ID: 1086210331

View in Genome Browser
Species Human (GRCh38)
Location 11:84310579-84310601
Sequence GTGGCAGATGTGAAGCCGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086210331 Original CRISPR GTGGCAGATGTGAAGCCGTT TGG (reversed) Intronic
904540142 1:31227339-31227361 GTGGCACATGTGAAGCTATGTGG + Intronic
909980240 1:82091198-82091220 CTGGCAGATGTGAAGCAAGTTGG - Intergenic
915528655 1:156490908-156490930 GTAGCAGCTGTGAGGCCATTTGG + Intronic
916618182 1:166466955-166466977 GTGGATGATGTGAAACCATTGGG + Intergenic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
917241765 1:172956380-172956402 TTGGCACATGTGAAGGAGTTTGG + Intergenic
920987022 1:210900499-210900521 GTGGGAGGTGTGAAGCACTTGGG + Intronic
923282802 1:232461049-232461071 GTCGCAGATGTGGAACCTTTTGG - Exonic
924289366 1:242523046-242523068 GGGGCAGATGGGAAGCAGGTCGG + Intronic
1063524288 10:6770135-6770157 GTGGCAGAAGTGAAACTGTGTGG + Intergenic
1065568978 10:27048451-27048473 GTCCCAGAAGTGAAGCTGTTAGG + Intronic
1074106630 10:110393882-110393904 GTGCCTGATGTGAAGCTGCTGGG - Intergenic
1074724769 10:116296726-116296748 GTGGCAGAAGTGAAACTGTCAGG - Intergenic
1074798510 10:116974616-116974638 GTGGCTGATTAGAAGTCGTTTGG - Intronic
1080674365 11:34411162-34411184 GAGGCATATGGGAAGCGGTTTGG - Intergenic
1080855850 11:36111038-36111060 GTGGGAGACGTGAAACTGTTAGG + Intronic
1084494360 11:69495528-69495550 GTGGAATATGTGAAGCCACTTGG + Intergenic
1085685984 11:78622436-78622458 GTGGCAGGAGTGAAGACCTTGGG - Intergenic
1086210331 11:84310579-84310601 GTGGCAGATGTGAAGCCGTTTGG - Intronic
1088191676 11:107234603-107234625 GTGGCAGATATGATGCTGTTTGG - Intergenic
1090245487 11:125213201-125213223 GTGGCAGATGTGAAGAAACTTGG - Intronic
1092041854 12:5392255-5392277 TTGGCAGATGTGTATCTGTTTGG + Intergenic
1094164555 12:27428936-27428958 CTGGTAGATGGGAAGCCTTTTGG - Intergenic
1095419880 12:42014032-42014054 GTGGCAGATCTGTACCCGTCAGG + Intergenic
1095508487 12:42924079-42924101 GTGGCAGATTTGAAAGCATTTGG - Intergenic
1095921090 12:47532310-47532332 GTGGCAGCTGTGAACCAGGTGGG + Intergenic
1099309411 12:80999284-80999306 GTGGGAGCTGTTAAGCCATTGGG + Intronic
1106107176 13:26742895-26742917 GAGTCAGATGTAAAGCCGTCAGG - Intergenic
1108314425 13:49223458-49223480 GTGGCATAAGTGAAGCCCTTTGG - Intergenic
1109049384 13:57458795-57458817 GTGGCTGATTTGAAGCCATCAGG - Intergenic
1112346280 13:98592695-98592717 TTGGGAGATGGGAAGCTGTTGGG + Intergenic
1112733304 13:102391363-102391385 GTGGCAGATGTGACTCTGTATGG - Intronic
1114271569 14:21103494-21103516 GAGGCAAATGTGAAGCTGTATGG - Exonic
1116122599 14:40739379-40739401 GTGGGAGATGGGAAGCGATTGGG - Intergenic
1116791874 14:49348050-49348072 ATGGTAGATGTGAAGGCGGTGGG - Intergenic
1118587198 14:67365740-67365762 GTGACTGATATGAAGCCTTTCGG - Intronic
1119078778 14:71672438-71672460 GTGGCGGATGTGGAGCCCTACGG + Exonic
1120873602 14:89359717-89359739 GTGGCAGGTGGTAAGCCCTTTGG - Intronic
1122203457 14:100136455-100136477 GTGGCAGATGGGAGGTAGTTAGG + Intronic
1122424241 14:101596415-101596437 GTGGCAGATGGGAAGCAGACAGG + Intergenic
1202853957 14_GL000225v1_random:38135-38157 GTGGCAGCTGTGAAGCTGGAGGG - Intergenic
1125712128 15:41795523-41795545 GAGGGAGATGGGAAGCCATTTGG + Intronic
1127363703 15:58267466-58267488 GTGGCAGTTGGGAAGCCCATGGG - Intronic
1130065696 15:80603331-80603353 GTGGCAGATGGGAAGCTGAGTGG + Intergenic
1131503392 15:92992902-92992924 GTGGCAGATCTGAAGCGCCTGGG + Exonic
1135435668 16:22425296-22425318 TGAGCAGATGTGAAGCCGGTGGG + Intronic
1141933825 16:87222921-87222943 GTGGCAGATCTGAAGTCATTTGG - Intronic
1142044874 16:87919100-87919122 TAAGCAGATGTGAAGCCGGTGGG + Intronic
1142779705 17:2171966-2171988 GTGGGAAATGTGAAGCCGACTGG + Intronic
1144723993 17:17492238-17492260 ACTGCAGATGTGAAGCGGTTTGG - Exonic
1152607472 17:81299986-81300008 GTCACAGAAGTGAAGCCTTTTGG + Intergenic
1156820257 18:41363764-41363786 CAAGCAGATGTGAAGCCCTTTGG - Intergenic
1159953305 18:74501413-74501435 GCTGCAGATGTTAAGCAGTTGGG + Exonic
1160599563 18:80002279-80002301 GTGGCACATCTTAATCCGTTAGG + Intronic
1162418792 19:10553999-10554021 CTGGCGGAAGTGCAGCCGTTTGG + Exonic
1166058887 19:40312211-40312233 GTGGCAGAAGTGAAGCCCTGTGG + Intergenic
1166540992 19:43605778-43605800 GTGACAGATCTGAAGCCGGGGGG - Intronic
925255006 2:2475855-2475877 GTGCCAGCTCTGAAGCCTTTGGG - Intergenic
927335409 2:21917078-21917100 GTGACAGATGTGGTGCTGTTTGG - Intergenic
927953087 2:27187292-27187314 GTGGCAGATGTGACTCTGGTTGG - Intergenic
930040728 2:47120974-47120996 TTGGAAGATGTGAAGCAGTTTGG + Intronic
933340930 2:81025434-81025456 GGGGCAGATGTGAGGCCATGAGG - Intergenic
938141341 2:128797183-128797205 GTGGCAGGTGTGAAGTCTGTAGG + Intergenic
945421946 2:209648862-209648884 GTGGCAGATGCTCAGCTGTTTGG + Intronic
947188291 2:227473212-227473234 ATGGCAGATGTGAATCCCCTGGG + Intronic
1177343749 21:19840696-19840718 GTGAGAGATGTGAAGATGTTTGG - Intergenic
1179921505 21:44510095-44510117 GTGGCAGAGGTGCCGCAGTTGGG - Intronic
1180752377 22:18133343-18133365 GTGGGAGAGGAGAAGCAGTTGGG - Intronic
1183303462 22:37069831-37069853 GTGGCAGATGGGCAGCCTTCGGG + Intronic
1184377891 22:44125989-44126011 CTGGTAAATGGGAAGCCGTTGGG + Intronic
1184462603 22:44647801-44647823 CTGGCACATGTGAAGCAGTATGG + Intergenic
1184974865 22:48053919-48053941 CTAGCATATGTGAAGCCTTTGGG - Intergenic
1185193703 22:49454892-49454914 GTCACAGATGGGAAGCCTTTTGG + Intronic
953769961 3:45772225-45772247 GTGGCAGGGGTGCAGCAGTTGGG + Intronic
960839610 3:121943306-121943328 GTGGCAGATGTTTAGCTATTTGG + Exonic
960950586 3:122996261-122996283 GTGGCAGAAGGGAGGCCGTCTGG + Intronic
963384972 3:144581195-144581217 GTGCCAGAGGAGGAGCCGTTGGG + Intergenic
964631218 3:158812737-158812759 GTGTGAGATGGGAAGCCATTGGG - Intronic
968982575 4:3858376-3858398 GGTGCAGATGTGAAGCTGTGGGG - Intergenic
976388293 4:84483909-84483931 GTGGCAGACGTGGTGCCGTCTGG + Intergenic
981319768 4:143378266-143378288 GTAGCAGATGTATAGCAGTTTGG + Intronic
988233265 5:28506845-28506867 GTGGCAGAAGTGAAGGCCATGGG + Intergenic
1007182706 6:39941904-39941926 GTGGCAGAAGTGATGGTGTTAGG + Intergenic
1011366988 6:86593520-86593542 TTGGCAGATGTGAAGTTGTGTGG + Intergenic
1012699177 6:102431751-102431773 TTGGCAGATGTGGAGCCCTGAGG + Intergenic
1015978423 6:138814769-138814791 GAGGCTGAAGTGAAGCCGTGGGG + Intronic
1016451394 6:144186802-144186824 GTGGCCGACGTGAAGCGGCTGGG + Exonic
1016739770 6:147514602-147514624 GTGGCAGATGTGAAGGGTATGGG + Intronic
1019020626 6:168914740-168914762 GTGGCTGATGTGAAGCCCCTTGG + Intergenic
1024255754 7:47538939-47538961 GTGTCAGATGTGAAGCAATCTGG - Intronic
1031976813 7:128099208-128099230 GAGGCAGCTGTGAAGAGGTTGGG - Intergenic
1033131768 7:138751151-138751173 GTGGGAGGAGTGAAGCCATTAGG - Intronic
1033682063 7:143604465-143604487 GTGATAGACGTGAAGCCGATGGG + Intergenic
1035243907 7:157550219-157550241 GTGGCAACTGTGAAGCCAGTGGG + Intronic
1038944126 8:32338058-32338080 GTGGCAGATTTGATGCCTTAAGG - Intronic
1047965437 8:130042766-130042788 GTGGCAGATGCGATGCTGTGGGG + Intergenic
1048259968 8:132937026-132937048 GTGACACATGTGAAACTGTTAGG + Intronic
1051814488 9:21089020-21089042 GTGGCAGAGGTGAAGAGGTGAGG - Intergenic
1055479008 9:76691711-76691733 GTGACAGATTTGAAACTGTTTGG - Intronic
1187505512 X:19875422-19875444 GTGACTGATGTGAGGCCGTGTGG - Intronic
1189442106 X:41046433-41046455 GTGGCAGATGAGAGGCTGATGGG - Intergenic
1196021348 X:110994456-110994478 TTGGCACATGTGAAGTGGTTAGG + Intronic
1198594175 X:138218130-138218152 GTGGCAACTATGAAGCCGGTGGG + Intergenic