ID: 1086213716

View in Genome Browser
Species Human (GRCh38)
Location 11:84351774-84351796
Sequence AACCTAAATCTGCTGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086213716_1086213717 9 Left 1086213716 11:84351774-84351796 CCTTGCTTCAGCAGATTTAGGTT 0: 1
1: 0
2: 1
3: 8
4: 150
Right 1086213717 11:84351806-84351828 ATTAGAACAGACTGTAACAATGG 0: 1
1: 0
2: 2
3: 62
4: 340
1086213716_1086213719 25 Left 1086213716 11:84351774-84351796 CCTTGCTTCAGCAGATTTAGGTT 0: 1
1: 0
2: 1
3: 8
4: 150
Right 1086213719 11:84351822-84351844 ACAATGGAGGAGAAGTAGAATGG 0: 1
1: 0
2: 3
3: 45
4: 505
1086213716_1086213718 12 Left 1086213716 11:84351774-84351796 CCTTGCTTCAGCAGATTTAGGTT 0: 1
1: 0
2: 1
3: 8
4: 150
Right 1086213718 11:84351809-84351831 AGAACAGACTGTAACAATGGAGG 0: 1
1: 0
2: 2
3: 13
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086213716 Original CRISPR AACCTAAATCTGCTGAAGCA AGG (reversed) Intronic
900099387 1:954904-954926 CACTAAAATCTGCTGAAGCATGG + Intronic
902217183 1:14941591-14941613 AAGCTAATTCTGGGGAAGCAGGG - Intronic
902845794 1:19109935-19109957 AACCCATATCTGCTGAACTAAGG + Intronic
903560710 1:24224938-24224960 AACCTGAGGCTGCTGAACCAAGG + Intergenic
906576045 1:46891274-46891296 AACCCAAAGCTACTGAAGGAAGG + Intergenic
906595875 1:47076312-47076334 AACCCAAAGCTACTGAAGGAAGG - Intronic
908334680 1:63109511-63109533 GACCTAAAACTGCGGAAGCCTGG + Intergenic
909335537 1:74468221-74468243 AAGCTAAAGGTGCTGAAGTAAGG + Intronic
911222895 1:95269020-95269042 AACTTAAATCTTCTTAAGCTAGG + Intergenic
912167991 1:107062432-107062454 CGACTAAATCTGTTGAAGCAAGG + Intergenic
915150675 1:153828589-153828611 AACTTAAATCTACATAAGCAAGG + Intronic
923120563 1:230986221-230986243 AACTTAAATGTGCTTAATCAGGG - Intronic
1064150019 10:12855062-12855084 AACCTAAACCATCTGAAGAAGGG - Intergenic
1066236025 10:33485540-33485562 ACCTGAAATCTGCAGAAGCAGGG + Intergenic
1068677169 10:59780063-59780085 AAGCTCATTCTGCAGAAGCAGGG - Intergenic
1070124343 10:73608439-73608461 AACTTAAATCAGCTCAAGGAAGG + Intronic
1072060007 10:91800251-91800273 AACCTAAATTAGCTGAAGAACGG - Intronic
1072452604 10:95550870-95550892 AACCTAAATCAGCTACTGCATGG - Intronic
1073518036 10:104096374-104096396 AACCAAAATCTGTTGAGGGAGGG - Intergenic
1075455361 10:122581510-122581532 ATCCCACATCTGCTGATGCATGG - Intronic
1075457484 10:122594213-122594235 ATCCCACATCTGCTGATGCATGG - Intronic
1075458555 10:122600709-122600731 ATCCCACATCTGCTGATGCATGG - Intronic
1075459187 10:122604767-122604789 ATCCCACATCTGCTGATGCATGG - Intronic
1075459819 10:122608826-122608848 ATCCCACATCTGCTGATGCATGG - Intronic
1075460451 10:122612885-122612907 ATCCCACATCTGCTGATGCATGG - Intronic
1075461083 10:122616944-122616966 ATCCCACATCTGCTGATGCATGG - Intronic
1076326642 10:129628829-129628851 AACCAGAATCTTCAGAAGCAAGG - Intronic
1078936902 11:15959850-15959872 AAACTAGATCTGTAGAAGCAAGG - Intergenic
1081392254 11:42542669-42542691 AAAATCAGTCTGCTGAAGCATGG + Intergenic
1083094326 11:60233876-60233898 AACCTAACAGAGCTGAAGCACGG + Intronic
1083099458 11:60288001-60288023 AACCTAACAGAGCTGAAGCATGG - Intronic
1085851723 11:80128333-80128355 ACCCCAAATATGCAGAAGCAAGG + Intergenic
1086213716 11:84351774-84351796 AACCTAAATCTGCTGAAGCAAGG - Intronic
1087999814 11:104864300-104864322 AACCAAAATGTGCTTAATCAAGG + Intergenic
1090512501 11:127390755-127390777 CACCATAATCTGCAGAAGCAAGG + Intergenic
1091067379 11:132528638-132528660 GTCCTAAAAGTGCTGAAGCAAGG + Intronic
1091502728 12:1034905-1034927 AACCCATATGTGCTGAAGAATGG + Intronic
1092030980 12:5284857-5284879 AACCTGAATAGGCTGATGCAGGG + Intergenic
1092799183 12:12146718-12146740 CTCCTAAATTTTCTGAAGCATGG - Intronic
1093318542 12:17682673-17682695 GCCCTAAATATGCTAAAGCAAGG - Intergenic
1095592080 12:43914897-43914919 AATATAAATTTGCTGAAGGAGGG - Intronic
1098735895 12:74104110-74104132 AACATAAATCTTATGAAGTATGG + Intergenic
1099516416 12:83601467-83601489 AACCAATATCTGGTGAAGAATGG - Intergenic
1103218622 12:119224330-119224352 AACCTAAAACTGCTCAAAAATGG + Intergenic
1104529486 12:129555404-129555426 AATCCAACTCTGCTCAAGCAGGG - Intronic
1105466558 13:20647643-20647665 TACCTAATGCTGCTGAAGAATGG - Intronic
1106169923 13:27280141-27280163 AAACAAAATATGCTGAAACAGGG - Intergenic
1107045925 13:35992022-35992044 AACCAAAATCTACTGAGCCAGGG - Intronic
1109145830 13:58778761-58778783 AACATAAATCTGCTGCAGCAGGG - Intergenic
1110480950 13:75975483-75975505 AACATAAAGGTGATGAAGCAGGG + Intergenic
1112385913 13:98939542-98939564 TACTTGAATCTGCTGAAGGAAGG + Intronic
1112393392 13:99005662-99005684 ATTCTAAATCTACTAAAGCAGGG + Intronic
1114631433 14:24161757-24161779 AACCTACCTCTGCTGATGCTCGG + Intronic
1115503181 14:34067314-34067336 ACTCTAAATATGCAGAAGCATGG - Intronic
1115900389 14:38140749-38140771 GACCCAAACCTGCTGAAGAAGGG - Intergenic
1118516248 14:66531234-66531256 AACCTAAATTTGGCCAAGCATGG - Intronic
1118637604 14:67762267-67762289 GACCTCAATCAGCTGAATCATGG - Exonic
1125827589 15:42689434-42689456 CATCTCTATCTGCTGAAGCAGGG + Exonic
1126555122 15:49978501-49978523 AACCTAGCTATGATGAAGCAAGG - Intronic
1127047657 15:55043740-55043762 AGCCCCAAGCTGCTGAAGCATGG - Intergenic
1127603234 15:60560163-60560185 AACATAAATCTCCTTAAGAAGGG - Intronic
1128443309 15:67734049-67734071 AGCAAGAATCTGCTGAAGCAAGG - Intronic
1128887569 15:71302752-71302774 AATCTCTATCAGCTGAAGCAGGG - Intronic
1129204386 15:74027183-74027205 AACCTAAATATGCAGCAACAAGG - Intronic
1130309067 15:82736904-82736926 AACCTAAAAATGCTGAAGGCTGG + Intergenic
1131306008 15:91243776-91243798 AATCCAATGCTGCTGAAGCAAGG + Intronic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1133524465 16:6590894-6590916 AACCTAAATGTGCAAATGCATGG - Intronic
1135272763 16:21083647-21083669 AAGCTGGATCTTCTGAAGCAAGG - Intronic
1135482016 16:22828508-22828530 TTCCCAAAGCTGCTGAAGCATGG + Intronic
1137381215 16:48001514-48001536 GCCATAAATCTGCTGCAGCAGGG - Intergenic
1141523067 16:84594296-84594318 AACCTAAAGCTCCTGACACAGGG + Intronic
1143612926 17:8030381-8030403 TACGTACTTCTGCTGAAGCAGGG - Intergenic
1143701034 17:8660329-8660351 AACATAATTTTGCTTAAGCAAGG - Intergenic
1144103951 17:11969508-11969530 ATGCTAAATCTGGAGAAGCAAGG - Exonic
1144823425 17:18091283-18091305 ATCAAAAATCTGCTGAAGTATGG + Intronic
1147287974 17:39418250-39418272 AACCTAAAACTGGCCAAGCACGG + Intronic
1152363730 17:79843858-79843880 AACCAAGAGCTGCTGCAGCAAGG + Intergenic
1153504059 18:5777860-5777882 AACCAAAATATGCAGAAGGAAGG - Intergenic
1158261172 18:55607473-55607495 AGACTAAATTTGCTGAAGAAAGG - Intronic
1158446209 18:57523869-57523891 AACATCATTCTGCAGAAGCAAGG - Intergenic
1162834198 19:13305503-13305525 AACATGAATCTGCTAAAACAGGG + Intronic
1166531395 19:43545665-43545687 AACCTGAAGGTGCTGAGGCAGGG + Intronic
935763185 2:106340638-106340660 AACCTAATTCTGCCTGAGCAAGG + Intergenic
938197316 2:129339970-129339992 AACATAGATCTTCTGCAGCAGGG - Intergenic
944291842 2:198016981-198017003 CACCAAAATCTGCAGAAGCACGG - Intronic
947420447 2:229937625-229937647 AAGCCAACACTGCTGAAGCAGGG - Intronic
1171087068 20:22247289-22247311 AACCTTTATCTGCTGAATAAAGG - Intergenic
1172149119 20:32778385-32778407 AAGCTAGATGTCCTGAAGCAGGG - Intronic
1172856211 20:38004858-38004880 AACCTGGAAATGCTGAAGCAGGG - Intronic
1174511113 20:51053432-51053454 ACCCAAAATATTCTGAAGCAGGG - Intergenic
1175221239 20:57417674-57417696 AAGCTAACTCTGCTGGAGTAGGG - Intergenic
1175597158 20:60244390-60244412 AACCTAAACCAGATGCAGCAAGG - Intergenic
1181938091 22:26453249-26453271 AAGCAGAAGCTGCTGAAGCACGG - Exonic
1182242993 22:28932087-28932109 AACCTTACTCTGCTCTAGCATGG + Intronic
1182781898 22:32874960-32874982 ACCCTAAGTCTGCAGGAGCATGG - Intronic
1182863081 22:33578066-33578088 GGTCTAAATCTTCTGAAGCAGGG - Intronic
950910860 3:16589989-16590011 AACCTCAAACTCCTGACGCAAGG - Intronic
953672470 3:44975131-44975153 AACCCAAATTAGTTGAAGCAAGG - Intronic
954269017 3:49492780-49492802 GGCCTTAATCTGCTGATGCATGG + Intronic
954938947 3:54353415-54353437 TACCCATATCTGCTGAACCAGGG - Intronic
956400780 3:68877539-68877561 GACCTAAATCTGCTGTAGAGAGG - Intronic
962181052 3:133206874-133206896 CACTTAAGTCTGCTGAAGCTGGG + Intronic
964295129 3:155225273-155225295 AAGCTAAGTTTGCTGATGCATGG + Intergenic
965621894 3:170650732-170650754 AGATTAAATCTGCTGAAGCAGGG + Intronic
967689302 3:192455713-192455735 CATCTAAATATGCAGAAGCATGG - Intronic
971827779 4:31648630-31648652 TACTTCAATCTACTGAAGCATGG - Intergenic
972963905 4:44486490-44486512 CACCTACAACTGCTGAAGGAGGG - Intergenic
974994283 4:69133720-69133742 AACCAAAAAGTGCTAAAGCATGG - Intronic
975082521 4:70298286-70298308 AGCCTAAATCCACTGAAGAAGGG + Intergenic
976346772 4:84012794-84012816 AATCTACATCTGCGGAATCAGGG + Intergenic
976402493 4:84623232-84623254 ACCCTCACTTTGCTGAAGCATGG + Intronic
979512276 4:121567856-121567878 CACTTAAGTCTGCTGAAGCTGGG - Intergenic
980417238 4:132507392-132507414 ACCCTAAAACTTCTCAAGCAGGG + Intergenic
981410444 4:144424210-144424232 AATGTATATCTGCTGAAACAAGG - Intergenic
982794932 4:159632894-159632916 AACTCAACTCTGCTGAAGCGAGG - Intergenic
984348981 4:178567877-178567899 AACACAAATGTGCTGAAACAAGG - Intergenic
986401927 5:7390821-7390843 AAAATAAATCAGCTGAAGCTTGG + Intergenic
986628219 5:9743030-9743052 AACCTGAATTTGCTGATTCATGG + Intergenic
992910132 5:81388566-81388588 AATCAATATCTGCTGAAGGAAGG - Intronic
993441535 5:87962618-87962640 CAATTAAATCTGCTGAAGGATGG + Intergenic
995772968 5:115691789-115691811 AACATAAATCTCCTTAAGAAGGG - Intergenic
1001277818 5:170363357-170363379 AACCTTAATCTCCTGCATCAAGG - Intronic
1002648738 5:180675636-180675658 AACCTAAAACTGCTCAAAAAAGG - Intergenic
1004983930 6:21059013-21059035 AGACTAAGTCTGCTGAACCATGG + Intronic
1005932778 6:30496243-30496265 AACCTAAGTCTCCTAAAACAGGG - Intergenic
1006564503 6:34943249-34943271 AACCTAAAACTGCTGTAGGCCGG - Intronic
1008332555 6:50261272-50261294 CAACTTAATCTGCTAAAGCATGG + Intergenic
1008922395 6:56856128-56856150 AACCCAAATCTCCTAAAGCCAGG + Intronic
1009684058 6:66933911-66933933 AATCGAAAACTGATGAAGCAGGG - Intergenic
1011633274 6:89347968-89347990 CAGCGAAATCTGCTGAGGCATGG - Intronic
1012769664 6:103415716-103415738 TTCCTAAATGTGCAGAAGCAGGG - Intergenic
1012770284 6:103424815-103424837 ACCCTGAGTCTGCTGGAGCAAGG - Intergenic
1013944296 6:115704005-115704027 AACCTGGATCTGCTGGAGCATGG + Intergenic
1017711083 6:157168663-157168685 TACATAAATCTTCTGAGGCAGGG - Intronic
1018751920 6:166813890-166813912 AACATAAATGTGCTGAAGAAAGG - Intronic
1021448543 7:20759247-20759269 CATTTAAATCTGCTGAAGTATGG - Intronic
1025764158 7:64426905-64426927 AACCTTCATTTTCTGAAGCAAGG + Intergenic
1030280972 7:107774796-107774818 ATCCGAAAACTGCAGAAGCAAGG - Exonic
1032002508 7:128274590-128274612 AACCAAGATCTGCTGGAGCTTGG - Intergenic
1041622592 8:59990181-59990203 CCCCTAAATCTGCTGGAACAAGG + Intergenic
1046083299 8:109399317-109399339 AACCAAATTCAGCTGAAGAAGGG + Intronic
1047703085 8:127469995-127470017 AACCTTATTCTGCAGAACCAGGG + Intergenic
1048481955 8:134805462-134805484 AACCTAAATCAGCTGGAGACAGG - Intergenic
1050101822 9:2127741-2127763 AACCTAAGTGTGCTGAGGCAGGG - Intronic
1051007218 9:12360254-12360276 AACTCAAATCTGCTGAAAAAGGG - Intergenic
1052322559 9:27183996-27184018 CACGTAAATCTGCTGATTCATGG - Intronic
1055218806 9:73902165-73902187 AACCTATATCAGTTGAAGAATGG + Intergenic
1055648065 9:78379426-78379448 AACTCAACTCTGCTGAAGCAGGG + Intergenic
1055814951 9:80194123-80194145 AACAAAAATCTGGTGAAGAATGG + Intergenic
1056955744 9:91079700-91079722 CCCCTAGATCTGCTGAATCAGGG + Intergenic
1057502478 9:95606609-95606631 AACCTAATTTTGCAGCAGCAAGG - Intergenic
1188056531 X:25547610-25547632 AGCCTAGATCAGCTGAATCATGG - Intergenic
1188256692 X:27969838-27969860 AATTTAAATTTGCTGATGCACGG - Intergenic
1192295615 X:69844621-69844643 AACCTAAAACTGTTGAGGGATGG - Intronic
1194330676 X:92580342-92580364 AAACTAAGTCTGCTGATCCATGG + Intronic
1195462322 X:105141521-105141543 AAACTAAATATTCTGAAACATGG - Intronic
1197043667 X:121970444-121970466 ACCTTAGGTCTGCTGAAGCATGG - Intergenic
1198967810 X:142245253-142245275 ACCCTGGATCTGCTGAATCAGGG - Intergenic
1200639380 Y:5699412-5699434 AAACTAAGTCTGCTGATCCATGG + Intronic