ID: 1086213896

View in Genome Browser
Species Human (GRCh38)
Location 11:84353944-84353966
Sequence ATGGAGGAGAGGAATGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1351
Summary {0: 1, 1: 0, 2: 5, 3: 134, 4: 1211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086213896_1086213901 29 Left 1086213896 11:84353944-84353966 CCACTCTCATTCCTCTCCTCCAT 0: 1
1: 0
2: 5
3: 134
4: 1211
Right 1086213901 11:84353996-84354018 TAAATGCTCAAATAACCTCTAGG 0: 1
1: 0
2: 0
3: 14
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086213896 Original CRISPR ATGGAGGAGAGGAATGAGAG TGG (reversed) Intronic
900031192 1:374102-374124 ATGGAGAGGAGAAAGGAGAGGGG - Intergenic
900051725 1:602230-602252 ATGGAGAGGAGAAAGGAGAGGGG - Intergenic
900051746 1:602302-602324 ATGGAGAGGAGAAAGGAGAGGGG - Intergenic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900297969 1:1961784-1961806 AGGGAAGAGAGGAAGGAGACGGG + Intronic
900391536 1:2436045-2436067 GAGGAGGGGAGGAAGGAGAGAGG - Intronic
900569537 1:3351555-3351577 AAGGAGGAAGGGGATGAGAGAGG - Intronic
900882332 1:5391062-5391084 ATGGAGGAGGGGTATGTGATGGG + Intergenic
900892309 1:5458374-5458396 AGGGAAGGGAGGAAGGAGAGAGG - Intergenic
900977649 1:6027125-6027147 ATGGAGGAGGCAAGTGAGAGGGG - Intronic
900993075 1:6106832-6106854 ATGGAGGAGTGGAAGGATGGAGG + Intronic
901082549 1:6591739-6591761 AGGGAGCAGAGGAAGGAGAAGGG + Exonic
901409494 1:9072242-9072264 ATGGAGGAGGGGGATGGCAGCGG + Intronic
901435380 1:9244449-9244471 ATGGAGAAGAGGCAAGTGAGAGG + Intronic
901437994 1:9261298-9261320 ATGGAGGTGAGCAAAGAGTGGGG - Intronic
901589660 1:10330109-10330131 AAGGAGAACAGGGATGAGAGAGG - Intronic
901593828 1:10369069-10369091 ATGGAGTAGAAAAATGAAAGAGG - Intronic
901829326 1:11882500-11882522 AAGGAGGAGGTGAATGAGAGGGG - Intergenic
902195234 1:14793272-14793294 AGGAAAGAGAGGATTGAGAGAGG + Intronic
902318280 1:15640619-15640641 ATGCAGGAGAGCAGTGAAAGGGG + Intronic
902911225 1:19598678-19598700 ATGGGCGAGAAGAGTGAGAGTGG - Intronic
902950216 1:19876634-19876656 ATGGATCAGAGTAAGGAGAGAGG - Intergenic
903051023 1:20601199-20601221 ATGGAAGAGACCAATGAGAGAGG - Intronic
904335417 1:29794115-29794137 AAGGAGGACAGGAGGGAGAGAGG - Intergenic
904463877 1:30696727-30696749 AAGGAGGAGAGGAGGGAGAGAGG + Intergenic
904464372 1:30699092-30699114 AAGGAGGAGAGGAGGGAGAGAGG + Intergenic
904576376 1:31507639-31507661 CTGGAGGAGAGGAAGGGCAGAGG + Intergenic
904599269 1:31664842-31664864 ATGGAGGAGTAGAATGTGATAGG - Intronic
904608703 1:31713566-31713588 ATGGGGAAGGGGAATGGGAGTGG + Intergenic
904818156 1:33220910-33220932 AGGGAGGAAAGGAATGAAACTGG + Intergenic
904819132 1:33229163-33229185 GTGGAGAAAAGGAAAGAGAGGGG - Intergenic
904905204 1:33892468-33892490 TTGGAGGAGAAGATTGAGAGGGG - Intronic
905261129 1:36719894-36719916 CCGGAGGAGAGGGATAAGAGGGG + Intergenic
905288640 1:36905950-36905972 GGGGAGGAGGGGAAAGAGAGGGG + Intronic
905406149 1:37733725-37733747 TTGGGGGAGAGGAATGAGAAGGG - Intronic
906800373 1:48731955-48731977 ATGGAGGGGAGAAATGAGTGTGG + Intronic
906865055 1:49409111-49409133 TTGATGGAGAGGAAGGAGAGGGG - Intronic
907279772 1:53339913-53339935 GTGGAGGAGAGGACAGAGTGGGG - Intergenic
907696073 1:56730407-56730429 AAGGAGGAGAGGGAGGGGAGGGG + Intronic
908291714 1:62673896-62673918 AGGGAGGGAAGGAAGGAGAGAGG + Intronic
908470365 1:64438239-64438261 AGGGAGGGGAGGAAAGAGAAAGG - Intergenic
908605594 1:65793504-65793526 GGGGAGGAGAGGATGGAGAGAGG + Intronic
908766485 1:67559149-67559171 ACAGAGGAGAGGAATGAGTAAGG + Intergenic
909062986 1:70900701-70900723 AGGCAGAAGAGGAATGAGAGAGG + Intronic
909821292 1:80065056-80065078 GTGAAGGAGAGGAATAAGAGAGG + Intergenic
910244175 1:85121064-85121086 ATGGATGAGAAAACTGAGAGAGG - Intronic
910310057 1:85813265-85813287 TAGGGGGAGGGGAATGAGAGTGG + Intronic
910559222 1:88572282-88572304 ATGGAGAAGAAGTGTGAGAGGGG - Intergenic
910641397 1:89466708-89466730 TGGGAGGAGAAGAAGGAGAGGGG + Intergenic
910721432 1:90290582-90290604 AGGGAGGAGGGGACAGAGAGAGG + Intergenic
911070417 1:93827741-93827763 AAGGAGGAGAGAAAGGAGAAGGG + Intronic
911090633 1:94014340-94014362 AGGGAGGAGAAGAAGGAAAGAGG + Intronic
911161823 1:94688965-94688987 ATGGTGGAGAGGGAGGAAAGGGG + Intergenic
912651332 1:111442101-111442123 ATGGAGGAGAGGGTTGTGAAAGG + Intronic
912696952 1:111849001-111849023 GAGAAGGAGAGGAATCAGAGAGG - Intronic
912866933 1:113266255-113266277 AAGGAGAACAGGAAGGAGAGTGG + Intergenic
913246919 1:116878435-116878457 ATGGAGTAAGGGATTGAGAGGGG - Intergenic
913294180 1:117302974-117302996 TTGAAGGAGAGGCATAAGAGGGG + Intergenic
913359543 1:117964564-117964586 AGGGAGGGGAGGAAGGTGAGAGG + Exonic
913942268 1:125119618-125119640 ATGGGAGAGAAGAAGGAGAGCGG + Intergenic
914711820 1:150221506-150221528 AGGGAGGAAAGGAAGGAGAGTGG + Intronic
914960080 1:152197365-152197387 AAGAAAGAGAGGAAAGAGAGAGG - Intergenic
915085635 1:153386780-153386802 CTGGAGAAGAGAAGTGAGAGAGG - Intergenic
915562124 1:156693451-156693473 TGGGAGGAGAGGAAAGGGAGGGG - Intergenic
915735067 1:158079239-158079261 ATGGATGGGAGAAAGGAGAGAGG + Intronic
915738818 1:158102356-158102378 ATGGAGGGAAGGAAAGAGGGAGG + Intergenic
915867059 1:159513891-159513913 AATAAGGAGAGGAATGAGTGAGG - Intergenic
915929821 1:160053392-160053414 ATGAAGGAGAGGGGTAAGAGAGG + Intronic
916055260 1:161064871-161064893 AGGAAGGAGAGAAAAGAGAGAGG + Intronic
916651118 1:166835646-166835668 AGGGAGGGGAGGAAGGAGGGAGG - Intergenic
917019195 1:170568093-170568115 AAATAGGAGAGGAATGAGAATGG - Intergenic
917027983 1:170663019-170663041 AGAGAGAAGAGAAATGAGAGAGG - Intronic
918440244 1:184559554-184559576 AGGGAGGGGAAGAAAGAGAGAGG - Intronic
918824215 1:189300876-189300898 AGGGAGGAGAGGAGGGAGGGTGG + Intergenic
918866944 1:189913735-189913757 AATGAGGAGAGGGAGGAGAGAGG - Intergenic
919349043 1:196425332-196425354 ATGGACTAGAGGAATCAGAAAGG - Intronic
919915269 1:202135118-202135140 ATGGGGGAAAGGGAGGAGAGGGG - Intronic
919939442 1:202276280-202276302 GTGGAAGAGAGGATGGAGAGGGG - Intronic
920081168 1:203373803-203373825 GTGGTGAAGAGGAAGGAGAGTGG - Intergenic
920120273 1:203650821-203650843 AGGGAGGAAGGGGATGAGAGTGG - Intronic
920225728 1:204437552-204437574 ATGGAGGAGAGGCATTCCAGTGG + Intronic
920270725 1:204761749-204761771 CTAGAGGAGAGGAAAAAGAGGGG + Intergenic
920702560 1:208228870-208228892 TTGGAGGAGAGAAAGGAGATTGG - Intronic
920702616 1:208229203-208229225 TTGGAGGAGAGAAAGGAGATTGG + Intronic
920812802 1:209302999-209303021 ACAGAGGAGAGGAAGGAGGGAGG + Intergenic
920844335 1:209581134-209581156 ATGGAGGAAAGAAAAAAGAGGGG + Intergenic
921353035 1:214256939-214256961 ATGGAGTGGAGGACTGAGAAGGG + Intergenic
921353801 1:214265254-214265276 ATGGAGGAGGAGGAAGAGAGTGG - Intergenic
921442385 1:215202983-215203005 AGGGAGGAGAAGAATGGGGGAGG - Intronic
921575574 1:216830993-216831015 GGGGAGGAGAGGAAGGAAAGGGG + Intronic
921651367 1:217682344-217682366 TTGGATGAGAGGAATGTTAGGGG - Intronic
921957757 1:221001649-221001671 AAGGAGGAGAGGACTGTGTGGGG + Intergenic
922093615 1:222422076-222422098 AGGGAAGAGAGTGATGAGAGAGG - Intergenic
922119360 1:222647781-222647803 ATGGAGCAGAGGAATTAGCAAGG + Intronic
922635745 1:227168885-227168907 AAGAAGGAGAGGAAAGAGAATGG - Intronic
922846323 1:228687908-228687930 ATGGAGCAGAGGAGGGAGAGGGG - Intergenic
923051650 1:230394612-230394634 GAGGAGGGTAGGAATGAGAGAGG - Intronic
923121068 1:230991991-230992013 ATGCAGGTGAAGGATGAGAGTGG - Intronic
923178081 1:231487874-231487896 ATGGAGGGGAGACAGGAGAGAGG - Intergenic
923482446 1:234397454-234397476 ATGGGGGAGGGGAAGGAGGGAGG + Intronic
923862714 1:237907658-237907680 AGGGTGGAGAGAAAGGAGAGGGG + Intergenic
923955579 1:239014881-239014903 TTGGAAGAGATGAAAGAGAGAGG - Intergenic
924067160 1:240235829-240235851 ATGGGGCAGAGGAAGAAGAGGGG - Intronic
924328677 1:242921185-242921207 ATGGAGGGGAGGAGGGAGATGGG + Intergenic
924440748 1:244083345-244083367 AGGGAGGGGAGGAATGGGAGCGG - Intergenic
924440756 1:244083365-244083387 AGGGAGGAAGGGAAGGAGAGAGG - Intergenic
924562390 1:245167846-245167868 AGAAAGGAGAGGAATAAGAGGGG + Intronic
1063112307 10:3047743-3047765 AGGGAGGAAAGGACAGAGAGAGG - Intergenic
1063180302 10:3592229-3592251 ATGGATGAGAAAACTGAGAGTGG - Intergenic
1063437130 10:6043356-6043378 CTGGAGGGGAAGAATGAGATTGG + Intronic
1063525232 10:6778770-6778792 ATGGAAGGAAGGAAGGAGAGAGG + Intergenic
1063525277 10:6778969-6778991 ATGGAAGAAAGGAAGGAGAGAGG + Intergenic
1063766570 10:9148351-9148373 ATGAAGGGGAGGAGGGAGAGGGG - Intergenic
1063993125 10:11588193-11588215 TTGGAGGAGAGTAAAGAGACTGG + Intronic
1064587246 10:16851697-16851719 ATGGAGGGAAGGAAAGATAGAGG - Intronic
1064594126 10:16926104-16926126 ATGGATGAGAGGAGGGAGAAGGG + Intronic
1064940525 10:20730104-20730126 ATGGAGGACAGGATTGTTAGAGG - Intergenic
1065070752 10:22021628-22021650 AGGGAGCACAGGAATGAGAGGGG + Intergenic
1065383954 10:25115433-25115455 ATGGAGGGAAGGAAGGAGGGAGG - Intergenic
1065453132 10:25879679-25879701 GTGGAGGAGAGGAAAGGCAGAGG - Intergenic
1065933439 10:30499783-30499805 AGGGAAGAGAGGAAGGAGAGAGG + Intergenic
1065973441 10:30822869-30822891 ATTAAGGAGAGGAAGGAAAGGGG - Intronic
1066076291 10:31881032-31881054 ATGGAGGAGGGGAAGGTGGGGGG - Intronic
1066290884 10:34013465-34013487 AAGGAGGAAAGGAGGGAGAGAGG - Intergenic
1066427997 10:35326345-35326367 CTTGGGGAGAGGAATGAGAAAGG + Intronic
1067174573 10:43934930-43934952 ATCAAGTATAGGAATGAGAGAGG + Intergenic
1067175337 10:43942008-43942030 ATGGAGGGATGGAGTGAGAGAGG + Intergenic
1067292887 10:44957440-44957462 GGGGAAGAGAGGAAAGAGAGAGG - Intergenic
1067939331 10:50640432-50640454 ATGGGGCAGTGGAATGTGAGGGG - Intergenic
1068004741 10:51380021-51380043 ATGGTGGAGAAGAATGAGCCAGG - Intronic
1068316878 10:55356242-55356264 ATGAAAGAAAAGAATGAGAGAGG + Intronic
1068894411 10:62183568-62183590 ATGAAGCAGATGAATTAGAGAGG - Intronic
1069057464 10:63859725-63859747 AGGAAGGAGAAGAATGAGTGAGG + Intergenic
1069700697 10:70422986-70423008 AGGAAGGAAAGGAAGGAGAGAGG - Exonic
1069872440 10:71541284-71541306 CAGGAGGAGAGGAATCAGAGCGG - Intronic
1069939031 10:71940812-71940834 TTGGGGAAGAGGAAGGAGAGAGG + Intergenic
1070309995 10:75266140-75266162 AGGGAGGACGGGAAGGAGAGGGG + Intergenic
1070574884 10:77670428-77670450 AGGGAGGGAAAGAATGAGAGAGG + Intergenic
1070684717 10:78472138-78472160 AGGGAGGAAAGAAAGGAGAGAGG - Intergenic
1070790195 10:79184560-79184582 AGGGAGGAGAGGAGGCAGAGAGG - Intronic
1070827386 10:79399158-79399180 ATGGAGGAGAAGAAGGACTGTGG + Intronic
1071343088 10:84666089-84666111 CAGGAGGAGAGGCGTGAGAGGGG + Intergenic
1071558640 10:86627675-86627697 TTGAAGGAAAAGAATGAGAGAGG - Intergenic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1072400669 10:95096175-95096197 AGAGAAGAGAGGAAAGAGAGGGG - Intergenic
1072448323 10:95518694-95518716 AGGGAGGGAAGGAATGACAGAGG + Intronic
1073046534 10:100642383-100642405 ATGGAGGAGGGGAAGCAGGGAGG + Intergenic
1073566051 10:104536593-104536615 AAGGAGGAGAGGAGAGAGGGAGG + Intergenic
1073761451 10:106632902-106632924 ATGGAGGAGATGAATGAGTGAGG + Intronic
1073812599 10:107166573-107166595 ATGGAGGAGAGGAGAGCCAGAGG + Intergenic
1074247927 10:111713626-111713648 CTTGAGCAGAGGATTGAGAGAGG - Intergenic
1074609140 10:115004461-115004483 ATGGAAGGGAGGAAGGAGGGAGG - Intergenic
1074827916 10:117228224-117228246 ATGGAGGAAGGGAAAGAGGGAGG - Intergenic
1075261734 10:120969297-120969319 ATGGAGGAGTTGAGTGGGAGCGG + Intergenic
1075627301 10:123972441-123972463 ATGGAGGGGTGGGATGGGAGGGG + Intergenic
1075954446 10:126510036-126510058 ATGGAGCAGAGGACAGAGGGAGG - Intronic
1076095777 10:127734224-127734246 ATGGATCAGAGGCCTGAGAGGGG + Intergenic
1076446589 10:130518435-130518457 ATGGATGAGAGCAATGATACAGG - Intergenic
1076446640 10:130518689-130518711 ATGGATGAGAGCAATGATACAGG + Intergenic
1076558751 10:131347201-131347223 AAGGAAGGGAGGAAGGAGAGAGG - Intergenic
1076595697 10:131623335-131623357 ATGGGAGAGAGGTAGGAGAGAGG + Intergenic
1076597337 10:131632167-131632189 AGGCAGGAGAGGCATGAGACGGG - Intergenic
1076811159 10:132887114-132887136 ACAGAGGAGAGGAGAGAGAGAGG - Intronic
1076811225 10:132887508-132887530 AGAGAGGAGAGGAGAGAGAGAGG - Intronic
1076811252 10:132887668-132887690 AGAGAGGAGAGGAGAGAGAGAGG - Intronic
1076811254 10:132887684-132887706 AGAGAGGAGAGGAGAGAGAGAGG - Intronic
1077135474 11:996048-996070 ATGGATTAGAGGAGTGACAGAGG - Intronic
1077208862 11:1358815-1358837 TTGGAGGGGAAGAATGGGAGGGG + Intergenic
1077288703 11:1779033-1779055 ATGGAGAAGGGGATGGAGAGGGG - Intergenic
1077458460 11:2695268-2695290 AGGGAGGAGAGCAAGGATAGAGG - Intronic
1077531305 11:3096925-3096947 GAGGAGGAGAGGAAAGAGGGAGG + Intronic
1077563570 11:3281736-3281758 AGGGAGGAGGAGAATCAGAGAGG - Intergenic
1077569460 11:3327551-3327573 AGGGAGGAGGAGAATCAGAGAGG - Intergenic
1078164901 11:8874137-8874159 GTGGAGGAGACGTATGAGAGAGG - Intronic
1078393231 11:10954768-10954790 GTGGAGCAGAAGAAAGAGAGAGG - Intergenic
1079161535 11:17999496-17999518 GTGGAGTGGAGGAAGGAGAGAGG - Intronic
1079373007 11:19868096-19868118 ATTGTGGAGGGGAATGAGTGGGG + Intronic
1079934805 11:26604087-26604109 GGGGAGGGGAGGATTGAGAGAGG - Intronic
1080823902 11:35831914-35831936 ATGAAGGTGGGGAAGGAGAGAGG - Intergenic
1081245880 11:40765299-40765321 CTGGAGAAGAAGAAAGAGAGAGG - Intronic
1081495628 11:43607219-43607241 ATGGAAGAGAGAAAAGAGAAAGG + Intronic
1081639272 11:44741888-44741910 AGAGAGGAGAGGAAGGAGAAGGG - Intronic
1081854004 11:46292591-46292613 ATGGAGCAGAGAAATGACATAGG + Intronic
1082936293 11:58660382-58660404 GTGGAAGAGAAGAATGCGAGAGG + Intronic
1083224639 11:61277016-61277038 AGGGAGGGAAGGAAGGAGAGAGG + Intronic
1083254427 11:61487427-61487449 GTGGAGAAGAGGGATGAGGGAGG + Intronic
1083471767 11:62888905-62888927 TTGGAGGAGACGCATGGGAGGGG - Intergenic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1083853807 11:65382332-65382354 TTGGTGGAGATGAATGGGAGTGG - Intronic
1083882264 11:65554417-65554439 AGGGAGGAGGGGAAAGAGACAGG - Intronic
1083909738 11:65699323-65699345 ATGGAGGAGAGGAGGCAAAGGGG + Intergenic
1083997474 11:66279324-66279346 CTGGAGGAGAGGAGCGGGAGGGG - Intronic
1084157626 11:67323001-67323023 AGGGAGGAGAGGAGGGAAAGAGG - Intronic
1084164264 11:67367638-67367660 ATGGACGAGAAGCATGAGCGCGG + Intronic
1084330528 11:68427289-68427311 ATGGAGGGGAGGAAGGACTGTGG - Intronic
1085282649 11:75341053-75341075 ATGGAAAAGAGGGATGAAAGAGG + Intronic
1085328981 11:75631464-75631486 CTGGAGGAGGGGAGTGGGAGAGG - Intronic
1085753770 11:79187057-79187079 ATGAAGGGGAGGAATGGGAAGGG - Intronic
1085756355 11:79205055-79205077 AGGAAGGAGAGGAATGAGATTGG + Intronic
1085810888 11:79680071-79680093 AAGGAGGAGAAGAAAGAGAAAGG - Intergenic
1086148422 11:83580921-83580943 AAGGAAGGGAGGAATGAGGGAGG - Intronic
1086213896 11:84353944-84353966 ATGGAGGAGAGGAATGAGAGTGG - Intronic
1086348603 11:85922731-85922753 ATGGAGAAGAGTGATGAGAAGGG - Intergenic
1086452050 11:86926769-86926791 ATGGAGGGGAAAAATGCGAGGGG - Intronic
1086471791 11:87121467-87121489 ATTGAGGAGTGGTATGAGATGGG + Intronic
1086827646 11:91519124-91519146 AGGAAGGGGAGGAAGGAGAGGGG + Intergenic
1087593663 11:100225504-100225526 AAGGAGGAAAGGAAAGAAAGAGG - Intronic
1087639254 11:100737891-100737913 CTGAGGAAGAGGAATGAGAGGGG - Intronic
1087847447 11:102989480-102989502 ATTGAGGAGAGAAATGGGACAGG - Intergenic
1088246109 11:107819865-107819887 ATGGAGAAGATGACTCAGAGTGG + Intronic
1088500260 11:110475924-110475946 AGGGAGGAGAGAAAAGAGAAAGG - Intergenic
1088567427 11:111187054-111187076 ATGTAGGAGAATAGTGAGAGTGG - Intergenic
1088594000 11:111426289-111426311 AAGGAGGACTGGATTGAGAGTGG + Intronic
1089061858 11:115632261-115632283 GAGAAGGAGAGGAATGGGAGAGG + Intergenic
1089180170 11:116578198-116578220 AGGGAGGAAAGGAAGGAGGGAGG - Intergenic
1089342495 11:117767961-117767983 AGGCAGAAGAGGAGTGAGAGGGG - Intronic
1089386630 11:118072593-118072615 AGGGAGGAGAGGAAGGAGGAAGG + Intergenic
1089453473 11:118612378-118612400 AGGGAGGAGGGGCAAGAGAGTGG - Intronic
1089506909 11:118969513-118969535 AGGGAGGAGAGGGAAGAGAAGGG + Intergenic
1090480938 11:127067499-127067521 ATGGAGGAGAATACTCAGAGTGG - Intergenic
1090510632 11:127371065-127371087 ATGGAGAAGAGAGATGAGAAAGG - Intergenic
1090548787 11:127795625-127795647 ATGGAGGAAATAAATGATAGAGG + Intergenic
1090643148 11:128746368-128746390 CTTGAGGAGAGGAAAGAGTGTGG - Intronic
1090661629 11:128886392-128886414 AAGGAGAAGAGGAATGAAACTGG - Intergenic
1091034644 11:132222239-132222261 GTGGAAGAGAGGAAAGAGAAAGG - Intronic
1091085019 11:132713065-132713087 ATGGAAGAGAGGAAACAAAGGGG - Intronic
1091174225 11:133545508-133545530 AGGATGGAGAGAAATGAGAGAGG + Intergenic
1091204218 11:133808511-133808533 GTGGACGAGAGGAAAGGGAGAGG - Intergenic
1091250672 11:134141447-134141469 AGGGAGGAGAGGGGGGAGAGGGG + Intronic
1091800708 12:3323015-3323037 AAGGAGGAGAGGAAGGAGAAGGG + Intergenic
1091877773 12:3950663-3950685 AGGAAGGAGAGGAATGAGTGGGG - Intergenic
1092236092 12:6810662-6810684 ATGGAGGGGAGGAACAAAAGAGG + Intronic
1092255567 12:6925194-6925216 AGGTAGGGGAGGAATGGGAGAGG + Intronic
1092775872 12:11944772-11944794 AGGGAGGTGAGGAAGCAGAGGGG + Intergenic
1092859310 12:12706308-12706330 GTGGAGGAGAGCCAAGAGAGAGG - Intergenic
1093310808 12:17581197-17581219 AGGGAGGGAAGGAAGGAGAGAGG + Intergenic
1094083790 12:26566285-26566307 AGGGAGGAGAGGAGAGGGAGAGG + Intronic
1094199591 12:27781915-27781937 CTTGAGGAGTGGGATGAGAGGGG + Intronic
1094627143 12:32135035-32135057 ATGGAGGGGAGGAGGGGGAGAGG - Intronic
1095276800 12:40295177-40295199 CTGGAGGAGAGGATGAAGAGTGG - Intronic
1095324425 12:40870998-40871020 CTGGAGGAGAGAGATGAGTGAGG + Intronic
1095812305 12:46383665-46383687 AGGGAGGAGGGGAAGCAGAGGGG + Intergenic
1096658105 12:53104201-53104223 ATGGAGGTGAGGGATGTCAGAGG + Exonic
1096864393 12:54553290-54553312 CTGGAGCAGAGAAAAGAGAGTGG - Intronic
1096975334 12:55696536-55696558 ATTAGGGAGATGAATGAGAGAGG + Intronic
1097123191 12:56752170-56752192 ATGGAGGCGAGGAATGGGTTCGG - Intronic
1097247065 12:57612505-57612527 GTGGAGGAGGGGACTGGGAGTGG + Intronic
1097752008 12:63365949-63365971 ATGGAGGAGAGGAATGGCTTTGG - Intergenic
1098520138 12:71426113-71426135 AAGGAAGAGAGGAAGGAGAAAGG + Intronic
1098608451 12:72423807-72423829 AAGCAGAAGAGGAATCAGAGAGG + Intronic
1098751796 12:74302167-74302189 ATGGAGTGGTGGAAAGAGAGTGG - Intergenic
1099263940 12:80419851-80419873 CTGCATGAGAGGAATGAGACTGG - Intronic
1099329298 12:81262172-81262194 CTAGAGAAGAGGAATGTGAGTGG - Intronic
1099857289 12:88183223-88183245 GGGGAGGAGAGGAATAACAGTGG + Intronic
1100098755 12:91076627-91076649 AAGGAAGAGGAGAATGAGAGAGG + Intergenic
1100307987 12:93368908-93368930 AAGGAAGAGAGGTAGGAGAGAGG - Intergenic
1100307996 12:93368954-93368976 AAGGAAGAGAGGTAGGAGAGAGG - Intergenic
1100309256 12:93378554-93378576 AGGGAGGAAAGGAGTGAGGGAGG - Intronic
1100379549 12:94048869-94048891 ATGGAGCAGAGGAAGGTGAGAGG - Intergenic
1100549197 12:95631035-95631057 AAGGAGGAGAGAAGAGAGAGAGG + Intergenic
1100728898 12:97441756-97441778 ATGGAGGAGAGGAGAGAGGGAGG + Intergenic
1101018902 12:100531618-100531640 ATTCAGGAGAGGATTGTGAGAGG - Intronic
1101071419 12:101080012-101080034 ATGAACGAGAGGGAGGAGAGTGG - Intronic
1101311125 12:103580314-103580336 ATGAAGCAGAGGAACCAGAGAGG + Intergenic
1101599700 12:106198331-106198353 ATGGAGGACATTAATGGGAGAGG - Intergenic
1101724766 12:107379661-107379683 AGGAAGAAAAGGAATGAGAGAGG - Intronic
1101831123 12:108257366-108257388 ATGGAGGAGGGAAATTTGAGAGG + Intergenic
1101831705 12:108263048-108263070 AAGGAGGAGAGGCAGGGGAGTGG - Intergenic
1101843231 12:108342373-108342395 GTGGGGGAGAGGAGGGAGAGTGG + Intergenic
1102145349 12:110651065-110651087 AGGGAGGAGAGGGAGGTGAGGGG + Intronic
1102231519 12:111265789-111265811 ATGGGGGAAAGGACTGGGAGAGG - Intronic
1102348973 12:112178499-112178521 ATGGAGCTGAGGACTGAGAAAGG + Intronic
1102513519 12:113431361-113431383 ATGCAGGAGAGGAGCCAGAGAGG + Intronic
1102574473 12:113847529-113847551 ATGGGGGAGAGGAATTGGTGGGG + Intronic
1102598725 12:114012816-114012838 ATGGGGGAGAGGAGTGATGGGGG + Intergenic
1102852820 12:116266274-116266296 AAGGAGGAGAGGAAAGAGAAGGG + Intronic
1102991894 12:117321937-117321959 AGGGAGGGAAGGAAGGAGAGAGG - Intronic
1102991900 12:117321957-117321979 AAGGAGGGAAGGAAGGAGAGAGG - Intronic
1102991911 12:117321997-117322019 AGGGAGGGAAGGAAGGAGAGAGG - Intronic
1102991917 12:117322017-117322039 AAGGAGGAAAGGAAGGAGAGAGG - Intronic
1102991963 12:117322195-117322217 AGGGAGGGAAGGAAGGAGAGAGG - Intronic
1102992049 12:117322504-117322526 AAGGAGGAGGGGAAGGAGGGAGG - Intronic
1102992085 12:117322622-117322644 AGGGAGGAAAGGAATGAGAGAGG - Intronic
1102992125 12:117322770-117322792 AAGGAAGAAAGGAAGGAGAGAGG - Intronic
1103113398 12:118303058-118303080 ATTCAGTAAAGGAATGAGAGTGG - Intronic
1103272973 12:119688717-119688739 ATCGAGGAGAGGGATGGGTGTGG - Intronic
1103310439 12:120002573-120002595 TTAGAGGAGGGTAATGAGAGAGG - Intronic
1103341094 12:120221562-120221584 AGGGAGGAGAAGGATGAGGGAGG + Intronic
1103619880 12:122180795-122180817 AAGGAAGAGAAGACTGAGAGGGG - Intronic
1103801877 12:123543406-123543428 AGGGAGTAGAGGAGGGAGAGTGG - Intergenic
1103913786 12:124365712-124365734 AGGGAGGGGAGGGAGGAGAGTGG - Intronic
1104276190 12:127330056-127330078 ATGGGGGTGAGGTATGGGAGGGG + Intergenic
1104315819 12:127699882-127699904 ATGGAAGGGAGGAAAGAGACTGG + Intergenic
1104668788 12:130666756-130666778 AGGGAGGGAAGGAAGGAGAGAGG + Intronic
1104668841 12:130666944-130666966 AGGGAGGAAAGGAGGGAGAGAGG + Intronic
1104668891 12:130667116-130667138 AGGGAGGGAAGGAAGGAGAGAGG + Intronic
1104668924 12:130667212-130667234 AGGGAGGGAAGGAAGGAGAGAGG + Intronic
1104676012 12:130713040-130713062 AGGGAGAGGAGGAATGAGGGAGG + Intronic
1104747687 12:131220314-131220336 AGGGAGCACAGGAGTGAGAGGGG - Intergenic
1105252449 13:18711961-18711983 AGGGAGGAGAGGACAGGGAGAGG - Intergenic
1105681627 13:22734058-22734080 AGGGAGGAGAGGATGTAGAGAGG + Intergenic
1105901632 13:24759717-24759739 AGGGAGTGAAGGAATGAGAGAGG + Intergenic
1106186315 13:27412882-27412904 TTGAAGGAGAGGAATGATTGTGG + Intergenic
1106299412 13:28450522-28450544 AGGGAGGAAAGGAGGGAGAGAGG + Intronic
1106313889 13:28577130-28577152 ATGTGGGAGGTGAATGAGAGGGG + Intergenic
1106356395 13:28987448-28987470 ATGAGGGAGAGGAAGGAGATGGG + Intronic
1106569940 13:30917697-30917719 ATGGAGCAGGGGGAAGAGAGCGG + Intronic
1106682162 13:32019151-32019173 ATAGAGGGGAGGGAAGAGAGAGG - Intergenic
1106791053 13:33155025-33155047 AGTGAGGAGAGGACTAAGAGTGG - Intronic
1107054715 13:36090585-36090607 AGGTAGGAGAGGAAAGAGACAGG + Intronic
1107349486 13:39499403-39499425 AGGGAGGAGAGGACTGAGGAAGG - Intronic
1107422562 13:40262191-40262213 AGGGAGGGAAGGAAGGAGAGAGG + Intergenic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1108306162 13:49136016-49136038 TTGTAGGTGAGGAATGAGACTGG - Intronic
1108534534 13:51360318-51360340 ATGGAGGAGAGGGGTGGGATGGG + Intronic
1108682148 13:52789874-52789896 ATGGATGGGAGGGATGAGAGAGG - Intergenic
1108732478 13:53248966-53248988 TTGGGGGAGAGAAAGGAGAGAGG + Intergenic
1108817576 13:54310908-54310930 AAAGAGGAAAGGAAGGAGAGAGG + Intergenic
1109273869 13:60283083-60283105 AGGGAGGGGAAGAGTGAGAGAGG - Intergenic
1109576875 13:64271198-64271220 AAGGAGGGGAGGAATAAGAAAGG - Intergenic
1109654144 13:65367511-65367533 TTGGAGGATAAGAATGACAGAGG + Intergenic
1110286175 13:73752696-73752718 AGGGAGCAGGGGAATGAGTGAGG - Intronic
1110554997 13:76849665-76849687 ATGGAGGAGAGGATGGCGAGTGG - Intergenic
1111104679 13:83629752-83629774 AAGGAGGAGAGGAAGAAAAGAGG - Intergenic
1111337499 13:86841402-86841424 ATGGAGGAGTGAACAGAGAGAGG - Intergenic
1111453517 13:88449849-88449871 CTGGAGGAGATGAATGAAGGAGG - Intergenic
1111589361 13:90323634-90323656 ATGCAGGAGAGGAGTGGGGGTGG + Intergenic
1111849448 13:93553712-93553734 AAAAAGGAGAGGAATGAGATGGG + Intronic
1111893004 13:94106532-94106554 AGGGAGGATGGGAAGGAGAGAGG + Intronic
1111912192 13:94325142-94325164 AGGGAGGAGAGGAGGGAGGGAGG + Intronic
1112148570 13:96730478-96730500 GGGGAGGGTAGGAATGAGAGAGG - Intronic
1112311060 13:98317919-98317941 AAGAAGGAAAGGAAGGAGAGAGG - Intronic
1112311070 13:98317975-98317997 ATGAGGAAGAGGAAGGAGAGAGG - Intronic
1112441223 13:99426387-99426409 AGGGAGTGGAGGAATGAGGGGGG - Intergenic
1112635255 13:101210169-101210191 ATGGGGGTGGGGAAGGAGAGAGG - Intronic
1112722881 13:102265141-102265163 ATGGAGGATGAGAATGAGAAAGG - Intronic
1112822647 13:103354620-103354642 ATCAAGGTGAGAAATGAGAGAGG - Intergenic
1113209625 13:107960472-107960494 AAGGAGGAGTGGAATGTGTGGGG + Intergenic
1113407661 13:110056670-110056692 AGGCAGGAGAGGAAAGAGACTGG + Intergenic
1113531905 13:111033291-111033313 AGAGAGGAGAGGGAGGAGAGAGG + Intergenic
1114079182 14:19187908-19187930 ATGAATGAAATGAATGAGAGGGG - Intergenic
1114651315 14:24286381-24286403 ATGGACTAGAGGGAGGAGAGAGG - Intergenic
1115813269 14:37133686-37133708 CTGGAGGAGGGGAAGGAGACAGG - Intronic
1116269409 14:42742054-42742076 ATAGAGGAGAGGGAAGAGTGGGG + Intergenic
1116357086 14:43942671-43942693 AGGGAGGAAGGGAAAGAGAGAGG - Intergenic
1116414780 14:44667021-44667043 CTGGAGAAGAGGCATGAGAATGG + Intergenic
1116427340 14:44807045-44807067 AAGGAGGGAAGGAAGGAGAGAGG + Intergenic
1117642014 14:57810131-57810153 ATGGAGGAGGGGCATGTGACAGG - Intronic
1118050757 14:62024568-62024590 CTGGTGGAGAAGAATGATAGTGG - Intronic
1118349085 14:64960778-64960800 GTTGGGGAGAGGAAGGAGAGTGG + Intronic
1118869317 14:69727923-69727945 ATGGAGGAAGGGCAGGAGAGAGG + Intronic
1119089316 14:71765832-71765854 AGGGAGGAAAGGAATGAGGGAGG - Intergenic
1119196853 14:72723424-72723446 AGGGAGGAGAGGAGGCAGAGGGG - Intronic
1119420851 14:74507146-74507168 AGGGAGGAGAGAGAGGAGAGAGG - Intronic
1119767552 14:77199909-77199931 ATGTAGGTGAGAGATGAGAGAGG + Intronic
1119948126 14:78716056-78716078 GGGGAGGAGGGGCATGAGAGGGG + Intronic
1119976411 14:79029147-79029169 AAGGAAGAAAGGAAAGAGAGAGG + Intronic
1120018545 14:79501842-79501864 ATGTCGGAGAGGAAGGACAGAGG + Intronic
1120071536 14:80108754-80108776 ATGAAGGAGAAGTATAAGAGTGG + Intergenic
1120204107 14:81569193-81569215 CTGGAAGAAAGGAATGAGTGAGG + Intergenic
1120216050 14:81681711-81681733 TTGGGGGAGAGGGAAGAGAGTGG - Intergenic
1120398553 14:83999789-83999811 ATGGAGGAAAGGAAGGACTGTGG + Intergenic
1120832375 14:89008806-89008828 AAGGAGGAGAGGTATGGGAAAGG - Intergenic
1121104187 14:91270139-91270161 ATGGTGGAGAGGAGGAAGAGAGG - Intergenic
1121607473 14:95251957-95251979 ATGGAGGAGAAGGATTAGCGAGG + Intronic
1121612812 14:95293160-95293182 AGGGAGGGAAGGAAGGAGAGAGG - Intronic
1121624661 14:95375141-95375163 AAGGAAGAGAGGAAGGAGGGAGG - Intergenic
1121624693 14:95375256-95375278 AAGGAAGAGGGGAAGGAGAGAGG - Intergenic
1121633374 14:95437513-95437535 AGTGAGGAGAGGAGGGAGAGAGG - Intronic
1121637728 14:95465185-95465207 AGGGAGGGGAGGAGGGAGAGAGG + Intronic
1121708280 14:96017589-96017611 GTGAAGGAGAGGAAGGACAGGGG - Intergenic
1121802760 14:96788597-96788619 CTGCAGCACAGGAATGAGAGGGG + Intergenic
1122002055 14:98666928-98666950 AGGGAGGGAAGGAAGGAGAGAGG - Intergenic
1122043432 14:99007011-99007033 AAGGAGGAGATGCATGGGAGTGG + Intergenic
1122133343 14:99618809-99618831 AGGTAGGAAAGGAATGCGAGGGG + Intergenic
1122252572 14:100450208-100450230 AAGGAGGAGAGCAACAAGAGTGG - Intronic
1122316438 14:100828331-100828353 GTGGAGGAGAGGAGTGGGAGGGG - Intergenic
1122764579 14:104057485-104057507 GTGGAGGAGAGAGAAGAGAGAGG - Intergenic
1122844790 14:104486976-104486998 CTGGAGCAGAGTAATGAGAATGG - Intronic
1123046829 14:105521518-105521540 AGGAAGGAAAGGAAAGAGAGAGG - Intergenic
1123154295 14:106209596-106209618 ATGGAGGAAAACAATGAAAGTGG + Intergenic
1123722562 15:23072347-23072369 ATGGATTAGAGAAATGAGAGGGG + Intergenic
1124262937 15:28208701-28208723 CAGGAGGAGAGGAGTGAAAGTGG - Intronic
1124621235 15:31275261-31275283 ATGAAGGAGAGGATTGAGTACGG + Intergenic
1124836642 15:33201846-33201868 AGAGAGGAGAAGAATGTGAGGGG + Intergenic
1124957802 15:34371016-34371038 GAGGAGGAGAGAAAGGAGAGAGG - Intergenic
1125499188 15:40227790-40227812 ATGGAGCAGAGGAATGGTACAGG - Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1125815366 15:42579563-42579585 AGGAAGGAAAGGAAGGAGAGAGG + Intronic
1126240767 15:46440568-46440590 ATGCAGGAGACGAATGTGTGGGG + Intergenic
1126391533 15:48160362-48160384 ATGGAGGAGAGGAGAGATAAAGG + Intronic
1126415865 15:48416866-48416888 ATGGAAGAGAGGAAGGGGAAGGG + Intronic
1126698416 15:51345171-51345193 CAGGAAGAGAGGAATGAGAGAGG - Intronic
1126778569 15:52119478-52119500 ATGGGAGAGAGGGAGGAGAGAGG + Exonic
1126944016 15:53797840-53797862 CTTGAGGAGAAGAAAGAGAGGGG + Intergenic
1127344289 15:58078792-58078814 AAGGAAGAAAGGAAGGAGAGGGG + Intronic
1127560586 15:60132541-60132563 AAGGAAGAGAGGAAGGAGAAGGG + Intergenic
1127560606 15:60132610-60132632 AAGGAAGAGAGGAAGGAGAAGGG + Intergenic
1127965107 15:63917477-63917499 ATGGGAGAGATGAATGAAAGAGG + Intronic
1128350793 15:66887044-66887066 ATGGAGGAGGGAGGTGAGAGAGG + Intergenic
1128380161 15:67106451-67106473 ATGAAGGGGAGGAATTAGAAAGG - Intronic
1128570896 15:68731924-68731946 TTGGAAGAAAGGAAGGAGAGAGG + Intergenic
1128698198 15:69784659-69784681 AAGGAAAGGAGGAATGAGAGAGG - Intergenic
1128934723 15:71735402-71735424 ATGGAGGAGAGGTAGGAGTCTGG - Intronic
1129036280 15:72650483-72650505 AGGGTGGAGAGGAAAAAGAGAGG - Intergenic
1129213609 15:74086741-74086763 AGGGTGGAGAGGAAAAAGAGAGG + Intergenic
1129247482 15:74288314-74288336 AAGAGGAAGAGGAATGAGAGTGG - Intronic
1129396794 15:75254344-75254366 AGGGTGGAGAGGAAAAAGAGAGG - Intergenic
1129400403 15:75278621-75278643 AGGGTGGAGAGGAAAAAGAGAGG - Intronic
1129659423 15:77544675-77544697 ATGAAGGTGGGGAATGAGAGGGG + Intergenic
1130042540 15:80417512-80417534 AGGGAGGAGAAGAAGCAGAGGGG - Intronic
1130170925 15:81512692-81512714 ATGGATGAGAGAAATCATAGGGG - Intergenic
1130226009 15:82058873-82058895 AGAGAGGAGAGGAAGGAGAAGGG - Intergenic
1130363279 15:83209516-83209538 GAAGAGGAGAGAAATGAGAGGGG + Intergenic
1130679956 15:85988021-85988043 AGGGAGGAGAGGATTGTGAGTGG + Intergenic
1130748565 15:86684093-86684115 ATGGAGGGAAGGAAAGAGGGAGG + Intronic
1130864939 15:87924898-87924920 AGGGAGGAATGGAATGAGGGGGG - Intronic
1131030771 15:89184525-89184547 AGGGAGGAGAGCAGTGAGTGGGG + Intronic
1131057735 15:89385643-89385665 GTGGAGGATAAGAATGACAGAGG + Intergenic
1131146180 15:90014336-90014358 TTGGAAGAGAGGAAGGAGAAGGG + Intronic
1131237762 15:90711689-90711711 AAGGAGGGAAGGAAGGAGAGAGG - Intergenic
1131651929 15:94409714-94409736 ATGGAGAAGAGGGAAGAGAGAGG - Intronic
1132063010 15:98708141-98708163 GAGGAGGAGAGGAGAGAGAGAGG - Intronic
1132398963 15:101493380-101493402 GAGGAGGAGAGGAGAGAGAGGGG - Intronic
1132719180 16:1307573-1307595 AGGGAGGAAGGGAATGAGTGAGG + Intergenic
1132719232 16:1307805-1307827 AGGGAGGAAGGGAATGAGTGAGG + Intergenic
1132719326 16:1308248-1308270 AGGGAGGGAATGAATGAGAGAGG + Intergenic
1132918020 16:2364689-2364711 AAGAAGGAGAGGAGGGAGAGAGG + Intergenic
1132989798 16:2786859-2786881 ATGGGGGAGGGGGATGAGGGAGG - Intronic
1133095670 16:3443517-3443539 ATGGCGGAGAGGGCTGAGGGCGG - Exonic
1133326869 16:4947245-4947267 ATGGAGGAAGGGAGGGAGAGAGG - Intronic
1133374686 16:5274591-5274613 AGGGAGGAGACGTATGAAAGGGG - Intergenic
1133506371 16:6416434-6416456 AGGGAGGGAAGGAATTAGAGGGG - Intronic
1133548506 16:6831173-6831195 TTGGAGGTGGGGAATGAGAGAGG + Intronic
1133578888 16:7123900-7123922 GTGGAGAAGAGAAAGGAGAGAGG + Intronic
1133656733 16:7872141-7872163 AGGGAGGGAAGGAATGAGGGAGG - Intergenic
1133710826 16:8399384-8399406 AAGGAAGAAAGGAATGAGAAAGG + Intergenic
1133722421 16:8507466-8507488 GTGGCAGAGAGGTATGAGAGAGG - Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133825372 16:9273546-9273568 ATAGAGGGGAGAGATGAGAGAGG - Intergenic
1133964173 16:10519275-10519297 ATGGAGGGGAGGGAAGCGAGGGG - Intergenic
1134428455 16:14177233-14177255 ATAGAGGAGAGGCATGGAAGAGG + Intronic
1134439409 16:14288892-14288914 ATGGTGGAGATGGATGAGAATGG - Intergenic
1134591091 16:15453963-15453985 GAGGAGGAGAGGAAGGAAAGGGG - Intronic
1134680939 16:16125004-16125026 ATGGGGGAGAGGAACTTGAGAGG + Intronic
1134691161 16:16191788-16191810 AAGGAGGAGAGGAAGGAGGGAGG - Intronic
1134692028 16:16197449-16197471 AAGGAGGAGAGGAAGAAGAAAGG + Intronic
1134754094 16:16650830-16650852 ATGGAAGAGAGGGAAGAGAAGGG - Intergenic
1134991967 16:18708219-18708241 ATGGAAGAGAGGGAAGAGAAGGG + Intergenic
1135114590 16:19714143-19714165 AAGAAGAAGAGGAAAGAGAGTGG - Exonic
1135617845 16:23927633-23927655 GTGGTGGTGAGGAAGGAGAGAGG + Intronic
1136068729 16:27775656-27775678 GTGGTGGAGAGGAAGGGGAGAGG + Intronic
1136696271 16:32084465-32084487 ATGGGAGAGAAGAAGGAGAGCGG - Intergenic
1136716394 16:32286878-32286900 ATGGAGGAGATGGAGGAGAAGGG - Intergenic
1136796766 16:33027717-33027739 ATGGGAGAGAAGAAGGAGAGCGG - Intergenic
1136834780 16:33493156-33493178 ATGGAGGAGATGGAGGAGAAGGG - Intergenic
1137459100 16:48642043-48642065 TTGGATGAGAGGAATGAGCAGGG - Intergenic
1138207007 16:55132649-55132671 GTGGAGGATGGGAAGGAGAGAGG + Intergenic
1138333937 16:56237448-56237470 AGAAAGGAGAGGAAGGAGAGAGG + Intronic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138730932 16:59194195-59194217 ATGGTAGAGAGGAATGAAAGAGG + Intergenic
1138961115 16:62030983-62031005 AAGGAGGGCAGGAAGGAGAGAGG + Intronic
1139142972 16:64290813-64290835 ATGGAGAAGTGGGAAGAGAGAGG + Intergenic
1139263938 16:65622284-65622306 AGGGAGGAGGGGAGTGAGAGAGG + Intergenic
1139303083 16:65961902-65961924 AGGGAGGAAAGGAGGGAGAGAGG + Intergenic
1139303118 16:65962012-65962034 AGGGAGGAAAGGAGGGAGAGAGG + Intergenic
1139308088 16:66005219-66005241 ATGGAAGAGAGGAGAGAAAGAGG - Intergenic
1139341605 16:66271203-66271225 GGGGAGAAAAGGAATGAGAGGGG + Intergenic
1139472674 16:67186690-67186712 GGGGAGGAGAGGAAGGAGGGAGG - Intronic
1140049062 16:71463403-71463425 ATGGAGGGTAGGAATGGGAAGGG - Intronic
1140230208 16:73111753-73111775 AGGGAGGAAGGGAAGGAGAGAGG + Intergenic
1140541508 16:75760364-75760386 AAGGAAGAGAGGAAGGAGGGAGG - Intronic
1140862300 16:79028559-79028581 AGGGAGGGAAGGAAGGAGAGAGG - Intronic
1141198945 16:81882640-81882662 AGGGAGGGGAGGAAAGAAAGAGG - Intronic
1141209680 16:81965657-81965679 GGGGAGGAGGGAAATGAGAGGGG + Intergenic
1141348498 16:83270990-83271012 GGGGAGGAAGGGAATGAGAGAGG - Intronic
1141365003 16:83434471-83434493 ATGGGAGAGTGGAATGAGATGGG - Intronic
1141822490 16:86456491-86456513 GTGGAGTGGAGGAATGAGTGGGG - Intergenic
1141845109 16:86603342-86603364 AGGAAGGAGAGGAGTGAGAAGGG - Intergenic
1142083969 16:88166282-88166304 ATGGAGGGAAGGAAAGAGGGAGG - Intergenic
1142096028 16:88240349-88240371 TTGGAGGGAGGGAATGAGAGAGG + Intergenic
1203010023 16_KI270728v1_random:230876-230898 ATGGAGGAGATGGAGGAGAAGGG + Intergenic
1203144950 16_KI270728v1_random:1793444-1793466 ATGGAGGAGATGGAGGAGAAGGG - Intergenic
1142615988 17:1135503-1135525 ATTGAGGATGGGAATGAGAGAGG + Intronic
1143023679 17:3929208-3929230 CTGGAGGAGAGGGAGGTGAGAGG - Intronic
1143084464 17:4405573-4405595 TTGGGGGAGAGAAAAGAGAGGGG + Intergenic
1143158207 17:4852415-4852437 TGGGAGGAGAGGATTGTGAGGGG + Intronic
1144247767 17:13384384-13384406 AGGGAGGAAAGGAGGGAGAGAGG + Intergenic
1144806120 17:17969023-17969045 ATTGAGGACAGGGATCAGAGAGG + Intronic
1145117896 17:20228587-20228609 ATGGATGATAGGTATCAGAGTGG + Intronic
1145177087 17:20710115-20710137 TTGGGGGAGGGGAATGAGATAGG - Intergenic
1145240517 17:21238413-21238435 AAGGATGAGAGGAGTGAGAGTGG - Intergenic
1145690207 17:26731759-26731781 ATGGGAGAGAAGAAGGAGAGCGG + Intergenic
1145783013 17:27576086-27576108 AAGGAGGAGGGGAATGGGGGTGG - Intronic
1145940491 17:28741053-28741075 ATGGGGGAGAGGAAGGAAAGGGG - Intronic
1146125826 17:30230669-30230691 GTGGAGAAGAGAAAAGAGAGGGG + Intronic
1146326259 17:31888731-31888753 ATGGAGGCTAGGAATAAGTGTGG - Intronic
1146367263 17:32238791-32238813 AGGGAGGGAGGGAATGAGAGAGG - Intronic
1146670493 17:34734190-34734212 AGGGACGAGAGCAATGGGAGAGG + Intergenic
1146886276 17:36473089-36473111 ATGGAGGGCAGGAATGAGACTGG + Intergenic
1146908384 17:36632386-36632408 GTGGTGGAGTGGAAAGAGAGTGG + Intergenic
1146925037 17:36738579-36738601 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
1146925046 17:36738599-36738621 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
1147177240 17:38663560-38663582 AGGGTGGAGAGGAGGGAGAGAGG - Intergenic
1147305709 17:39562835-39562857 AAGGAGGAAAAAAATGAGAGAGG - Intronic
1147310398 17:39592635-39592657 ATGGAGGAGAAAGAAGAGAGGGG + Intergenic
1147310871 17:39595560-39595582 GAGGAGGAAAGGAAAGAGAGTGG + Intergenic
1147493595 17:40894940-40894962 ATGGAGGGATGGAAAGAGAGAGG + Intergenic
1147565423 17:41533317-41533339 AAGGAGGAAAGGAAGGAGGGAGG + Intergenic
1147625328 17:41896401-41896423 AGTGAGGAGAGGACTGAGTGGGG + Intronic
1147759914 17:42790860-42790882 ATGGAGGAGATGCTTTAGAGAGG - Intronic
1147788066 17:42994554-42994576 AGTGAGGGGAGGAATGAGGGTGG - Intergenic
1147846876 17:43410710-43410732 AGGGAGGAAAGGAAAGAGGGTGG + Intergenic
1148193803 17:45698926-45698948 GGGGAAGAGAGGAAGGAGAGGGG + Intergenic
1148443497 17:47724224-47724246 ATGGCGGTGAGCAAGGAGAGGGG + Intergenic
1148957917 17:51369415-51369437 AAGGAGAAGAGGACTGATAGGGG - Intergenic
1149045846 17:52244475-52244497 CTGGAGGAGAGGAATTAGGACGG - Intergenic
1149864930 17:60146132-60146154 ATGGAGGTGAGGCTGGAGAGGGG - Intergenic
1149971866 17:61226997-61227019 AGGGAGGAGAGGATGGAGACTGG + Intronic
1149985383 17:61343165-61343187 ATGGCAGAGAGGGATGATAGAGG - Intronic
1150293251 17:63993493-63993515 AAGGAGGAAAGGAAGGAGGGAGG + Intergenic
1150543237 17:66125211-66125233 ATGAAGAAGAGTTATGAGAGTGG - Intronic
1150922025 17:69494175-69494197 CAGGAGGAGAGGAAAGGGAGAGG + Intronic
1151007501 17:70454989-70455011 ATGGAGGAAAGGAAGGAGGGAGG + Intergenic
1151276662 17:73039498-73039520 ATGAAGGGGAGGAACGAGGGTGG + Intronic
1151354265 17:73549208-73549230 AGGGAGGAGTAGAAGGAGAGAGG + Intronic
1152043074 17:77917555-77917577 AGGAAGGAGAGGAAGGAGAAGGG + Intergenic
1152047949 17:77950775-77950797 AAGGAGGGGAGAAAGGAGAGGGG + Intergenic
1152268582 17:79310500-79310522 AGGTAGGAGAGAAAAGAGAGGGG - Intronic
1152292215 17:79446369-79446391 TGGGAGGAGAGGAATGATTGTGG + Intronic
1152470809 17:80489363-80489385 GTGGAGGGGAGGGAGGAGAGGGG + Intergenic
1152470886 17:80489612-80489634 GTGGAGGGGAGGGAGGAGAGGGG + Intergenic
1152470963 17:80489861-80489883 GTGGAGGGGAGGGAGGAGAGGGG + Intergenic
1152471003 17:80489983-80490005 GTGGAGGGGAGGGAGGAGAGGGG + Intergenic
1152481418 17:80556181-80556203 ATGGAGTAGAGGGATTGGAGAGG - Intronic
1152799585 17:82324537-82324559 AAGGGGGAGGGGAGTGAGAGGGG - Intronic
1152948461 17:83211611-83211633 ATGGAGAGGAGAAAGGAGAGGGG + Intergenic
1152993348 18:383367-383389 ATGGAGGTGAGGAGGGAGTGAGG + Intronic
1154069080 18:11136642-11136664 TTTGATGAGAGGAAGGAGAGGGG + Intronic
1154072069 18:11161710-11161732 CAGGAGGAGAGGGATGAGGGAGG + Intergenic
1154207311 18:12348101-12348123 AGGGAGGAGAGGCATGGGAGGGG + Intronic
1154236316 18:12609644-12609666 ATGCTGGAGAGTAAGGAGAGTGG - Intronic
1154286129 18:13058518-13058540 TTGAAGGAGAGGATTGAGGGTGG + Intronic
1154505899 18:15040574-15040596 ATGGAGAACAGGAATGGGAATGG + Intergenic
1155198277 18:23495442-23495464 ATGGAGGAAAAGAAAGTGAGAGG + Intergenic
1155882043 18:31161927-31161949 TTGGAGGTGAGGGAAGAGAGGGG - Intronic
1155972534 18:32094738-32094760 AGGGAGGAGAGCAAGGTGAGAGG + Intronic
1156341611 18:36214748-36214770 AGGGAGGAGAAGAAATAGAGAGG + Intronic
1156450514 18:37263895-37263917 ATGGCTGAGGGGAATGAGAGAGG - Intronic
1156460388 18:37318382-37318404 ATGGAGAGAAGGAATGGGAGAGG - Intronic
1156490478 18:37493031-37493053 TTGGAGGAGTGGGAAGAGAGAGG - Intronic
1156516339 18:37683773-37683795 AAGGAGGAGAGGAATTTGAGAGG + Intergenic
1156530654 18:37811804-37811826 ATAGGGGAAAGGAATGAGGGTGG + Intergenic
1156706444 18:39888782-39888804 AAGGAGAAGGGGAAGGAGAGGGG - Intergenic
1157215857 18:45782914-45782936 ATGGAGGAGGGGAGGGAGAGTGG + Intergenic
1157271970 18:46283140-46283162 GTGGAGGAGAGCAATCAGGGAGG + Intergenic
1157410423 18:47458611-47458633 AGAGAGAAGAGGGATGAGAGGGG + Intergenic
1157410447 18:47458757-47458779 AAGGGAGAGAGGAAAGAGAGGGG + Intergenic
1157475544 18:48021230-48021252 AGGGAGGGGAGGAAAGAGAAGGG - Intergenic
1157492601 18:48134991-48135013 AGGAAGGAGAGGAAAGAGCGGGG - Intronic
1157571277 18:48713923-48713945 ATCTAGAAGAGGAATTAGAGCGG - Intronic
1157624338 18:49037424-49037446 AGGGAGGAAGGGAAGGAGAGAGG + Intergenic
1157661469 18:49448662-49448684 ATGGTGGAGAGGAAGCAGTGGGG - Intronic
1157793778 18:50557376-50557398 AGGGAGGAAAGGAAAGGGAGAGG + Intergenic
1157967574 18:52225423-52225445 ATGGAGGAGAGGAAGGAAAAAGG - Intergenic
1158314368 18:56194485-56194507 AGGGAGGAAAGGAAGGAGGGAGG - Intergenic
1158585743 18:58732723-58732745 ATGGAGGAGACAAATGAGTCAGG + Intronic
1158931487 18:62328213-62328235 AGGGAGGAGGGGAGGGAGAGAGG + Intronic
1159029410 18:63215612-63215634 CTAGAAGAGAGGAATTAGAGTGG + Intronic
1160051399 18:75437449-75437471 ATGGGGGAGGGGAAGGGGAGAGG + Intergenic
1160105796 18:75974884-75974906 AAGGAGGGAAGGAAGGAGAGAGG - Intergenic
1160123525 18:76150942-76150964 AGGGAGGAGAGGAGTGAGTGGGG + Intergenic
1160373021 18:78390343-78390365 AGGGAGGAGGGGAAGGAGCGGGG + Intergenic
1160376372 18:78415750-78415772 ATGAAGGAGAGGCAGGAGACAGG - Intergenic
1160893229 19:1390425-1390447 ATGGAGGAGAGGGGAGGGAGTGG + Intronic
1160899141 19:1418410-1418432 ATGAAGCAGAGGAAGGACAGGGG - Intronic
1161705237 19:5817380-5817402 AGGGAGGAAAGGAGTGAGGGAGG + Intergenic
1162038151 19:7953496-7953518 AAGGAGGAGAGGAGGGGGAGGGG - Intergenic
1162038188 19:7953590-7953612 GGGGAGGAGAGGAAGGAGAGGGG - Intergenic
1162248760 19:9425249-9425271 CTGTGGGATAGGAATGAGAGAGG - Intronic
1162362150 19:10226932-10226954 GTGGAGGGGAGGGATGGGAGGGG - Intronic
1162531325 19:11237930-11237952 ATGGGGGACAGGAAGAAGAGAGG - Intronic
1162943645 19:14029261-14029283 AAGGAGGATAGGTATGAGCGTGG + Intronic
1163020684 19:14479532-14479554 AGGCAGGAGAGGAGTGAGTGTGG + Intronic
1163182819 19:15616097-15616119 AGTGAGGAGAGGAATGAGTGAGG - Intronic
1163190647 19:15674305-15674327 AGTGAGGAGAGGAATGAGTGAGG - Intronic
1163191015 19:15676573-15676595 AGTGAGGAGAGGAATGAGTGTGG - Intronic
1163191084 19:15677153-15677175 AGTGAGGAGAGGAATGAGTGTGG - Intronic
1163191118 19:15677482-15677504 TGGGAGGAGGGGAATGAGTGAGG - Intronic
1163191161 19:15677854-15677876 AGTGAGGAGAGGAATGAGTGAGG - Intronic
1163353817 19:16796660-16796682 AGGAAGGAGAGAAATGAGAAGGG - Intronic
1163353827 19:16796725-16796747 AAGGAAGGGAGGAAGGAGAGAGG - Intronic
1163381055 19:16969045-16969067 AAGGATGAGAGGAAGGAGAAAGG + Intronic
1163399568 19:17083985-17084007 AGAGAGGAGAGAAATCAGAGAGG + Intronic
1163818002 19:19479039-19479061 ATGGAGAAGAGGTTGGAGAGTGG + Intronic
1164250074 19:23468384-23468406 AAGGAGGAGAGGAAAAGGAGAGG - Intergenic
1164569677 19:29364096-29364118 AAGGAAGAGAGGAAGGAGGGAGG + Intergenic
1164609520 19:29622583-29622605 AGGGAGGGGAGGAAAGAGAAAGG + Intergenic
1164744150 19:30599090-30599112 AGGGAGGAAAGGAGAGAGAGAGG - Intronic
1164771919 19:30816158-30816180 AGGGAGGGAAGGAAGGAGAGAGG - Intergenic
1164960288 19:32422478-32422500 ATGTTGGACAGGACTGAGAGAGG + Intronic
1165121781 19:33564419-33564441 ATGGAGGAGATCAATAAGTGAGG - Intergenic
1165180376 19:33962367-33962389 AAGGAAGACAGGAAGGAGAGGGG + Intergenic
1165269103 19:34689499-34689521 AAGGAGGAGAGGAGAGGGAGAGG + Intergenic
1165275524 19:34747824-34747846 AAGGAGGAGAGGAGAGGGAGAGG + Intergenic
1165381539 19:35484977-35484999 ATGGAGTACAGGAAGAAGAGGGG - Intergenic
1165545229 19:36529496-36529518 TTGGAGGACAGAAATGAGAAGGG - Intergenic
1165863322 19:38920463-38920485 AGGGAGGAGGAGAATCAGAGAGG + Intronic
1166140862 19:40804436-40804458 ATGGAGCAGAGTGATGGGAGAGG + Intronic
1166333347 19:42091219-42091241 AGGGACCAGAGGAATGGGAGGGG + Exonic
1166650349 19:44569370-44569392 ATGGAGGGAAGGAAGGAGAGAGG + Intergenic
1166786848 19:45372658-45372680 ATGGATGAGAGAAGTGAGAAAGG + Intergenic
1167175885 19:47864137-47864159 ATTGAGGAGATGAAAAAGAGAGG - Intergenic
1167409631 19:49337258-49337280 AGGGAGGAGAGGGAAGGGAGTGG + Intronic
1167674493 19:50875945-50875967 GAGGAGGAGAGGCATGAGGGTGG - Intronic
1167821720 19:51934396-51934418 ATGGAGGAGAGGAAAGGGGGTGG - Intronic
1167891267 19:52541536-52541558 ATAGAGGTGAGGAATAAGACCGG + Intronic
1167916576 19:52744737-52744759 ATAGAGGTGAGGAATAAGACTGG - Intergenic
1167920738 19:52781300-52781322 ATAGAGGTGAGGAATAAGACCGG - Intronic
1168284101 19:55321906-55321928 AAGGGTGAGAGGAAGGAGAGTGG - Intronic
1168389432 19:55993615-55993637 ATAGGGGAGAGGAGGGAGAGGGG - Intergenic
925032210 2:659674-659696 AGGGAGGGAAGGAAGGAGAGAGG + Intergenic
925079374 2:1051173-1051195 AGGGAGGAAAGGAAGGAGGGAGG - Intronic
925317340 2:2936459-2936481 AGGGAGGAAAGGAATGTGAGAGG - Intergenic
925625895 2:5841939-5841961 AGGGAGGGGAGGATGGAGAGAGG + Intergenic
925659187 2:6184321-6184343 ATGGAGGGAAGGAAAGAAAGAGG + Intergenic
925791211 2:7489211-7489233 AAGGAAGGGAGGAAGGAGAGAGG + Intergenic
925842576 2:8006527-8006549 GAGGAGGAGAGGAAGGAGTGAGG - Intergenic
925972046 2:9112773-9112795 AGTGAGGAGGGGAAGGAGAGAGG - Intergenic
926118090 2:10225836-10225858 AGAGGGGAGAGGAGTGAGAGAGG - Intergenic
926119899 2:10236215-10236237 ATGGAGAAGAGGGAAGAGGGTGG - Intergenic
926141230 2:10369651-10369673 ATGTAGCAGAGAACTGAGAGGGG + Intronic
926244550 2:11113395-11113417 AAGGAAGAAAGGAAGGAGAGAGG - Intergenic
926742962 2:16127310-16127332 GTAGGGGACAGGAATGAGAGGGG + Intergenic
927042829 2:19246643-19246665 ATGGAGGACAGAAAGGGGAGAGG + Intergenic
927223821 2:20741600-20741622 AATGAGGAGAGGAATGTTAGAGG - Intronic
927263306 2:21116742-21116764 CTGGAGGAGAGGAGTGAGGAGGG + Intergenic
927400058 2:22700683-22700705 AAGGAAGAGAGGAAGGAGAGCGG - Intergenic
927780937 2:25938972-25938994 AGGAAGGAGAGGAAGGAGAGGGG - Intronic
928465925 2:31522303-31522325 AAGGAGGGGAGTAATGAGCGAGG - Intergenic
928630415 2:33185844-33185866 ATGGAGGAGACGATTTAAAGAGG + Intronic
929214774 2:39400516-39400538 ATGAAGGGGAAGAAAGAGAGGGG - Intronic
929380786 2:41350557-41350579 ATGGAGGAGAAGCAGAAGAGTGG + Intergenic
929562224 2:42963057-42963079 TTGGGGGAGAGGAAAGAAAGGGG - Intergenic
929642471 2:43595728-43595750 GTGGAGTCGAGGAATGACAGTGG + Exonic
930069888 2:47357744-47357766 ATGGAGGTGAGAAAGGAGTGGGG + Intronic
930886253 2:56330513-56330535 ATGGAAGAAAGGAAAGAGGGAGG - Intronic
931091618 2:58892772-58892794 AAGGAGGAGAGCTATGAAAGAGG + Intergenic
931177334 2:59867309-59867331 AGGGTGCAGAGGAATGAAAGAGG + Intergenic
931209750 2:60181257-60181279 ATGGAGGAGAGAAGGAAGAGAGG + Intergenic
931317491 2:61146403-61146425 ATGGAGGGTAGGACTGAGATAGG + Intronic
931529386 2:63197077-63197099 TTGAAGGAGAGGCAAGAGAGAGG - Intronic
931807356 2:65820114-65820136 ATGGATCAGATGACTGAGAGAGG - Intergenic
931909530 2:66883253-66883275 TTGGAGGGGAAGAATGAGAGGGG - Intergenic
932214844 2:69960048-69960070 GAGGATGAGAGGAATGTGAGAGG - Intergenic
932290375 2:70572111-70572133 GTGGAGGAGAGGCAGGAAAGGGG + Intergenic
932323196 2:70837042-70837064 AAAGAGGAGAGGAAAGAGGGAGG + Intergenic
932487540 2:72093749-72093771 ATGGGGGAAAGCAAGGAGAGAGG - Intergenic
932621294 2:73266064-73266086 ATGGGGGAGAGGAGAGAGAAGGG + Intronic
932631297 2:73345528-73345550 TTAGAGGATAGGAATGAGACAGG - Intergenic
934047337 2:88183612-88183634 ATGGAAAGGAGGAAGGAGAGAGG - Intronic
934095502 2:88598925-88598947 ATGGGGGAGAAGAGTGAGAGTGG + Intronic
934219954 2:90073582-90073604 TTGGATGGGAGGAATGAGACTGG + Intergenic
934487174 2:94725957-94725979 AGGGAGGAGAGGACAGGGAGAGG - Intergenic
934511369 2:94946942-94946964 ATTGGGAAGAGGAAAGAGAGTGG - Intergenic
934926740 2:98387393-98387415 GTGGAAGAGAGAAATCAGAGGGG + Intronic
935400081 2:102651173-102651195 ATCCAGGAGAGGGCTGAGAGTGG - Intronic
935659969 2:105458200-105458222 ACGGGGGAGAGGACAGAGAGAGG + Intergenic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
935883194 2:107587483-107587505 GAGGAGGAAAGGCATGAGAGAGG - Intergenic
936761009 2:115783047-115783069 ATGGAAGAAAGGAAAGAGAAAGG - Intronic
936910610 2:117588696-117588718 ATTGAGGAGAAGAATGAAATAGG - Intergenic
937084877 2:119164860-119164882 AAGGAGGGAGGGAATGAGAGAGG - Intergenic
937268395 2:120631657-120631679 AGGGAGGAAATGAATGAGAGAGG - Intergenic
937299754 2:120832066-120832088 TTGGTGGAGAGGAATCAGTGTGG + Intronic
938678776 2:133667321-133667343 AAGGATGAGAGGAAAGAGAGAGG - Intergenic
939297979 2:140294811-140294833 TGTGAGGAGGGGAATGAGAGTGG + Intronic
939538726 2:143465871-143465893 TTGGAAGAGAGGAACTAGAGAGG - Intronic
939655183 2:144816023-144816045 GGAGAGGAGAGGAGTGAGAGAGG - Intergenic
939655187 2:144816045-144816067 GGAGAGGAGAGGAGTGAGAGAGG - Intergenic
939655191 2:144816067-144816089 ACAGAGGGGAGGAGTGAGAGAGG - Intergenic
940103237 2:150067093-150067115 ATGGGGGAGAGGGATGAATGGGG - Intergenic
940367529 2:152864723-152864745 TTGGAGGAGAGGAAAAAAAGGGG + Intergenic
940492321 2:154378646-154378668 CGGGAGGGGAGGAATGTGAGAGG - Intronic
940724695 2:157323507-157323529 AAGGAGGACAGGAATGTGATTGG - Intronic
941972122 2:171362264-171362286 ATGGAGAACAGGAAGGAAAGGGG + Intronic
942297199 2:174529080-174529102 AGAGAGGAGAGGAAGGAGAAAGG + Intergenic
942501717 2:176597795-176597817 TTGGGGGAGAGGAAGAAGAGAGG + Intergenic
942509546 2:176682825-176682847 AGGGAGGTAAGGAAGGAGAGAGG + Intergenic
942919704 2:181357058-181357080 AGGGAGGAGAGAACTCAGAGAGG - Intergenic
942955116 2:181764504-181764526 TGGGAGGAGAGGACTGAGACAGG - Intergenic
943173213 2:184431688-184431710 ATGTAGAAGAGGAATCAGAATGG + Intergenic
943334320 2:186595528-186595550 ATAGAGGAAAGGAAAAAGAGAGG - Intronic
943433666 2:187835361-187835383 CTGGAGAAGGGGAATGGGAGTGG - Intergenic
943522914 2:188976053-188976075 AAAGGGGAGAGGAATGAGAAAGG - Intronic
943557166 2:189419907-189419929 GAGGAGGAGAAGAAGGAGAGGGG + Intergenic
943701571 2:190993645-190993667 CTGAAGGAAAGGAATGAGATAGG + Intronic
944154864 2:196598215-196598237 AGGGAGGAGGGGAAGGGGAGGGG + Intergenic
944154904 2:196598296-196598318 AGGGAGGAGGGGAAGGGGAGGGG + Intergenic
944466309 2:200003408-200003430 AGAGAGGAGAGGAATGATAGAGG + Intronic
944685609 2:202114928-202114950 ATGGAGGAAAGGCTTGAGAAAGG - Intronic
946015879 2:216603343-216603365 GGGGAGGAGAGGAAGGGGAGGGG + Intergenic
946173444 2:217908830-217908852 GTGGAGGAGAGGTGTGGGAGGGG - Intronic
946357232 2:219195531-219195553 ATACAAGAGAGGAATGAGAAGGG - Intronic
946418204 2:219551081-219551103 ATGGGGAAGAGGAAAGAAAGAGG + Intronic
946555116 2:220847831-220847853 ATGATGGAGAGGAATGAGAAGGG + Intergenic
946835428 2:223767844-223767866 AGGAGGGAGAGGAATGAGTGGGG - Intronic
946941781 2:224776773-224776795 ATGATGGGGAGGAATGAAAGAGG - Intronic
947876277 2:233470149-233470171 AGGGAGGAGCGGGAGGAGAGAGG - Exonic
947998009 2:234544765-234544787 AGGGAGGGAAGGAAGGAGAGAGG + Intergenic
948089133 2:235277642-235277664 AGGAAGGAAAGGAAAGAGAGAGG + Intergenic
948197847 2:236108370-236108392 AAGGAGGAGAGGAAGGGCAGAGG - Intronic
948262242 2:236613015-236613037 ATGGAGCAGAGGGAGGAGGGCGG - Intergenic
948282783 2:236760555-236760577 AGGAAGGAGGGGAAGGAGAGAGG + Intergenic
948538992 2:238672320-238672342 AAGGAGGAGAAGAAGGAGAAGGG - Intergenic
948695652 2:239732009-239732031 GTGGAGGGGAGGAAGGAGGGTGG - Intergenic
948724211 2:239921889-239921911 AAGGAGAAAAGGAAGGAGAGAGG - Intronic
948855258 2:240727348-240727370 AGGGAGGAGAGGAAGGACAGAGG + Intronic
948926057 2:241098944-241098966 TTGGAGGTGAGGAATAGGAGTGG - Intronic
949047372 2:241878020-241878042 AGGGAGGAGAGGGATGGGGGTGG - Intergenic
1168807633 20:681877-681899 ATGGAGGAGAGCCTTCAGAGAGG + Intergenic
1169260767 20:4136425-4136447 AAGGAGGAGAGAAAAGAGAAGGG - Intronic
1169334663 20:4746352-4746374 AGGGAAGAGAGGAATTGGAGAGG + Intergenic
1169704385 20:8486036-8486058 AGGAAGGAGAAGAATGAGTGGGG + Intronic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170291996 20:14780745-14780767 ATAACAGAGAGGAATGAGAGTGG + Intronic
1170845039 20:19955105-19955127 ATGGGGGAGAGAAAAGAGAATGG - Intronic
1170867693 20:20174666-20174688 GTGGAGGAGAGAAAGGAGGGTGG + Intronic
1171002928 20:21433122-21433144 TTGGGGGAGAGGAATGAGAGGGG + Intergenic
1171148003 20:22802680-22802702 AAGAAAGAGAGGAAAGAGAGAGG + Intergenic
1171299832 20:24050498-24050520 GTGGAAGAGAGGAATGAATGAGG - Intergenic
1171308279 20:24124519-24124541 TTTGAGGAGAGGAATGACAAGGG - Intergenic
1171721688 20:28569793-28569815 AAGGAGGGAAGGAAGGAGAGAGG - Intergenic
1171756375 20:29113704-29113726 AAGGAGGGAAGGAAGGAGAGAGG + Intergenic
1171756382 20:29113732-29113754 AAGGAGGGAAGGAAGGAGAGAGG + Intergenic
1171756431 20:29113903-29113925 AGGGAAGGGAGGAAGGAGAGAGG + Intergenic
1171785882 20:29464200-29464222 AAGGAGGGAAGGAAGGAGAGAGG - Intergenic
1171844580 20:30257983-30258005 ATGGAGGAAAGGAACGTGAATGG + Intergenic
1171862373 20:30412828-30412850 AAGGAGGGAAGGAAGGAGAGAGG + Intergenic
1172019180 20:31900850-31900872 ATTGAGCAGAGGCAGGAGAGGGG - Intronic
1172027673 20:31960192-31960214 AGGGATGAGAGGCAGGAGAGAGG - Intergenic
1172872261 20:38143126-38143148 AAGGAGTGGAGGAAGGAGAGAGG + Intronic
1172872265 20:38143142-38143164 AGAGAGGAGAGGAAAGAGGGAGG + Intronic
1172936604 20:38624969-38624991 ATGGAGGAGGGGAATGTGCTTGG - Intronic
1172966545 20:38839492-38839514 AAGGAGGGGAGGAAGGAGAGAGG - Intronic
1173040567 20:39458570-39458592 AAGGAGGAGCAGCATGAGAGGGG + Intergenic
1173297366 20:41771670-41771692 ATGGAAGAGAAGAAAGAAAGTGG + Intergenic
1173472254 20:43332992-43333014 AGGGAGAAGAGGAAAGGGAGGGG - Intergenic
1173597885 20:44271564-44271586 TGGGAGGAGAGGAATGAAGGCGG + Intronic
1173706672 20:45115157-45115179 AGTCAGGAGAGGAAAGAGAGGGG + Exonic
1173880583 20:46408889-46408911 ATGGATTAGAGAACTGAGAGGGG - Intronic
1173914248 20:46694870-46694892 AAGGAGGGGAGGAATGATATTGG + Intergenic
1174151439 20:48489071-48489093 GTGGAGCAGAGGAATCAGAAGGG + Intergenic
1174198003 20:48786876-48786898 AGGGAGGAGAGGAAAGGGAGAGG + Intronic
1174577330 20:51545751-51545773 ATGGAGGAGTGGATGGAGGGTGG + Intronic
1174870974 20:54181796-54181818 ATGGAGGACAGGGAAGAGAAGGG + Intergenic
1175279819 20:57795494-57795516 ATGGAGGAGGGAAATGAATGTGG - Intergenic
1175382672 20:58574629-58574651 ATGGAGGAAGGGAATGAGGGAGG - Intergenic
1175984009 20:62755272-62755294 ATGGAGGGAAGGAGGGAGAGAGG - Intronic
1176162968 20:63657902-63657924 ACGCAGGAGAGGAAGGAGAGGGG + Intronic
1176283522 20:64328524-64328546 CTGGAGGAGAGGAAGGTGTGGGG + Intergenic
1176664996 21:9678202-9678224 AGAGTAGAGAGGAATGAGAGGGG - Intergenic
1176903090 21:14467252-14467274 ATGGAGGAGAGGATTTATGGAGG + Intergenic
1177278512 21:18948030-18948052 ATTGAAGAGAAGAAAGAGAGAGG + Intergenic
1177736119 21:25092551-25092573 ATGGAGGAGTGGGCAGAGAGGGG - Intergenic
1177991355 21:28039455-28039477 ATGGAGAACAGGAATGGGAATGG - Intergenic
1178021665 21:28415281-28415303 GTGGTGGAGAGGAAAGAGAATGG + Intergenic
1178111903 21:29377117-29377139 ATGGGGTAGGGGAATGAGAGGGG + Intronic
1178149805 21:29781465-29781487 GGGGAAGAGAGTAATGAGAGTGG - Intronic
1178393196 21:32216031-32216053 ATGGAGGAGAGGAGTTTTAGAGG - Intergenic
1178627375 21:34229250-34229272 AGGGAGGAAGGGAAGGAGAGAGG + Intergenic
1178720848 21:35007696-35007718 GTGGAGAAGAGGTAGGAGAGAGG - Intronic
1179088931 21:38245605-38245627 AAGGAGGGAAGGAAGGAGAGAGG + Intronic
1179150628 21:38805808-38805830 AGGGAGGAGAGAAGAGAGAGGGG - Intronic
1179155760 21:38849705-38849727 ATGAAAGGGAGGGATGAGAGTGG + Intergenic
1179270025 21:39843689-39843711 AGGGAGGAGGAGAAGGAGAGAGG + Intergenic
1179388931 21:40969846-40969868 AGGGAGGAATGGAAGGAGAGAGG + Intergenic
1179911910 21:44455296-44455318 ATGGGGGAGGGGCATGGGAGGGG - Intergenic
1180118185 21:45725856-45725878 ATGGAGGAAAGGAAGGGGTGGGG + Intronic
1180295243 22:10928484-10928506 AAGGAGGGAAGGAAGGAGAGAGG - Intergenic
1180413436 22:12637589-12637611 AAGGAGGGAAGGAAGGAGAGAGG + Intergenic
1180413466 22:12637714-12637736 AGGAAGGAAAGGAAGGAGAGAGG + Intergenic
1180700490 22:17778888-17778910 TTTGAGGATATGAATGAGAGTGG - Intergenic
1181094530 22:20496270-20496292 AAGGAGGGAGGGAATGAGAGGGG - Intronic
1181094572 22:20496432-20496454 AGGGAGGGAAGGAATGAGAGAGG - Intronic
1181466827 22:23114897-23114919 AGGGAGGTGAGGAAAGGGAGAGG + Intronic
1181537119 22:23552160-23552182 ATGCAGGAGAGGATAGACAGAGG - Intergenic
1181630238 22:24147316-24147338 AGGGAGGAGAGGAGGGAGGGAGG - Intronic
1181791236 22:25268447-25268469 AAGGAAAAGAGGAATGAGACAGG + Intergenic
1182068043 22:27444090-27444112 TTGGAGGAGAGGAGTATGAGGGG - Intergenic
1182100785 22:27655999-27656021 ATGGAGGAAGGGAGGGAGAGAGG + Intergenic
1182100859 22:27656311-27656333 ATGGAGGAAGGGAGAGAGAGAGG + Intergenic
1182277696 22:29200966-29200988 AAGCAGGAGGAGAATGAGAGTGG - Intergenic
1183039075 22:35162574-35162596 ATGGAAGAGAGGAAAGAAATGGG + Intergenic
1183333792 22:37235348-37235370 AAGGGAGAGAGGAAGGAGAGTGG - Intronic
1183375861 22:37464664-37464686 AGGGAGGAATGGAATGAGAATGG - Intergenic
1183613053 22:38923682-38923704 AGGGAGGAGAGGAAGGAGGAAGG - Intergenic
1184032954 22:41905508-41905530 GGGGAGGAGAGGAAGGAGAGGGG - Exonic
1184103375 22:42353416-42353438 AGGGAGGACAGGAAGGAGGGTGG + Intergenic
1184125211 22:42481957-42481979 AGGGGGGAGAAGAATGAGAGAGG - Intergenic
1184665425 22:45986555-45986577 ATGGAGCAGAGGAAAGGGGGAGG + Intergenic
1203324981 22_KI270738v1_random:4868-4890 ATGGGAGAGAAGAAGGAGAGTGG - Intergenic
949161400 3:887212-887234 AAGGAAGAAAGGAATGAGGGAGG - Intergenic
949437323 3:4043476-4043498 AGTGAGGAGAGGGCTGAGAGAGG - Intronic
949742799 3:7255659-7255681 ATGGAGGAGAGAAGTGAGTTGGG + Intronic
950149553 3:10676146-10676168 AAGGAAGAAAGGAAGGAGAGAGG + Intronic
950180224 3:10906909-10906931 CTTGCGTAGAGGAATGAGAGTGG - Intronic
950180747 3:10911511-10911533 AGGGAGGGGAGGAGTGAGGGAGG - Intronic
950363810 3:12468880-12468902 AGGGAGGGAAGGAAAGAGAGAGG + Intergenic
950532466 3:13560250-13560272 AGGGAGGAGAGGGAAGGGAGGGG + Intronic
950767175 3:15281493-15281515 CTGCTGGAGAGGAAGGAGAGAGG - Intronic
951525177 3:23646596-23646618 ATTGAGGAGGGGACAGAGAGAGG - Intergenic
951591205 3:24266911-24266933 AAGGAAGAGAGGGAGGAGAGAGG + Intronic
951621462 3:24606340-24606362 ATGGAGGAGAGGGAAGATAATGG - Intergenic
951636776 3:24787413-24787435 ATGAAGGAGATGAACGAGACGGG + Intergenic
951853698 3:27170921-27170943 ATGGAGAGGAGAAATGAGAGAGG - Intronic
952631073 3:35468329-35468351 ATGTAGGAGAGGAATTAGTGGGG + Intergenic
953012212 3:39037790-39037812 ATGGGGGATAGAAATGAGAATGG + Intergenic
953201927 3:40785611-40785633 GAGGAGGAGAAGAAGGAGAGGGG - Intergenic
953206277 3:40832784-40832806 ATGGAGCAGAGGAGAGAGAAGGG - Intergenic
953596203 3:44317006-44317028 ATTTAGAAGAGGAGTGAGAGTGG - Intronic
953739596 3:45525983-45526005 AAGTAGGAGGGGAAAGAGAGAGG + Intronic
953757671 3:45661145-45661167 ATGGAGTAGGGGAATGTGGGTGG - Intronic
953890402 3:46748095-46748117 GTGGAGAAGGGGAATGGGAGTGG + Intronic
954390225 3:50264785-50264807 AGGGAGGAGTGGGAGGAGAGGGG - Intergenic
954411635 3:50373716-50373738 AGGGAGAAGAGGAGGGAGAGAGG + Intronic
954445028 3:50541903-50541925 ATGATGGAGACAAATGAGAGGGG + Intergenic
954635118 3:52067028-52067050 CTGGAGCAAAGGGATGAGAGGGG + Intergenic
954771904 3:52978365-52978387 AAGGAGAAGAGGCAGGAGAGAGG + Intronic
954952064 3:54484270-54484292 ATGGAGAATAGGAAGGAGAATGG - Intronic
955086588 3:55708761-55708783 ATGGAGGAGTGGAAGAAGAAAGG + Intronic
955119413 3:56041628-56041650 GTGGAGGGAAGGAATGAAAGAGG - Intronic
955555696 3:60134939-60134961 ATGGAGTAGAGGAAAGAGAAAGG + Intronic
955656144 3:61247008-61247030 ATGGAGGACAGGAGGGAGGGAGG - Intronic
955672799 3:61419325-61419347 ATGGGGGAGAGGTAGGAAAGTGG - Intergenic
956134572 3:66086406-66086428 ATGGAAGTGGGGAGTGAGAGGGG - Intergenic
956299154 3:67750742-67750764 CTAGAAGAGAGGAATTAGAGAGG - Intergenic
956749877 3:72336988-72337010 CTGGAGGAGAGGGATGAGCGGGG - Intergenic
956961750 3:74411015-74411037 AGGGAGGAAAGGATAGAGAGGGG - Intronic
957456517 3:80457127-80457149 AGGGAGGAGAGGACAGAAAGAGG - Intergenic
957600434 3:82327153-82327175 AGGGAGGAGAGGAAAGAGATAGG - Intergenic
957639123 3:82827614-82827636 ATGAAGCAGAAGAAAGAGAGGGG - Intergenic
957938700 3:86977240-86977262 AGGGAGGGAAGGAAGGAGAGAGG + Intronic
958446155 3:94217544-94217566 ATGAAGAGGAGGAAGGAGAGTGG + Intergenic
958670932 3:97202999-97203021 ATGGAAGAGAGGAGTTGGAGAGG + Intronic
958995230 3:100896440-100896462 TTGGAGGAGAGGCTTGAGAGCGG + Intronic
959155362 3:102660216-102660238 TTAGGGGAGAGAAATGAGAGAGG + Intergenic
959589311 3:108060070-108060092 TTGGAGGATGGGAATGTGAGTGG - Intronic
960184745 3:114624731-114624753 GTGGAGAAGAGGAAGAAGAGAGG + Intronic
960260876 3:115567063-115567085 ATGAAGGAGATGAAGGAGACTGG + Intergenic
960273466 3:115699629-115699651 AAGGAAGAGGGGGATGAGAGAGG + Intronic
960313116 3:116141454-116141476 ATGGAGGAGAGGGAGAAGAAAGG - Intronic
960337651 3:116437591-116437613 AAAGGGGAGAGGAAGGAGAGAGG + Intronic
960674355 3:120180319-120180341 AAGGAGGAGTGGGATGAGGGAGG + Intronic
960822869 3:121752907-121752929 AGGAAGGAGAGGAAAGAAAGGGG + Intergenic
961695623 3:128702274-128702296 CTGGAGGAGAGGAAGGGTAGTGG - Intergenic
961904123 3:130244649-130244671 ATTCAGGAGATAAATGAGAGTGG - Intergenic
962613488 3:137101591-137101613 ATGTAGGAGAGAAGAGAGAGTGG - Intergenic
962635253 3:137324891-137324913 GTGGAGGAGAGGAAATATAGGGG - Intergenic
962976539 3:140451000-140451022 ATGGAGGAGAGGACTGGAGGTGG - Intronic
963809821 3:149764603-149764625 AGGGAGGAGAGGAGGGAGGGAGG - Intronic
964205555 3:154171010-154171032 TTGGAGAAGAGAAATGGGAGAGG + Intronic
964384842 3:156136648-156136670 TTGGAGGAGAGGTAGGTGAGCGG - Intronic
964626700 3:158766675-158766697 ATGAATGAGATGGATGAGAGAGG - Intronic
964911348 3:161785095-161785117 AGGGAGGAGAAGACAGAGAGAGG - Intergenic
965042409 3:163526657-163526679 AGGGAGGGGAGGAGAGAGAGAGG + Intergenic
965285757 3:166817718-166817740 ATGTAGTAGTGGAAGGAGAGAGG - Intergenic
965500336 3:169448047-169448069 ATGGATGAGAGCTAGGAGAGGGG + Intronic
965586688 3:170325225-170325247 GTGGAGGAGAGGTATGGGGGTGG + Intergenic
965594856 3:170400562-170400584 AAGGAGGAGAGGGAGGGGAGGGG - Intergenic
965781241 3:172288400-172288422 TTGGAGGAGGGTAATGAGACAGG - Intronic
965836554 3:172859884-172859906 AGGGAGGAGAGAAAGGAGACGGG - Intergenic
965881607 3:173395378-173395400 AGGAAGCAGAGGAAAGAGAGGGG + Intergenic
966737192 3:183196269-183196291 ATGGGTGAGAGGAATGACACTGG - Intronic
966794269 3:183698413-183698435 ATGGAGGGGAGGGGTCAGAGAGG + Intronic
966868088 3:184272341-184272363 AAGGAAGAGAGGAAGGAAAGGGG + Intronic
966933179 3:184688946-184688968 ATTGAGGAGAGGAGCCAGAGGGG + Intergenic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967228817 3:187318523-187318545 AAGGAGGAGAGCAATGGGATGGG - Intergenic
967293272 3:187942560-187942582 GTGGAGGAGAGGGATGGGAAAGG - Intergenic
968085955 3:195873943-195873965 AGGGAGGGAAGGAAGGAGAGAGG + Intronic
968493055 4:900830-900852 AGGGAGGAAAGGAAGGAGAAGGG + Intronic
968947859 4:3675008-3675030 AGGGAGGAGGGGAGGGAGAGAGG - Intergenic
969480460 4:7444312-7444334 ATGGAGGAAAGTGATGAGTGAGG + Intronic
969847402 4:9930137-9930159 GTGGAAGGGAGGAAGGAGAGGGG - Intronic
969928961 4:10611772-10611794 GTGGAGGAAAGGAAGGGGAGAGG - Intronic
969937301 4:10695034-10695056 ATGGAGGAGTGGACTGGGAAAGG + Intergenic
969984007 4:11188330-11188352 CAGGAGGAGAGGCAAGAGAGAGG - Intergenic
970078741 4:12255220-12255242 GGGGAGGAGAGGAATCAGAGTGG - Intergenic
970167010 4:13249350-13249372 ATGGAGGAGAGGACTTTCAGAGG + Intergenic
970602223 4:17649769-17649791 ATGGTGGGAAGGTATGAGAGAGG - Intronic
970965638 4:21924794-21924816 ATAGAGGAGAGGGAGGAGAGGGG - Intronic
971261743 4:25063488-25063510 ATGGAGCAGAAGAATGGTAGAGG + Intergenic
971455186 4:26837390-26837412 TTGGATGAGATGAATGAGAGAGG + Intergenic
971559448 4:28057634-28057656 ATGAAGGAGAAGTCTGAGAGTGG + Intergenic
971727769 4:30335690-30335712 AGAGAGGAGAGGAAAGAGAGAGG + Intergenic
971954840 4:33403457-33403479 AGGGAGGGAAGGAAGGAGAGAGG - Intergenic
972353074 4:38255102-38255124 ATGGAGGAAAGGAAGGAAAGAGG + Intergenic
972591557 4:40492923-40492945 ATGGAGGAGGGGAAGCAGAAGGG - Intronic
973314361 4:48744333-48744355 TTGAAGGAGGGGAAGGAGAGAGG + Intronic
973544386 4:51966181-51966203 AAGGAGGAAAGGAAGGAGGGAGG - Intergenic
973555469 4:52077309-52077331 AGGGAGGGAAGGAAGGAGAGAGG - Intronic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
973719763 4:53711497-53711519 GGGCAGGAGAGGAATGAGGGAGG - Intronic
973769745 4:54195481-54195503 ATGGAAGAGAGGAGGAAGAGGGG + Intronic
973814417 4:54605770-54605792 GTGGAGGTGGGGAATGGGAGTGG + Intergenic
974020026 4:56684871-56684893 ATGGTGGAAAGGAAAGAGTGTGG + Intergenic
974020523 4:56688241-56688263 AGGGAGGAAGGGAAGGAGAGAGG + Intergenic
974890598 4:67877714-67877736 CTGGATGTGAGGGATGAGAGAGG - Intronic
975050577 4:69859229-69859251 AAGAAAGAGAGGAAGGAGAGCGG - Intronic
975108728 4:70599592-70599614 ATGGAAGAGAGGAATGTGGTGGG - Exonic
975112792 4:70645600-70645622 AGGGAAGAAAGGAATCAGAGAGG - Exonic
975346759 4:73300590-73300612 GAGGAGAAGAGGAAGGAGAGAGG + Intergenic
975673401 4:76803816-76803838 AGGGAGGAGCGCAGTGAGAGTGG - Intergenic
976116812 4:81736639-81736661 ATGGAGGTGAGGGTGGAGAGAGG - Intronic
976652153 4:87447554-87447576 ATGGAGGTGAGGAAGGGGAAGGG + Intronic
977389951 4:96395576-96395598 AGGGAGGAGAGGATTGGGAGAGG - Intergenic
978420827 4:108531127-108531149 ATGAGGCAGAGGAATGAGGGAGG + Intergenic
978487807 4:109276012-109276034 ATGGAGGAGAAGAGTGAGCAGGG - Intronic
978900812 4:113947531-113947553 AGGGAGGGAAGGAAGGAGAGAGG + Intronic
979663351 4:123284078-123284100 AGGGAGGAGAGAAATGACAAAGG - Intronic
979698541 4:123640925-123640947 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
979960209 4:127009928-127009950 ATGAAGGAGAAGAGAGAGAGCGG + Intergenic
980886937 4:138773146-138773168 ATGGAGGGGAGGAGTGGGAATGG - Intergenic
981081256 4:140641651-140641673 AGGGCGGAGAGGAAGGAAAGTGG + Intronic
981086549 4:140689668-140689690 AGGGAGGGGAGGAAGGAGAAAGG - Intronic
981265614 4:142779761-142779783 AGGGAGGAAAGGAATGAAAGTGG + Intronic
981579746 4:146239465-146239487 TTGGAAGAGAGGAAAGAGATGGG - Intergenic
981700247 4:147600058-147600080 ACTGAGGACAGGAATGAGATTGG + Intergenic
981832162 4:149014844-149014866 GTGGAGGAGAGGAGGGGGAGGGG - Intergenic
982106621 4:152016891-152016913 TTGGAGGAGAAGTAAGAGAGTGG - Intergenic
982275014 4:153629599-153629621 AGGGAGGAGAGGAATTTGAATGG - Intronic
982325128 4:154122158-154122180 ATGAAGGAGGAGAATGAGATGGG - Intergenic
982340569 4:154293678-154293700 CTGGAGGAGAGAAATGAGTTAGG - Intronic
982369909 4:154623704-154623726 CTGAAGAAGAGGAATCAGAGAGG - Intergenic
982866934 4:160525172-160525194 AGGGAGAAAAGGAAAGAGAGAGG - Intergenic
983255901 4:165400300-165400322 ATGGATGAGATGACTGAGGGAGG + Intronic
983265056 4:165499989-165500011 ACAGTGGTGAGGAATGAGAGGGG + Intergenic
983499426 4:168482210-168482232 AAGGTGCAGAGGAAAGAGAGTGG - Intronic
983523718 4:168738273-168738295 GTGGAGGACAAGAATGAAAGAGG + Intronic
983896453 4:173086186-173086208 AGGGAGGAAAGGAATGAAGGAGG - Intergenic
984184703 4:176529743-176529765 AGGGAGGAGAGGATGAAGAGAGG - Intergenic
984668972 4:182460551-182460573 ATGAAGGAGAGACAAGAGAGGGG + Intronic
984684475 4:182650584-182650606 AAGAAGGAGAGAAAGGAGAGAGG - Intronic
984822045 4:183890527-183890549 AAGGAGGGAAGGAAGGAGAGAGG + Intronic
985106969 4:186509433-186509455 AGGGAGGGAAGGAAGGAGAGAGG + Intronic
985265342 4:188151232-188151254 GGTGAGAAGAGGAATGAGAGTGG + Intergenic
985402069 4:189602729-189602751 GTGAAGGAGAGGTATGACAGAGG - Intergenic
985410469 4:189678649-189678671 AGAGTAGAGAGGAATGAGAGGGG - Intergenic
985676994 5:1237304-1237326 ACTGAGGAGAGGAGTGAGAGAGG + Intronic
985957473 5:3276172-3276194 AGGGAGGGGAGGAAGGAGGGGGG + Intergenic
985957522 5:3276315-3276337 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
985957529 5:3276331-3276353 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
985957536 5:3276347-3276369 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
985957564 5:3276427-3276449 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
985958063 5:3279046-3279068 TGGGAGGAGAGGAAGGAGGGAGG - Intergenic
986250017 5:6046685-6046707 ATGGAGGAGAGGAAGGGGTTGGG - Intergenic
986283983 5:6346533-6346555 AAGGAGGAAAGGAAGGAGGGAGG + Intergenic
986299664 5:6467988-6468010 CTGGATGAGAGCAAGGAGAGAGG - Intronic
986356722 5:6935862-6935884 ATGGTGGCGATGAATGAGGGAGG + Intergenic
986772030 5:10983012-10983034 TTGGGAGAGAGGAATAAGAGGGG + Intronic
986879075 5:12147789-12147811 AAGGAGGAAAGGAAGGAGGGAGG - Intergenic
986983944 5:13479550-13479572 TAGGAGGAGAGTAAAGAGAGGGG - Intergenic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
987589149 5:19900234-19900256 GGGGAGGGGAGGAAGGAGAGAGG + Intronic
987932042 5:24414514-24414536 GAGGACGAGAGGATTGAGAGAGG - Intergenic
988158500 5:27487142-27487164 ATGGAGGATAGGAAGGAGGGTGG + Intergenic
988337709 5:29927829-29927851 ATGGTGGAGAGCAGAGAGAGAGG + Intergenic
988805648 5:34738076-34738098 ATGGAATTGAGGAATGAGATGGG + Intronic
989224963 5:39016300-39016322 ACGGAGAAAAGGAAGGAGAGGGG + Intronic
989981927 5:50655719-50655741 AGGGAGGGGAGGAGGGAGAGAGG - Intergenic
990295475 5:54397653-54397675 ATGGAGGAAGGGAAGGAGGGAGG - Intergenic
990328190 5:54698752-54698774 ATGGAGAAGAGGAGAGAAAGGGG + Intergenic
990407275 5:55503912-55503934 AGGGGGGGGAGGAATGGGAGAGG + Intronic
990704634 5:58514834-58514856 ATCATGGAGAGGAATGAAAGCGG + Intergenic
991433590 5:66573381-66573403 AAGGAGGAGAGGAAGGAGGGAGG + Intergenic
991433595 5:66573397-66573419 AGGGAGGAGAGGAAGGAGGGAGG + Intergenic
991557930 5:67916647-67916669 ATGGAAGAGAAGAGTGAGATGGG - Intergenic
991740350 5:69666171-69666193 TTGGACGAGAGGTTTGAGAGGGG - Intergenic
991757148 5:69886996-69887018 TTGGACGAGAGGTTTGAGAGGGG + Intergenic
991791925 5:70245912-70245934 TTGGACGAGAGGTTTGAGAGGGG - Intergenic
991819813 5:70542288-70542310 TTGGACGAGAGGTTTGAGAGGGG - Intergenic
991836551 5:70762878-70762900 TTGGACGAGAGGTTTGAGAGGGG + Intergenic
991884374 5:71246250-71246272 TTGGACGAGAGGTTTGAGAGGGG - Intergenic
992520671 5:77547225-77547247 ATGAAGAAGAGTAGTGAGAGTGG - Intronic
992720598 5:79557239-79557261 AGGGAGGAAAGGAGTGAGGGAGG - Intergenic
992777058 5:80097810-80097832 AGGGAGGAGAGGGAGGAGAGGGG - Intergenic
992955494 5:81904072-81904094 ATAGTGGAGAGGAAGGAGAATGG - Intergenic
992988452 5:82257910-82257932 TTGCAGAAGAGGAATGTGAGTGG + Intronic
993418350 5:87665524-87665546 ATGGAGTTGAGCAATTAGAGTGG - Intergenic
993861903 5:93146499-93146521 ATGGAGCACATGAATGGGAGGGG - Intergenic
993900810 5:93583350-93583372 AGAGAGGAGAGGAGGGAGAGAGG - Exonic
994417339 5:99489137-99489159 ATGGAGGGCAGGAAGGAGAAGGG - Intergenic
994462623 5:100086029-100086051 ATGGAGGGCAGGAAGGAGAAGGG + Intergenic
995093296 5:108206537-108206559 AGGGAGGGGAGGGAGGAGAGAGG - Intronic
995191893 5:109326703-109326725 ATGAAGGAGAGACAGGAGAGAGG + Intergenic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
995616394 5:113969063-113969085 ATGAAGGAGAAGGATGGGAGAGG + Intergenic
996252937 5:121359760-121359782 ATTGTGGAAAGCAATGAGAGGGG - Intergenic
997166966 5:131671534-131671556 ATGGAGGAGAGCAAGAAGATTGG - Exonic
997258676 5:132448798-132448820 AAGCAGGAGAGGGATCAGAGAGG - Intronic
997335501 5:133106268-133106290 ATGGAGGCCAGGACAGAGAGTGG + Exonic
997648724 5:135499112-135499134 ATAGAAGAAAGGAAGGAGAGGGG + Intergenic
998014794 5:138723532-138723554 ATGGAGAAGATGAAAGAGAGGGG + Intronic
998148162 5:139742145-139742167 ATGGGGGAGAGGAGTGTGGGTGG + Intergenic
998170716 5:139870716-139870738 ATCTAGGAGAGGAGTGGGAGGGG - Intronic
998404561 5:141866909-141866931 AAGGAGGAGAGGACTGGCAGTGG - Intronic
998731616 5:145083513-145083535 ATGGAGGAGACTAAGGAGACAGG - Intergenic
998878890 5:146627447-146627469 ATGAGGGTGAAGAATGAGAGTGG + Intronic
998885882 5:146693116-146693138 AGGGAGGGAAGGAAGGAGAGAGG - Intronic
999065267 5:148678811-148678833 ATAGTGGAGAAGAATGAGATGGG - Intergenic
999261168 5:150239791-150239813 AGGGAGCAGAGGAACGACAGGGG + Intronic
999348403 5:150844621-150844643 ATGGAGGAGATGGATGAGAGAGG - Intergenic
999562498 5:152820028-152820050 ATGGAAGTGAGGAGTCAGAGTGG - Intergenic
999642679 5:153687726-153687748 AGGGAGGTGAGGACGGAGAGTGG - Intronic
999881018 5:155863993-155864015 AAGGAGAGGAGGAATGGGAGTGG + Intergenic
1000037366 5:157459772-157459794 GTGGAGGGGAGGAAGGAGAGGGG + Intronic
1000204963 5:159050211-159050233 AGGGAGGAGAGGAGAGAGAGAGG - Intronic
1000204967 5:159050231-159050253 AGGGAGGAGAGGAGAGAGAGAGG - Intronic
1000445346 5:161312236-161312258 AGGGAGTTGAGGAGTGAGAGCGG - Intronic
1000469827 5:161627553-161627575 ATGGAGGAAGGGAATGAGGACGG - Intronic
1000496106 5:161987379-161987401 ATGAGGGAGGGAAATGAGAGAGG + Intergenic
1000984891 5:167855840-167855862 AGGGAGGGAAGGAATGAGGGAGG + Intronic
1000997050 5:167969920-167969942 ATAGTGGAGAGGAAGGAGTGTGG + Intronic
1001055656 5:168447838-168447860 AGAGAGGAAAGGAAAGAGAGAGG - Intronic
1001195121 5:169666185-169666207 ATGGCAGAGAGCAAAGAGAGAGG + Intronic
1001445531 5:171779812-171779834 AGAGAGGAGAGGAAGGAGAGAGG + Intergenic
1001514334 5:172344948-172344970 ATGGAGGAAAGGAAGGAAGGAGG + Intronic
1001560471 5:172665734-172665756 AGGGAGGAGAGGGAGCAGAGGGG - Intronic
1002174375 5:177393280-177393302 TTGGAGGAGAGGAAGGAGCCAGG + Intronic
1002436640 5:179235664-179235686 AGGGCAGAGAGGAAGGAGAGGGG + Intronic
1002742628 5:181444766-181444788 ATGGAGAGGAGAAAGGAGAGGGG + Intergenic
1002773239 6:307262-307284 AGGGAGGGGAGGAAGGAGAAGGG - Intronic
1002823933 6:755565-755587 ACTGACGGGAGGAATGAGAGTGG - Intergenic
1003005604 6:2378193-2378215 AGGGAGGAAAGGAGGGAGAGAGG + Intergenic
1003424573 6:5989522-5989544 AAGGAGGAGGCCAATGAGAGTGG + Intergenic
1003425935 6:5998377-5998399 TTGGAGGATAGGAGGGAGAGAGG - Exonic
1004447396 6:15712637-15712659 GAGGAGGAGAGGATTGAGAAAGG + Intergenic
1004788521 6:18997376-18997398 AGGGAGGAAGGGAAAGAGAGAGG - Intergenic
1004812658 6:19276605-19276627 ATCGAAAAGAGGAAGGAGAGGGG + Intergenic
1004828793 6:19454212-19454234 ATGGAGGAAAAGAAGTAGAGAGG + Intergenic
1005824210 6:29622828-29622850 ATGAGGGAGAGGAGAGAGAGGGG - Intronic
1006006131 6:31003185-31003207 ATGGAAGAGAAGAATTAGAAGGG + Intergenic
1006253262 6:32808188-32808210 TTGGAGGACAGGAATGAGTCTGG + Intergenic
1006410335 6:33870057-33870079 AGAGGGGAGAGGAAGGAGAGGGG + Intergenic
1006443742 6:34067569-34067591 AGGGAGGAAAGGAGGGAGAGAGG - Intronic
1006517642 6:34553665-34553687 CTGGAGAAGAGGAAAGAGAGAGG + Intronic
1006905288 6:37529036-37529058 AAGGAGGTGATGAATGGGAGGGG + Intergenic
1006966596 6:37992363-37992385 ATAGAGGAGAAGAATGATTGTGG - Intronic
1007013278 6:38438193-38438215 AAGGAGGAAAGGAAGGAGGGAGG + Intronic
1007359097 6:41342561-41342583 ATGGGGGAGTGGAAGGACAGGGG - Intronic
1007940744 6:45778893-45778915 AGGGAGGAGAGGAAAGAGTTGGG - Intergenic
1008020389 6:46570723-46570745 ATGCAAGAGAGAAATGGGAGAGG + Intronic
1008156566 6:48022246-48022268 AGGAAGGAGAGAGATGAGAGAGG - Intronic
1008497951 6:52152118-52152140 AGGGAGGGAAGGAGTGAGAGAGG + Intergenic
1008499513 6:52166953-52166975 ATTGAGGAGAGGAAGCAGTGGGG - Intergenic
1008612551 6:53197641-53197663 AAGGAGGGAAGGAATGAGGGAGG + Intergenic
1009029456 6:58038882-58038904 ATCCAGGAGAGAAATGAGGGAGG - Intergenic
1009380317 6:63020206-63020228 CTGGGAGAGAGGAATTAGAGTGG + Intergenic
1009445628 6:63739063-63739085 AAGGAGGGGAGGAAGGAGGGAGG - Intronic
1009823683 6:68839280-68839302 CTGGAGCAGAGGAATGGCAGAGG - Intronic
1009915050 6:69984461-69984483 AGGAAGGAGAGGAAAGAGGGTGG - Intronic
1010144462 6:72650895-72650917 ATGGAGGAGAGGATGGTCAGAGG + Intronic
1010474939 6:76275783-76275805 ATGGAGGAGGGGAAAGGGAAAGG - Intergenic
1010828426 6:80501183-80501205 ATGAGGGAGAGGAGAGAGAGTGG + Intergenic
1011180665 6:84616414-84616436 CTGGAGGAGTGGAAGGACAGAGG + Intergenic
1011635234 6:89366187-89366209 CTTGGGGAGAGGAAGGAGAGAGG + Exonic
1011656278 6:89555010-89555032 AGGGAGGAGAGGATAGAGAGAGG - Intronic
1011761413 6:90569866-90569888 ATAGAGAAGAGGAAGAAGAGTGG - Intronic
1011823432 6:91279038-91279060 ATGGAAGAGAAGAAGGAGAGAGG - Intergenic
1011849503 6:91608664-91608686 ATGTAGAAAAGGAAGGAGAGAGG + Intergenic
1011872566 6:91914522-91914544 ATGGAGAAAATGAATAAGAGTGG + Intergenic
1012174427 6:96062620-96062642 AGGGAGGATAGGATGGAGAGAGG + Intronic
1012323851 6:97888878-97888900 AGGGAGGAAGGGAATGAGGGAGG - Intergenic
1012617110 6:101290894-101290916 AAGGAGGAGAGGTCAGAGAGAGG - Intergenic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1013354391 6:109334641-109334663 ATGGAGGAGAGTAAGGACAGTGG - Intergenic
1014154937 6:118099493-118099515 AGGGAGGAGAAGGAAGAGAGAGG - Intronic
1014561862 6:122900923-122900945 AGGGAGGAAAGGAAGGAGAGAGG - Intergenic
1014726330 6:124976274-124976296 AGGGAGGAAAGGAGAGAGAGCGG - Intronic
1015112468 6:129609085-129609107 ATGGAGGGAAAGAATGAGGGGGG + Intronic
1015402450 6:132801347-132801369 AATGGGGAGAGGAATGAGAATGG - Intergenic
1015756111 6:136608412-136608434 ATGCAGGTGAGCGATGAGAGTGG + Intronic
1015830738 6:137366094-137366116 AGGGAGGAGAGAAAGGAGCGGGG - Intergenic
1015860975 6:137679457-137679479 AAAGAGGAGAGAAGTGAGAGAGG + Intergenic
1016848766 6:148595150-148595172 ATGCTGGAGAGGAAGGACAGTGG - Intergenic
1016871667 6:148824022-148824044 ATAGAGGAAGGAAATGAGAGTGG + Intronic
1017081816 6:150676907-150676929 ATGAAGGAGAGGGAGGAGGGAGG - Intronic
1018176811 6:161184418-161184440 ATGGGGGAGAGGAAGGTGTGTGG + Intronic
1018234528 6:161710983-161711005 ATGGAAGAAAGGAAGGAAAGGGG - Intronic
1018347747 6:162920200-162920222 AGGGAGGAAGGGAATGAGAGAGG + Intronic
1018705667 6:166461790-166461812 ACGGAGGAGAGGAGCTAGAGGGG - Intronic
1019247763 6:170720505-170720527 ATGGAGAGGAGAAAGGAGAGGGG + Intergenic
1019508413 7:1404946-1404968 AGGGAGGAGAGGGAAGAGGGAGG + Intergenic
1019730548 7:2627287-2627309 ATGGAGGAAAGGAGGGAGTGAGG + Intergenic
1019901959 7:4027960-4027982 ATGGAGGAGGGGAGGGAGAGAGG + Intronic
1019963006 7:4476943-4476965 AGGGAGGAGAGGCAGAAGAGAGG + Intergenic
1020558596 7:9700586-9700608 ATGGAGATGAGGAAGGAAAGAGG + Intergenic
1020673512 7:11150511-11150533 AAGAAGGAAAGGAAAGAGAGAGG + Intronic
1020685265 7:11286053-11286075 AAGGAGGAAGGGAAGGAGAGAGG - Intergenic
1020685273 7:11286082-11286104 AAGGAGGAAGGGAAGGAGAGAGG - Intergenic
1021648199 7:22807403-22807425 ATGGAGGAAAGGAAGAGGAGAGG + Intergenic
1022019232 7:26382367-26382389 GTGGAGGAGGGGAGGGAGAGTGG + Intergenic
1022029446 7:26479087-26479109 ATGGGGGAGAGGGAGAAGAGGGG - Intergenic
1022055971 7:26734728-26734750 ATGGCGGAAAGGCAAGAGAGGGG + Intronic
1022279202 7:28889171-28889193 ATAGAAGAAAGGAATGGGAGAGG + Intergenic
1022374671 7:29802432-29802454 ATGGAGGGGAGGACTGAGAAAGG + Intergenic
1022385844 7:29898397-29898419 ATTCAGGTGAGGAATGACAGTGG - Intronic
1022537398 7:31106693-31106715 ATGGAGGAGAGGAGGAGGAGGGG - Exonic
1022617386 7:31945767-31945789 CTGAAGGAGAGGAAAGAGAATGG - Intronic
1022651256 7:32277692-32277714 ATGAAGCTGAGGAATGAAAGAGG - Intronic
1022998631 7:35784804-35784826 ATGGAGGGGCAGAAAGAGAGGGG - Intergenic
1023120748 7:36905808-36905830 ATGGAGAAGAGGAATATCAGTGG + Intronic
1023302914 7:38792830-38792852 GTGGAGGAGAGGGATGTAAGTGG - Intronic
1023340938 7:39218770-39218792 AGGGATAAGAGGAAAGAGAGAGG + Intronic
1023377963 7:39577430-39577452 AGGGAGGTGTGGAGTGAGAGTGG + Intronic
1023427797 7:40057434-40057456 AGGGAGGAGAGTAATGAGCCAGG + Intronic
1023747587 7:43336056-43336078 AGGGAGGGGAAGAAAGAGAGAGG - Intronic
1023761445 7:43468330-43468352 ATGGAGGAGAGAGAGGAGTGAGG + Intronic
1024243587 7:47453471-47453493 TTGGGGGAGAGGAAGGAAAGAGG - Intronic
1024620867 7:51156816-51156838 AAGGGGGAGAGGAAGGAGAAGGG - Intronic
1024760502 7:52591092-52591114 ATTGAGGAGAGGCAGGTGAGAGG - Intergenic
1025320381 7:58088080-58088102 ATGGGAGAGAAGAAGGAGAGCGG + Intergenic
1025615171 7:63112125-63112147 ATGGGGCAGAGGGAAGAGAGAGG - Intergenic
1025872627 7:65449177-65449199 GGGGAGGAGAGGAGGGAGAGGGG - Intergenic
1025957359 7:66193224-66193246 AGGGAGGGAAGGAAGGAGAGAGG + Intergenic
1026155028 7:67818967-67818989 AGGGAGGAGAGGGAGGGGAGGGG - Intergenic
1026362719 7:69617525-69617547 ATTGAGGAGGGGACAGAGAGTGG + Intronic
1026525512 7:71150109-71150131 ATGGTGAACAGGAATGAGAAGGG - Intronic
1026574401 7:71560300-71560322 AAGGAGGAGGAGAATGAGATAGG - Intronic
1026631795 7:72044185-72044207 TTGGAGGAGAGGGGAGAGAGGGG - Intronic
1026961497 7:74410951-74410973 AGGGAGGAAAGGAAGGAGAGAGG + Intergenic
1027522449 7:79226610-79226632 AAGGAGGATAGGAAAGAGAAGGG - Intronic
1027669377 7:81077015-81077037 AAGGAGGACAGGAATAAGACAGG + Intergenic
1027730018 7:81859492-81859514 ATGGAGAAGAGAAAGCAGAGTGG + Intergenic
1028167607 7:87556606-87556628 CTGGAGCAGAGGCAGGAGAGGGG - Intronic
1028425989 7:90689450-90689472 ATGGAGGAGAGGGATAAAAGAGG + Intronic
1028741824 7:94284097-94284119 ATGGAGTAGAGAAATGAAAATGG - Intergenic
1028962633 7:96766700-96766722 ATGGAAGAGGGAAAAGAGAGAGG - Intergenic
1029184450 7:98728675-98728697 AGGGAGGAAAGGAAGGAGGGAGG - Intergenic
1029184493 7:98728815-98728837 AAGGAGGGGAGGAAGAAGAGAGG - Intergenic
1029187249 7:98748122-98748144 AGGGAGGAAAGGAAGGAGAGAGG + Intergenic
1029858531 7:103543919-103543941 TTGGAGGAGGGGAAAGTGAGGGG - Intronic
1030781370 7:113604273-113604295 ATGGGGCAGAGGCATGAGGGAGG + Intergenic
1030790269 7:113717482-113717504 ATGGAGGAGAGTATTGTAAGTGG - Intergenic
1030985810 7:116240480-116240502 ATGGAGGAAAGGGAGGAGCGAGG - Intronic
1031080842 7:117255572-117255594 CTGGAGGAGGAGAAAGAGAGGGG - Intergenic
1031086235 7:117304409-117304431 GTGGAGGAGAGGATTGAAAGGGG - Intronic
1031652328 7:124305569-124305591 ACTCAGGAGAGGAATGAAAGGGG - Intergenic
1031750245 7:125562824-125562846 CTAGAGAAGAGAAATGAGAGAGG + Intergenic
1032479493 7:132235135-132235157 GGGGAGGAGAGGAATGGAAGGGG + Intronic
1032996804 7:137455831-137455853 GTGGAGTTGAGGAATGTGAGAGG - Intronic
1033203404 7:139394342-139394364 ATGGGGAAGATGCATGAGAGGGG - Intronic
1033207503 7:139435594-139435616 TTTGAGGAGAGGATTGGGAGAGG - Intergenic
1033455558 7:141500256-141500278 ATCTAGGAGAGGAATCAGACAGG + Intergenic
1033819350 7:145115338-145115360 ATGGAGGAGAGGGAAGAAAAGGG + Intergenic
1034211343 7:149365726-149365748 AGGGAGGGGAGGAATGGGAGTGG - Intergenic
1034325476 7:150227284-150227306 ATGAAGGAGAGAAATGGGAAAGG - Intergenic
1034375957 7:150644322-150644344 AGGAAGGAGAAGAATGACAGTGG - Intergenic
1034405331 7:150899020-150899042 ATGGAGGAGGGGACAGAGAAGGG + Intergenic
1034466138 7:151230256-151230278 AAGGAGGTGAGTAAAGAGAGAGG + Intergenic
1034995095 7:155572021-155572043 ATGGAGGTGAGGAAGGAGAGGGG + Intergenic
1035226736 7:157438041-157438063 GAGGAGGGGAGGAAAGAGAGGGG - Intergenic
1035500373 8:87431-87453 ATGGAGAGGAGAAAGGAGAGGGG - Intergenic
1035743593 8:1946177-1946199 ATGGAGGAAAGAAATGAGGAGGG + Intronic
1035872275 8:3148789-3148811 TGGGAGGAGAGGCATGTGAGTGG - Intronic
1035898104 8:3426988-3427010 ATGAAGGAGAGGAATGCAGGGGG + Intronic
1035902395 8:3471575-3471597 AGGGAGGGAAGGAAGGAGAGAGG - Intronic
1035902403 8:3471605-3471627 AGGGAGGGAAGGAAGGAGAGAGG - Intronic
1035910972 8:3566130-3566152 ATGGAGGAGAGAAAGAGGAGAGG + Intronic
1035911147 8:3567525-3567547 ATGGGGGAGGGGAAAGAGAAAGG + Intronic
1036279342 8:7386317-7386339 AGGGAGGGAAGGAAGGAGAGAGG - Intergenic
1036279859 8:7391498-7391520 AAGGAGGAAAGGAAGGAGGGAGG - Intergenic
1036341663 8:7920385-7920407 AAGGAGGAAAGGAAGGAGGGAGG + Intergenic
1036342172 8:7925555-7925577 AGGGAGGGAAGGAAGGAGAGAGG + Intergenic
1036398930 8:8391173-8391195 ATGGAAGAAAGGAATTAGATGGG + Intergenic
1036658135 8:10690823-10690845 GAGGAGGAGAGGAATGAGGAGGG - Intronic
1036981250 8:13472337-13472359 TTGGGGGAGGGGAATGAGTGAGG + Intronic
1038914476 8:32005131-32005153 ATGGAAGAGAGGAAGGAAGGAGG + Intronic
1039398356 8:37246863-37246885 ATGGGGGAGAAGAGTGGGAGAGG + Intergenic
1039725878 8:40216046-40216068 AGGAAGGAGAGGGAAGAGAGGGG + Intergenic
1039792978 8:40890583-40890605 GTGGAGGTGAGGTTTGAGAGGGG - Intronic
1039824520 8:41161700-41161722 AAGGAGAAAAGGAAGGAGAGAGG - Intergenic
1039986506 8:42452314-42452336 ATGGAGGAGAAGAAAGAGATAGG + Intronic
1040550091 8:48430920-48430942 AGGGAGCAGAGGAAGGAGATAGG + Intergenic
1040996685 8:53409316-53409338 AGGGAAGAAAGGAAGGAGAGGGG + Intergenic
1041195295 8:55395984-55396006 ATGGAGGAGAGCAGAGAGAGAGG + Intronic
1041345779 8:56896568-56896590 ATGCAGGAAAGGAATGAGAAAGG + Intergenic
1041673076 8:60512297-60512319 AAGGAGGAGAGGAAAGGAAGGGG + Intergenic
1041739775 8:61145821-61145843 ATGGAGAAGAGGCATGCTAGTGG - Intronic
1042036904 8:64542854-64542876 ATGGAGGAGACAGAAGAGAGTGG - Intergenic
1042204220 8:66312253-66312275 AAGTAGGAGAGGAATGAAGGAGG - Intergenic
1042333034 8:67602340-67602362 CTGGAGAAGAGGAATAGGAGGGG + Intronic
1043291522 8:78607624-78607646 TTAGAGGAGAGGAATGAGAATGG - Intergenic
1043366802 8:79542626-79542648 CTTGAGGAGAGGGAAGAGAGGGG + Intergenic
1043438195 8:80254383-80254405 ATAGAGGAGAAGAATGAGGGTGG + Intergenic
1043536220 8:81207348-81207370 TTTGGGGAGAGGAAAGAGAGGGG + Intergenic
1044014162 8:87030843-87030865 AGGGAGGAGAGGGAGGAGAGGGG - Intronic
1044252009 8:90013966-90013988 ATGTAGGAGAGGGATGAGTATGG + Intronic
1045049150 8:98307030-98307052 AGGGAAGAGGAGAATGAGAGAGG - Intergenic
1045488512 8:102653815-102653837 AGGGAGGGGAGGAAAGGGAGTGG + Intronic
1045523506 8:102923533-102923555 ATGGAGGAGATGTATAAGAAAGG - Intronic
1045723103 8:105137401-105137423 ATTGAAGAGAGACATGAGAGCGG - Intronic
1045901764 8:107290250-107290272 ATGAAGGGAAGGAAGGAGAGAGG + Intronic
1045947758 8:107815745-107815767 AAGAAGGAGAGAAATGAGAGAGG + Intergenic
1046153957 8:110263295-110263317 ATGGAAGAAAGGAAGGAGGGAGG - Intergenic
1046562524 8:115855843-115855865 AAGCAGGATAGGAAAGAGAGTGG - Intergenic
1046770298 8:118111351-118111373 ACGGAGGAAAAGAAAGAGAGAGG + Exonic
1046833772 8:118776922-118776944 ATAGAGGAGAGGATTGAGAAGGG + Intergenic
1047014470 8:120709085-120709107 AGGGAGGAAAGGAAGGAGGGAGG + Intronic
1047339886 8:123970769-123970791 ATGGAGGACAGGAATGGGAAGGG + Intronic
1047573858 8:126131739-126131761 ATGGAAGGGAGGAAGGAAAGAGG + Intergenic
1047632671 8:126725452-126725474 CTGGAGAAGAGGCATGAGAATGG - Intergenic
1047636422 8:126768113-126768135 GTGGAGGAGAGAAATGAAATGGG + Intergenic
1047802969 8:128329484-128329506 CTGGAGGAGAGGGATGGAAGGGG + Intergenic
1047806264 8:128363794-128363816 ATGGAGGTGGGGAATGGGTGGGG - Intergenic
1048115536 8:131517691-131517713 AAGAAGGAGAGGAAGCAGAGAGG - Intergenic
1048165633 8:132059178-132059200 ATGGAGGAAAAGAGTGAGGGAGG - Intronic
1048332338 8:133479318-133479340 GTGGAGGAGAGGAGTGGGTGGGG + Intronic
1048362214 8:133707394-133707416 ATGCGGGAGAAGAAAGAGAGTGG + Intergenic
1048500779 8:134973167-134973189 ACGGAGGACAGGGATGAGTGTGG + Intergenic
1048541619 8:135347112-135347134 GGGGAGGGGAGGAAGGAGAGGGG + Intergenic
1048553244 8:135453511-135453533 CTGGTGGAGAGGACAGAGAGTGG + Intergenic
1048574216 8:135678282-135678304 CAGGAGGAGAGGAGGGAGAGAGG - Intergenic
1048827151 8:138439392-138439414 ATGGTGTAGTGGAATGAGAATGG - Intronic
1048865163 8:138755323-138755345 AGGGAGTAGAGGTATGGGAGTGG + Intronic
1048866661 8:138766382-138766404 AGGGGCGAGAGGAATGAGAGAGG + Intronic
1048871216 8:138800847-138800869 ATGGAGGAGAGGAATGGACCTGG + Intronic
1048974968 8:139666139-139666161 AAGCAGGAGAGAACTGAGAGGGG + Intronic
1049124020 8:140769654-140769676 AAGGAGAAGAGGGAAGAGAGGGG + Intronic
1049444932 8:142625563-142625585 ATGGAGGTGATGACTGACAGTGG - Intergenic
1050526199 9:6548972-6548994 ATGGAGGTCGGGAAGGAGAGGGG - Intronic
1050802223 9:9629698-9629720 ATGGAAGAGGGTAAGGAGAGAGG + Intronic
1051139385 9:13962159-13962181 AGGGAAGAGAGGAATGAAAGCGG - Intergenic
1051308352 9:15740785-15740807 AAAAAGAAGAGGAATGAGAGGGG - Intronic
1051688257 9:19681374-19681396 ATGAAGGAGAGAAAAGAGATAGG - Intronic
1052070359 9:24074294-24074316 GTGTAGGTGAGGGATGAGAGAGG - Intergenic
1052174662 9:25443677-25443699 AGGGAGGAAAAGAAGGAGAGAGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052214687 9:25951600-25951622 GTTGAGGAGAGGAAAGAGTGGGG - Intergenic
1052274392 9:26661076-26661098 ATGGAGGAAAGGAGGGAGGGAGG + Intergenic
1052320428 9:27161691-27161713 ACAGAGTAGAGGTATGAGAGTGG + Intronic
1052656267 9:31365535-31365557 ATGAAGGAGGGAAAGGAGAGAGG - Intergenic
1053072801 9:35111177-35111199 GGGGAGGAGAGGAGTGAGAAGGG - Exonic
1053182261 9:35982880-35982902 ATTGAGGAGGGAAATAAGAGGGG - Intergenic
1053920416 9:42984739-42984761 AGGGAGGAGAGGACAGGGAGAGG + Intergenic
1056108134 9:83367912-83367934 ATGGAGGAGAGGAAAAAAAGAGG - Intronic
1056108871 9:83374805-83374827 ATGGAGAAGAAGAATAAAAGAGG + Intronic
1057042161 9:91855708-91855730 ATGGATGAGGGGAATGGGGGTGG + Intronic
1057226506 9:93296027-93296049 ATGGAGGGGATGATGGAGAGGGG - Intronic
1057226585 9:93296247-93296269 ATGGAGGGGACGATGGAGAGGGG - Intronic
1057412008 9:94825127-94825149 ATGGAGGAGAGGAGGGAAATTGG + Intronic
1057757885 9:97852291-97852313 ATGGGGGAGTGGGAAGAGAGCGG - Intergenic
1057763065 9:97891827-97891849 ATGGGGGAGAGGATTGAAGGTGG - Intergenic
1057767427 9:97934423-97934445 ATGGGGGAGAGGAGGGGGAGGGG + Intronic
1057985466 9:99709024-99709046 CTGGAGTAGAGAGATGAGAGAGG - Intergenic
1058425061 9:104868985-104869007 AGGGAGGAGAGGGAAGAGAGGGG + Intronic
1058432471 9:104930871-104930893 AGGTAGGAGAAGAAGGAGAGAGG - Intergenic
1058935091 9:109762864-109762886 GTGGAGGGGAGGAAAGAGATGGG + Intronic
1058963134 9:110010343-110010365 AGGGAGAAGAGGAATGTAAGAGG + Intronic
1059226118 9:112674768-112674790 AAGGAGGAGAGGAAAGAGGGGGG - Intergenic
1059228016 9:112691141-112691163 ATTGAGGCAAGAAATGAGAGTGG + Intronic
1059312236 9:113396562-113396584 ATGGAGGGGATGGATAAGAGGGG + Intronic
1060154530 9:121310020-121310042 AGGAAGGAAAGGAAAGAGAGAGG + Intronic
1060244825 9:121936107-121936129 GTAGATGAGAGGAAGGAGAGAGG + Intronic
1060885337 9:127148324-127148346 ATGGAAGAGAGGAAGGACACAGG + Intronic
1061204326 9:129154390-129154412 AGGAGGGAGAGGAAGGAGAGGGG + Intergenic
1061476935 9:130874157-130874179 CGGGAAGAGCGGAATGAGAGGGG - Intronic
1062100631 9:134726576-134726598 ATGGAGGAGTGGATGGATAGAGG + Intronic
1062144054 9:134979093-134979115 AGGGAGGGGAGGAAGGAGAGAGG + Intergenic
1062266583 9:135689340-135689362 AGAGAGGGGAGGAGTGAGAGTGG - Intergenic
1062703966 9:137924360-137924382 AAGGAGGAGGGGAAAGAGGGAGG - Intronic
1202802099 9_KI270720v1_random:9525-9547 ATGGAAGGAAGGAAGGAGAGAGG - Intergenic
1203446673 Un_GL000219v1:63350-63372 AAGGAGGGAAGGAAGGAGAGAGG - Intergenic
1203608534 Un_KI270748v1:75985-76007 ATGGAGAGGAGAAAGGAGAGGGG + Intergenic
1203661106 Un_KI270753v1:43547-43569 AGAGTAGAGAGGAATGAGAGGGG + Intergenic
1203672290 Un_KI270755v1:26776-26798 AGAGTAGAGAGGAATGAGAGGGG + Intergenic
1185478457 X:429041-429063 ACGGAGGAAAGGAAGGAGGGAGG - Intergenic
1185478467 X:429073-429095 AGGGAGGAAAGGAAGGAGGGAGG - Intergenic
1185545800 X:943153-943175 AGAGAGGAGAGGAAAGAGAGGGG + Intergenic
1185751150 X:2610315-2610337 AGAGAGGAGAGGAGAGAGAGAGG - Intergenic
1185751181 X:2610556-2610578 AGAGAGGAGAGGAGAGAGAGAGG - Intergenic
1185751200 X:2610730-2610752 AAAGAGGAGAGGGAGGAGAGGGG - Intergenic
1185766907 X:2732934-2732956 AGGGAGGAAGGGAAGGAGAGAGG - Intronic
1185772191 X:2773281-2773303 AAGAAGGAGAGGAATGAAGGAGG + Intronic
1185772211 X:2773380-2773402 ACGGAGGGAAGGAAGGAGAGAGG + Intronic
1186200805 X:7153377-7153399 AGGAAGGGAAGGAATGAGAGAGG - Intergenic
1186490804 X:9970554-9970576 AAGGAGGAGAGGAGGGAGGGAGG - Intergenic
1186908744 X:14139037-14139059 AAGGAGGAGAAGAAGGAGAAGGG + Intergenic
1186926791 X:14342508-14342530 AAAAGGGAGAGGAATGAGAGAGG + Intergenic
1187584191 X:20641611-20641633 ATGGAAGATAGCAATAAGAGAGG - Intergenic
1187708999 X:22035300-22035322 ATTGTGGGGAGGAAAGAGAGGGG - Intronic
1187941946 X:24391191-24391213 ATGGAGGACAGGACAGAGAAGGG + Intergenic
1187967131 X:24623077-24623099 ATGGAGGAGAGAGATAAGAAAGG + Intronic
1188254601 X:27945997-27946019 AGGGAGGTGAGGGAAGAGAGAGG - Intergenic
1188572851 X:31610090-31610112 AGGGAGGATAGAAAGGAGAGAGG - Intronic
1188820753 X:34771847-34771869 TTAGGGGAGAGGAATGATAGAGG - Intergenic
1188901758 X:35741316-35741338 AAGGAGGAAGGGAAGGAGAGAGG + Intergenic
1189037492 X:37507215-37507237 CAGGAGGTGAGGAATGGGAGAGG + Intronic
1189063138 X:37776133-37776155 ATGGAGGGAAGGAAAGGGAGTGG + Intronic
1189106163 X:38237895-38237917 ATGTAGGAGAATAGTGAGAGAGG + Intronic
1189110642 X:38286209-38286231 AGGAAGGAGAGGAAGGAGAAGGG - Exonic
1189110660 X:38286269-38286291 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189110675 X:38286320-38286342 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189206012 X:39239418-39239440 ATGGAGGAGTGGCATGGGATGGG + Intergenic
1189242425 X:39535971-39535993 AGGGAGGAGAGACGTGAGAGAGG - Intergenic
1189284482 X:39841556-39841578 AGGAAGGAGAGGAAGAAGAGGGG + Intergenic
1189968881 X:46397929-46397951 ACGGAGCAGACGAATGATAGGGG - Intergenic
1190265228 X:48824071-48824093 ATGGAGCAGAGGAAGGGGATGGG + Intronic
1190325500 X:49204797-49204819 ATGGAGGAAAGGGGAGAGAGCGG - Intergenic
1190596122 X:52053797-52053819 ATGGAGGAGAGAGAGCAGAGAGG - Intronic
1190598066 X:52066209-52066231 AGGGAGGAGAGGAAGGAGATGGG + Intronic
1190610758 X:52187864-52187886 AGGGAGGAGAGGAAGGAGATGGG - Intronic
1190612702 X:52200276-52200298 ATGGAGGAGAGAGAGCAGAGAGG + Intronic
1190775533 X:53549571-53549593 ATGGGGGAGGGGAATGAGCTAGG + Intronic
1191681728 X:63847642-63847664 GTGGAGGAGTGGAATGAGCACGG + Intergenic
1191889660 X:65926978-65927000 CTCAAGGAGAGGAATGAAAGGGG - Intergenic
1192072669 X:67957752-67957774 ATGGAGGAGAATAATGAGCCAGG - Intergenic
1192113327 X:68387397-68387419 ATGGATTATAGGAATGAGAGTGG - Intronic
1192297185 X:69863151-69863173 GTGCAGGAGAGGCAAGAGAGAGG - Intronic
1192718829 X:73670300-73670322 CTCAAGGAGAGGAATGAAAGGGG - Intronic
1192837865 X:74821186-74821208 ATGTTGGAAAGGAATGGGAGAGG - Intronic
1193179317 X:78434896-78434918 ATAGAGGAAAGGAAGGAGTGTGG + Intergenic
1194333369 X:92614347-92614369 AGGGAGGAGAGGAAAGGGAAAGG - Intronic
1195273373 X:103254627-103254649 ATCGAGGTGAGGGAAGAGAGAGG - Exonic
1195458536 X:105097758-105097780 TTAGAGGAGAGGAAGGAGGGAGG - Intronic
1195777834 X:108427233-108427255 AAGGGGAAGAGGAAAGAGAGAGG - Intronic
1195786193 X:108526556-108526578 AGGGAGGAAAGGAAGGAGGGAGG - Intronic
1195978565 X:110554258-110554280 AGGAAGGAGGGGAATGGGAGTGG - Intergenic
1196035073 X:111135114-111135136 ATACAGGTGAGAAATGAGAGTGG + Intronic
1196558386 X:117118772-117118794 ATGGAGGAGATGAGTGAAAACGG - Intergenic
1197146313 X:123176394-123176416 AGGGAGGAGGGGAGTGAGGGAGG - Intergenic
1197765501 X:130057169-130057191 TGGGAGGAGAGGAAGGAAAGGGG - Exonic
1197871468 X:131066336-131066358 ATGGAGGTGAAGAATCAGGGTGG - Intronic
1198000078 X:132424758-132424780 AAGGAGGAAAGGAGGGAGAGAGG - Intronic
1198229156 X:134673234-134673256 ATGGAGGAAAGGAGAGAGGGAGG + Intronic
1198455437 X:136812892-136812914 AGGGAGGAAGGGAATGAGGGAGG + Intergenic
1198672896 X:139100375-139100397 ATGGAGAAAGGGAAAGAGAGAGG + Intronic
1198741552 X:139848426-139848448 ATGGAGCTGAAAAATGAGAGAGG - Intronic
1199396171 X:147341204-147341226 AGGGAGGAAAGGAAGGAGAGAGG - Intergenic
1199928850 X:152497336-152497358 ATGGAGGTGGGGAACTAGAGTGG - Intergenic
1200154981 X:153970488-153970510 AGGGAGGAGGGGAGAGAGAGAGG + Intronic
1200158228 X:153989630-153989652 ATGCAGGAGAGGCATGGGAGGGG - Intergenic
1200232632 X:154451630-154451652 AAAGAGGAAAGGAAGGAGAGGGG - Intergenic
1200338020 X:155372689-155372711 AGGGAAGAGAGGAGAGAGAGAGG + Intergenic
1200348449 X:155468005-155468027 AGGGAAGAGAGGAGAGAGAGAGG - Intergenic
1200642053 Y:5733353-5733375 AGGGAGGAGAGGAAAGGGAAAGG - Intronic
1201298445 Y:12485752-12485774 AAGGAGGGAAGGAAGGAGAGAGG - Intergenic
1201741016 Y:17325018-17325040 AGGGAGGAAAGGAAGGAGGGAGG + Intergenic
1201741183 Y:17325905-17325927 AGGGAGGAAAGGAAGGAGGGAGG + Intergenic
1201741210 Y:17326069-17326091 AGGGAGGAAAGGAAGGAGAGAGG + Intergenic