic
985487543 5:159895-159917 CTGGAGGCCGGGAAGGAAGCGGG - Intronic
985839275 5:2293866-2293888 CTGGGGGCATCCACAGAAGTGGG + Intergenic
986191927 5:5505032-5505054 CCGGGGTCATGGATGGATGTAGG + Intergenic
986458330 5:7942726-7942748 CTGGGAGAGTGGCAGGAAGTGGG - Intergenic
986471563 5:8081542-8081564 CTTGGGGCAAGGAAGGCAGAGGG + Intergenic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
986585240 5:9309559-9309581 CTGGAGGCATGGATTGAAGACGG + Intronic
987056504 5:14198561-14198583 TTTGGGGCATTGAAAGAAGTTGG + Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987305821 5:16637213-16637235 CTGGGAGAATGGAACCAAGTTGG - Intergenic
987719600 5:21616870-21616892 GTGGGGGCAGGGAAGTGAGTAGG + Intergenic
988806045 5:34741694-34741716 ATGGGGGCATGGAAGAGTGTGGG + Intronic
989845219 5:46132417-46132439 CTGGGAGAATGGAACCAAGTTGG + Intergenic
990388137 5:55288704-55288726 CTGGTGGTATGGAAGGAGTTAGG + Intronic
990437458 5:55807916-55807938 CAGGGAGAATGGAAGAAAGTTGG - Intronic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
992530728 5:77649292-77649314 ATGAAGGCATGGAGGGAAGTAGG - Intergenic
992650229 5:78852655-78852677 CGGGGAGAATGGAAGCAAGTTGG - Intronic
997264254 5:132485951-132485973 CTGAGGGTGAGGAAGGAAGTAGG - Intronic
997266130 5:132496380-132496402 CTGGGGGTAGGGGTGGAAGTGGG - Intergenic
998128521 5:139639525-139639547 CTGGGAGTATGGAAGGTAGCAGG - Intergenic
998708352 5:144791477-144791499 CCGGGGGAAGGGAAGGAAGAGGG - Intergenic
998779986 5:145646130-145646152 CTGGGAGTATGGAACCAAGTTGG - Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999207405 5:149859467-149859489 CTTGGGGAAGGGAAGGAAATAGG + Exonic
999311985 5:150557540-150557562 CTGAGGGCCTGGGAGGAAGATGG - Exonic
999672981 5:153973917-153973939 ATGAGGACATGGAAGGAAGAGGG - Intergenic
999944481 5:156580497-156580519 CTGGGAGAATGGAACCAAGTTGG - Intronic
1000195033 5:158948847-158948869 CGGGAGGCAGGGAATGAAGTAGG - Intronic
1000218655 5:159189898-159189920 CTGGGGGCAGGGAGGGTGGTGGG + Intronic
1001106071 5:168855713-168855735 CTGGGGGCAGGGAGGGAATGGGG + Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001773645 5:174313030-174313052 GAGGAGGCATGGAAGGAAGAAGG + Intergenic
1002193861 5:177491969-177491991 GTGGGGGCCTGGGTGGAAGTGGG + Intronic
1002672958 5:180884999-180885021 CGGGGGGAATGGAACCAAGTTGG - Intergenic
1002673700 5:180891243-180891265 CAGGGGGAATGGAACCAAGTTGG + Intergenic
1002681886 5:180971014-180971036 CTGGGGGCAGGGGAGGCAATAGG + Intergenic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003165174 6:3671222-3671244 CTGGCTGCATGGGAGGGAGTGGG + Intergenic
1004493652 6:16142644-16142666 CTGTGGCCAGGGAAGGAGGTAGG - Intronic
1004510269 6:16278974-16278996 CTGTGGGCATGGGAGGGAGCTGG + Intronic
1005723200 6:28622766-28622788 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1005841681 6:29748172-29748194 CTGAGGGCAGGGGAGGAGGTGGG + Intergenic
1006337049 6:33426274-33426296 CTGGGGGGAGGGCAGGAACTAGG - Intronic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1007340155 6:41186169-41186191 CAGGAGGCCTGGAAGGAAGGGGG + Intergenic
1007342761 6:41201996-41202018 CTGGAGGCAGGGGAGGAAGGGGG - Intergenic
1007766205 6:44161775-44161797 CTGGGGGCCTGGAAGGACCAGGG - Intronic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008497259 6:52145714-52145736 TTGGGGGGGTGGAAGGAACTTGG + Intergenic
1008796574 6:55310709-55310731 CGGGGAGAATGGAAGCAAGTTGG - Intergenic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009655758 6:66542449-66542471 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1009727707 6:67556953-67556975 CTGGGAGAATGGAAGCAAGTTGG - Intergenic
1010105490 6:72162986-72163008 CGGGGAGCATGGAACCAAGTTGG - Intronic
1010594741 6:77749662-77749684 CTGGGAGAATGGAACCAAGTTGG + Intronic
1010615502 6:78007080-78007102 CGGGGAGAATGGAAGGAAGTTGG + Intergenic
1010676096 6:78745436-78745458 CTGGGGGCAGGGATGGCAGGTGG + Intergenic
1011181303 6:84624457-84624479 CTGGTGGGATGGAAGGCAGGAGG - Intergenic
1012082178 6:94773866-94773888 TTGTGGGCATGGTAGGAGGTGGG - Intergenic
1013183942 6:107741111-107741133 CTGGTGGCATAGAAGCAAGCTGG + Intronic
1013578174 6:111506313-111506335 CGGGGAGAATGGAAGCAAGTTGG - Intergenic
1014008414 6:116448162-116448184 CGGGGTGCATGGGATGAAGTGGG + Intergenic
1014128329 6:117803291-117803313 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1014132939 6:117855342-117855364 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1014145841 6:117997317-117997339 CTGGGAGAATGGAACCAAGTTGG + Intronic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015886782 6:137926032-137926054 CTGGGGGTTAGGGAGGAAGTGGG - Intergenic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1016559909 6:145384410-145384432 GTGGGGGCATGGAAGGAAGAAGG + Intergenic
1016840449 6:148519713-148519735 CTGGGGGGCTGGCCGGAAGTTGG + Exonic
1020568068 7:9822597-9822619 CTGGGGCCATGAATGGCAGTGGG - Intergenic
1021780966 7:24105547-24105569 GTGGGGGCATTTAAGGAGGTGGG - Intergenic
1023488336 7:40710954-40710976 CTGGGGTAAAGGAAGGAATTGGG + Intronic
1023584654 7:41716621-41716643 ATGGGGGCAAGGATGGGAGTAGG - Intergenic
1024220647 7:47283989-47284011 CTGGGTGCATGTAAGGCAGATGG + Intronic
1024356404 7:48417597-48417619 CTGGGGGCAAGGGAGGCAGAGGG - Intronic
1024628207 7:51226488-51226510 CTGGGCCCAGGGAAGGAATTCGG + Intronic
1024754685 7:52516024-52516046 CTGTGTGCATGGGAGGAATTTGG - Intergenic
1024963776 7:55004494-55004516 CTGGTGGCTTGGAGGGACGTTGG + Intergenic
1025943094 7:66087706-66087728 CTGGGGGGGTGGGAGGAAGCAGG - Intronic
1026498250 7:70921741-70921763 CTGGGTGCATGGGAAGAAGCCGG + Intergenic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1027054970 7:75043499-75043521 CTGGGGGCATGGAGCCTAGTGGG - Intronic
1027871691 7:83715990-83716012 CGGGGAGAATGGAAGCAAGTTGG - Intergenic
1028446294 7:90927811-90927833 CGGGGGGAATGGAACCAAGTTGG - Intronic
1028659560 7:93253721-93253743 CAGGTGGCATGGAGGGCAGTGGG + Intronic
1028805884 7:95025670-95025692 CAGGGGGAATGGAACCAAGTCGG - Intronic
1029489224 7:100861369-100861391 CTGCGGGCATGGAGGGGAGGAGG - Intronic
1029712884 7:102309126-102309148 CTGGGGACCTGGAAGGAAGTTGG + Intronic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1029882409 7:103829336-103829358 CTGGGGGAAGGGAAAGAAGAAGG - Intronic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032686636 7:134240596-134240618 CTGGGAGAATGGAACCAAGTTGG + Intronic
1033142518 7:138840271-138840293 CTGGGAGCCTGGAAGGAACATGG + Exonic
1034265778 7:149780006-149780028 CAGGGGCCATGGCAGGCAGTGGG + Intergenic
1034571786 7:151961921-151961943 CTGGGGGCTGGGCAGGAACTGGG - Intronic
1034819394 7:154202771-154202793 CTCAAGGCATGGAAGGAAGGAGG - Intronic
1035008658 7:155691066-155691088 CTGGGAGAATGGAACCAAGTTGG - Intronic
1035027275 7:155834220-155834242 CTGGGGGGATGGGAGGACGGGGG + Intergenic
1035073075 7:156158967-156158989 CTGGGGGCCTGGAAAGATGAGGG - Intergenic
1035231338 7:157467786-157467808 CTGGGGGCACGGGAGCAAGCGGG + Intergenic
1035592822 8:830432-830454 CATGGGGCTTGGAAGTAAGTGGG - Intergenic
1035953484 8:4050682-4050704 GTTGGGGCTTGGATGGAAGTGGG - Intronic
1037921322 8:22808189-22808211 GTGGGTGGATGGATGGAAGTTGG - Intronic
1039314572 8:36356945-36356967 CTGGGGGAATGGAAAGCAGCAGG + Intergenic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1039854885 8:41403467-41403489 TGGGGGGCATGGAAGCATGTGGG + Intergenic
1040833555 8:51706406-51706428 CTGGTGTCAAGGGAGGAAGTAGG + Intronic
1042089644 8:65144841-65144863 AAGGGGGCAAGGAAGGAAGAAGG - Intergenic
1042887708 8:73570355-73570377 CGGGGGGAATGGAACCAAGTTGG + Intronic
1043618977 8:82164408-82164430 CTGGGGCCATGTTAGGAACTAGG + Intergenic
1043819094 8:84840510-84840532 CTGGGAGAATGGAACCAAGTTGG + Intronic
1043881168 8:85544708-85544730 GTGGGGGAAGGGATGGAAGTGGG + Intergenic
1044378085 8:91499953-91499975 CTGGGGACAAGGATGGCAGTGGG - Intergenic
1044816179 8:96115795-96115817 TAGGGGGCAAGAAAGGAAGTTGG - Intergenic
1044837754 8:96312833-96312855 CTGGGGCAGAGGAAGGAAGTGGG - Intronic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1046081438 8:109375099-109375121 CTGGGAGAATGGAACCAAGTTGG - Intronic
1046406706 8:113781954-113781976 CTGTAGTCATGGAAGCAAGTAGG + Intergenic
1046524963 8:115371866-115371888 CGGGGAGAATGGAAGAAAGTTGG + Intergenic
1046972379 8:120237207-120237229 CAGGGAGAATGGAACGAAGTTGG - Intronic
1048334052 8:133490094-133490116 CTTTGGGCAGAGAAGGAAGTTGG + Intronic
1049036279 8:140078785-140078807 CTGGGGGCAGGGAGGGGAGGTGG - Intronic
1049146068 8:141001639-141001661 TTGGGGGCAGGGAAGGAGATGGG - Intronic
1049212351 8:141392503-141392525 CTGGAGGCACGGAAGGCTGTGGG - Intronic
1049368791 8:142253664-142253686 CTGAGGCCTTGCAAGGAAGTTGG - Intronic
1050544919 9:6701593-6701615 CTGGAGGAATGGAAGAAAGCAGG + Intergenic
1050983389 9:12049829-12049851 CTGGGGGAATGGGAAGATGTTGG - Intergenic
1052506457 9:29359937-29359959 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1052598502 9:30594067-30594089 CGGGGAGAATGGAAGCAAGTTGG + Intergenic
1052612139 9:30789650-30789672 CGGGGAGAATGGAAGCAAGTTGG - Intergenic
1052971697 9:34380794-34380816 CTGGGGGCCTGCACGGAAGCTGG + Intronic
1053068961 9:35089606-35089628 CTTGGGGCAGGGCAGGAAGTAGG - Intronic
1053073535 9:35114991-35115013 CCTGGGGCAAGGAAGGAAGTGGG + Intronic
1053076587 9:35139166-35139188 CTGGGGCCATGAATGGCAGTGGG + Intergenic
1053381777 9:37654978-37655000 CCGGGGGCAGGGAAGGAGGGAGG - Intronic
1053420148 9:37972267-37972289 CTCTGGGCATGGGAGGAACTGGG - Intronic
1055098825 9:72441924-72441946 CTTGGGGCATGCAGGGCAGTGGG + Intergenic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1056075258 9:83031854-83031876 ATGGGGGCAGGGATGGAAGGTGG - Intronic
1056770853 9:89477021-89477043 CTGGAGGCATGGAGGAGAGTGGG + Intronic
1057075374 9:92135666-92135688 CTGGGGGCATGGAGGGCTCTTGG + Intergenic
1057191371 9:93089754-93089776 CTGGGGGCAGGGAAGGAGGGAGG - Intergenic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1057746511 9:97756494-97756516 CTAGGGGTTTGGGAGGAAGTGGG - Intergenic
1057871391 9:98720842-98720864 CTGGGGGCAAGGAAGACAGGTGG + Intergenic
1058595086 9:106606513-106606535 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1058927779 9:109684477-109684499 CAGGGGGCAGGCAAGGAAATAGG + Intronic
1059566285 9:115385782-115385804 CTGGGGCCATGAATGGCAGTAGG + Intronic
1059730291 9:117050457-117050479 CTGGGAGCAGGGGAGGAAGCAGG - Intronic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1060619401 9:125050165-125050187 TTGGGGAAATGGAATGAAGTGGG - Intronic
1060880301 9:127113374-127113396 CTGGGGGGAGGGGAGGAATTGGG - Intronic
1060999823 9:127896825-127896847 CTGGGGGGATGGGAGGACGTAGG - Intronic
1061273079 9:129554860-129554882 CTGGGCTCAAGGAAGGAAGCAGG - Intergenic
1061547169 9:131311113-131311135 CTGGTGGCAAGGAAGGAACTGGG + Intergenic
1062107519 9:134764014-134764036 CTGGGGGCATTGTGGGGAGTCGG + Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062354222 9:136154233-136154255 CTGGGGGGATGGAAGAGAATGGG - Intergenic
1062354275 9:136154391-136154413 CTGGGGGGATGGAAGAGACTGGG - Intergenic
1187018019 X:15349989-15350011 CTCGGGGCAGGGAAGGAGGCAGG - Intronic
1187374376 X:18738724-18738746 CTGGGAGAATGGAACCAAGTTGG - Intronic
1187533058 X:20113960-20113982 CTGGGGGGTGGGAAGGAGGTAGG - Intronic
1187661017 X:21546472-21546494 CTGGGAGAATGGAACCAAGTTGG + Intronic
1188921762 X:35986203-35986225 CGGGGAGAATGGAACGAAGTTGG - Intronic
1189300539 X:39949088-39949110 CTGGGCGCATGGGAGGATGCAGG + Intergenic
1189858085 X:45243744-45243766 GTGGGGGGCTGGGAGGAAGTGGG - Intergenic
1189934838 X:46056954-46056976 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1189937928 X:46088668-46088690 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1190013383 X:46804976-46804998 CTGGGGGCAGGGAGTGAGGTGGG - Intergenic
1190580392 X:51888023-51888045 ATGGGGGCTGGGAAGGAGGTGGG + Intronic
1191140124 X:57107622-57107644 CTGGGTCCATGGAAGGGGGTAGG - Intergenic
1191147948 X:57188983-57189005 CTGGGAGAATGGAATCAAGTTGG - Intergenic
1191754133 X:64575923-64575945 CGGGGAGAATGGAAGCAAGTTGG + Intergenic
1191969042 X:66793634-66793656 CGGGGAGAATGGAATGAAGTTGG - Intergenic
1191984571 X:66965697-66965719 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1192156943 X:68753692-68753714 CTGGGGGCCTGCAAGGAGGAGGG + Intergenic
1192197520 X:69038426-69038448 CTGGGGCCATGGCAGTAGGTGGG - Intergenic
1192491380 X:71579399-71579421 ATGGGGGCGTTGAGGGAAGTGGG + Intronic
1192718474 X:73667958-73667980 CTGGGAGAATGGAACCAAGTTGG - Intronic
1193030966 X:76897731-76897753 CGGGGAGAATGGAACGAAGTTGG + Intergenic
1193456699 X:81740134-81740156 CTGGGGGAAAGGAAGGAAGGAGG - Intergenic
1193620977 X:83752027-83752049 CTGGGAGAATGGAACAAAGTTGG + Intergenic
1194202971 X:90977723-90977745 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1194203697 X:90985049-90985071 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
1194648578 X:96487947-96487969 CGGGGGGAATGGAACCAAGTTGG + Intergenic
1194657037 X:96585480-96585502 CGGGGGGAATGGAACCAAGTAGG + Intergenic
1194901261 X:99514459-99514481 CTGGGGGAAGGGGAGGCAGTGGG + Intergenic
1195367870 X:104143646-104143668 CGGGGAGAATGGAACGAAGTTGG + Intronic
1195387894 X:104330347-104330369 CAGGGGTCATGGAAGTAACTGGG + Intergenic
1195457289 X:105083346-105083368 CTGGGAGAATGGAACCAAGTTGG + Intronic
1195676569 X:107511506-107511528 TTGGGGGCATGGAAGGCTGGTGG + Intergenic
1195933905 X:110107082-110107104 CCAGGGGCAGGGAAGGAAGAAGG + Intronic
1195967876 X:110445484-110445506 CTGTGGGGGAGGAAGGAAGTGGG + Intronic
1196987160 X:121286825-121286847 CTGGTGACATGGAAGCAAGCTGG - Intergenic
1197008778 X:121535806-121535828 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1197319264 X:125007427-125007449 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1197354861 X:125425911-125425933 GTGGGGGAATTGAAGGAAGATGG + Intergenic
1197438429 X:126460664-126460686 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1198179678 X:134194104-134194126 CTGGGGGCCTGTCAGGAGGTGGG + Intergenic
1198276148 X:135097741-135097763 CCTGGGGAATGGAAGGTAGTGGG - Intergenic
1198592548 X:138199817-138199839 CAGGGGGAATGGAACCAAGTTGG + Intergenic
1198660229 X:138960607-138960629 CGGGGAGAATGGAACGAAGTTGG - Intronic
1199011981 X:142769059-142769081 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1199194759 X:145015516-145015538 ATGGTGGCATAGAAGCAAGTTGG + Intergenic
1199769970 X:150969094-150969116 CTGGGGACCTGGAGGGAGGTGGG - Intergenic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200548807 Y:4553149-4553171 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1200549531 Y:4560496-4560518 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
1200564928 Y:4753398-4753420 CGGGGAGAATGGAACGAAGTTGG + Intergenic
1201514135 Y:14799018-14799040 CTGGGGGCATGGAGGGGAAGGGG + Intronic
1202196676 Y:22305379-22305401 CTCAGGGCATGGAAGGGAGCCGG + Intergenic
1202374688 Y:24223415-24223437 CGGGGAGAATGGAAGCAAGTTGG + Intergenic
1202496092 Y:25446705-25446727 CGGGGAGAATGGAAGCAAGTTGG - Intergenic