ID: 1086222881

View in Genome Browser
Species Human (GRCh38)
Location 11:84471128-84471150
Sequence CTGGCAACCCAGATGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086222876_1086222881 -4 Left 1086222876 11:84471109-84471131 CCCATCAGCTAGTAACATTCTGG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1086222881 11:84471128-84471150 CTGGCAACCCAGATGGAACTGGG 0: 1
1: 0
2: 0
3: 16
4: 172
1086222878_1086222881 -5 Left 1086222878 11:84471110-84471132 CCATCAGCTAGTAACATTCTGGC 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1086222881 11:84471128-84471150 CTGGCAACCCAGATGGAACTGGG 0: 1
1: 0
2: 0
3: 16
4: 172
1086222875_1086222881 3 Left 1086222875 11:84471102-84471124 CCAAGAACCCATCAGCTAGTAAC 0: 1
1: 0
2: 0
3: 2
4: 124
Right 1086222881 11:84471128-84471150 CTGGCAACCCAGATGGAACTGGG 0: 1
1: 0
2: 0
3: 16
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086222881 Original CRISPR CTGGCAACCCAGATGGAACT GGG Intronic
900715799 1:4142688-4142710 CTGGCAGCCAGGATGGAAATGGG - Intergenic
901390976 1:8945912-8945934 CTGGCCACCCAGCAGGAACAGGG - Exonic
903274684 1:22212971-22212993 CTGGAATCCCACCTGGAACTCGG - Intergenic
904407600 1:30303244-30303266 CTGGCATCCCAGCTGCCACTTGG - Intergenic
905127939 1:35729044-35729066 TTGGAAAACCAGATGGACCTAGG - Intronic
905868943 1:41391951-41391973 GTGGAAACCCAGATGGGAGTTGG - Intergenic
905879292 1:41453192-41453214 CTGGTAACCCAGATCTATCTGGG + Intergenic
906461227 1:46036154-46036176 CGGTCAACCCACATGTAACTAGG + Intergenic
910586923 1:88890972-88890994 TTGGTAAGCCAGATGGAACCTGG - Intronic
910937603 1:92497892-92497914 TTGGCATCCCAGATGTAACTTGG - Intergenic
913281987 1:117194714-117194736 GTGGTAACACAGATGGAACCTGG + Intronic
916011411 1:160709479-160709501 CATGGAACCCAGATAGAACTAGG + Intronic
916202403 1:162284428-162284450 CTGGCAGCCGTGATGGAACCTGG + Intronic
917596145 1:176531181-176531203 CAGGCAAGCCAGATCCAACTTGG + Intronic
920336910 1:205251003-205251025 CTGGCACCCCAGAGGGGACTGGG - Intronic
920934847 1:210422548-210422570 GAGGCAACAAAGATGGAACTGGG - Intronic
922187027 1:223284703-223284725 ATGGCAACGTGGATGGAACTGGG + Intronic
922287235 1:224181088-224181110 CTGCCAATCCAGATGAAACTTGG + Intronic
922289491 1:224198655-224198677 CTGCCAATCCAGATGAAACTTGG - Intergenic
922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG + Intronic
923106598 1:230858624-230858646 CTGGCCACCCAAATGGAAAGAGG + Intronic
924069357 1:240260046-240260068 ACAGCAACCTAGATGGAACTGGG - Intronic
1064651073 10:17510377-17510399 CTCACAACCCACAAGGAACTTGG + Intergenic
1066208209 10:33210518-33210540 ATGAAAACCCATATGGAACTAGG + Intronic
1071568831 10:86685420-86685442 CTGGCAAAGCAGAGGGCACTGGG + Intronic
1072051220 10:91705474-91705496 CTGTCAACCCAGATGGAGTAGGG - Intergenic
1074629987 10:115242236-115242258 ATGGAAACCCAGATGTATCTGGG + Intronic
1075983947 10:126767067-126767089 CTGGCATCCCAGGTGCCACTGGG + Intergenic
1076190505 10:128479924-128479946 CTGGCGATCCAGATGGAAGCAGG - Intergenic
1081739172 11:45426083-45426105 CATGAAACCCAGCTGGAACTGGG - Intergenic
1083132259 11:60635807-60635829 CTGACAATCCAGAAGGAATTGGG + Intergenic
1086222881 11:84471128-84471150 CTGGCAACCCAGATGGAACTGGG + Intronic
1086835549 11:91617117-91617139 GTGACAACACGGATGGAACTGGG - Intergenic
1087192524 11:95270045-95270067 CTGACAAACCTGATGGAACTGGG + Intergenic
1087429608 11:98036046-98036068 GTGGCAACCTGGATGGAACTGGG + Intergenic
1089708125 11:120295438-120295460 CTGCCATCCCAGAGGGTACTGGG - Intronic
1091891522 12:4058710-4058732 CTGGCAACCTTGGTGGACCTTGG + Intergenic
1094092237 12:26663039-26663061 CAGGGAACCCAGATGGATCTAGG - Intronic
1097132588 12:56823565-56823587 GTGGAAAAGCAGATGGAACTTGG - Intergenic
1097340537 12:58432559-58432581 CTGACAACCGGGAAGGAACTTGG - Intergenic
1098151903 12:67555731-67555753 CTGGCATTCCAGGTGGCACTAGG + Intergenic
1098620592 12:72593145-72593167 CTGGCAACCAAAAATGAACTTGG - Intronic
1098713843 12:73802983-73803005 GTAACAACACAGATGGAACTTGG - Intergenic
1101923426 12:108951788-108951810 TTGGCAAACCAGTTGCAACTGGG - Intronic
1103359679 12:120346323-120346345 CTGGCAACCCAGAAAGAAGACGG + Intronic
1108038659 13:46319052-46319074 GTGGCAACATAGGTGGAACTGGG + Intergenic
1111008451 13:82281114-82281136 CTGCTAAGCCAGATGGACCTTGG + Intergenic
1115343496 14:32317719-32317741 CTGGCAAACCAGATGGTGCCTGG - Intergenic
1125892646 15:43277753-43277775 CTGACCACCCAGATCGTACTAGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1130423155 15:83768566-83768588 CTGGGAACGTAGAAGGAACTAGG + Intronic
1132012341 15:98287106-98287128 CTGAGAATCCAGAGGGAACTGGG - Intergenic
1132559629 16:587465-587487 CAGGGAACCCAGATGGGTCTAGG - Intergenic
1135173842 16:20210548-20210570 CCGACAACACAAATGGAACTTGG - Intergenic
1135250931 16:20900550-20900572 CTAGCAACCCGGAGGGAGCTGGG + Intronic
1136072106 16:27793760-27793782 CTGGCTACCCAGGAGGCACTTGG + Intronic
1137882263 16:52062381-52062403 CTGGCAATGCAGATGGAAGAAGG - Intronic
1139468847 16:67167644-67167666 CTGGCAGCCCAGATGGCTGTAGG + Intronic
1140529429 16:75650873-75650895 TTGGCAAGCCATTTGGAACTTGG + Intronic
1142405004 16:89883614-89883636 CAGGTAACCAAAATGGAACTCGG - Intronic
1142600490 17:1051346-1051368 CTGGGAACCCAGCTGGCACACGG + Intronic
1144731591 17:17529242-17529264 CTGGCAGGACAGGTGGAACTGGG - Intronic
1145051128 17:19662058-19662080 GTGGCAGCCCAGATTGAATTGGG + Intronic
1146272928 17:31496400-31496422 CTCTTAACCCAGATGGAACGGGG - Intronic
1146487227 17:33252945-33252967 CTGGGAATCCAGGTGGATCTGGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1151207046 17:72515489-72515511 CTTGGAAACCAGATGGAAATAGG - Intergenic
1151603161 17:75118972-75118994 CTGGGAACCCAGCTGGCACCAGG + Intronic
1152477066 17:80525455-80525477 CTGGCTTCCAAGATGGCACTTGG - Intergenic
1152895730 17:82910058-82910080 CTGGAAACCCAGATGAGCCTGGG - Intronic
1153425210 18:4955195-4955217 CTTACAAGCCAGAAGGAACTGGG + Intergenic
1153937400 18:9941303-9941325 CTAACAACCCAGATGGAGTTGGG - Intronic
1155307278 18:24490735-24490757 TTGACAACCCAGATGGAATGTGG + Intergenic
1157809369 18:50683795-50683817 CTGGCAACACAGCTGGATGTAGG + Intronic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1163011445 19:14429084-14429106 CTGCCTCCCCAGATGGAGCTGGG - Intergenic
1163491543 19:17619840-17619862 CTGACAAGCCAGATGGGCCTGGG + Intronic
1163669887 19:18621147-18621169 CTGGAAACCCAGGTGGCACCAGG + Intergenic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1167043705 19:47038014-47038036 GTGGCAACCCAGATGGGGCAGGG + Intronic
1167188777 19:47967831-47967853 CAAGCAACACAGATGGAAGTAGG - Intergenic
1167866365 19:52331886-52331908 CTTGTAACCCACATGGACCTAGG - Intergenic
1168374955 19:55869133-55869155 AGGGGAACCCAGATGGAAGTTGG + Intronic
926621557 2:15050749-15050771 GTGGAAACCCAGATGGAACCCGG - Intergenic
928587221 2:32772827-32772849 CTGAAAACCCAGAGGGGACTGGG - Intronic
929709378 2:44250718-44250740 ATGGGAACCCAGACAGAACTGGG + Intergenic
931480359 2:62633405-62633427 CTGGCATCCCAGGTGCCACTGGG - Intergenic
931973461 2:67616174-67616196 CTGGGAACTCAGAAGGAACTAGG + Intergenic
933932219 2:87164623-87164645 CTGTCAACCCACTTGGAATTTGG - Intergenic
934984164 2:98872016-98872038 CCAGCAACACAGATGGAGCTGGG + Intronic
936360894 2:111800810-111800832 CTGTCAACCCACTTGGAATTTGG + Exonic
936577962 2:113671122-113671144 ATGGCAACCAAGATGTAGCTAGG + Intergenic
937740269 2:125343940-125343962 CTGGCAACAGGGATGTAACTGGG + Intergenic
942898721 2:181089338-181089360 CTGGCATTCCAGATGCCACTGGG - Intergenic
943319941 2:186433780-186433802 CTAGAAAGCCTGATGGAACTTGG + Intergenic
943785287 2:191870987-191871009 CTGAAAACAGAGATGGAACTGGG + Intergenic
948256882 2:236574859-236574881 CTCACAGCCCAGATGGTACTGGG - Intronic
1170800236 20:19584515-19584537 CTGGCCACACTGAGGGAACTGGG + Intronic
1171064608 20:22002324-22002346 CTTGCAACACAGAAGGATCTCGG - Intergenic
1172241993 20:33419237-33419259 CTAGCAAGCCAGATGGCCCTGGG - Intronic
1173726039 20:45298390-45298412 GTAGCGACCCAGAGGGAACTCGG + Exonic
1174497120 20:50955231-50955253 ATGGAAGCCCAGATGGAACAAGG - Exonic
1175265192 20:57698695-57698717 CTGGGAACCCTGCAGGAACTTGG - Intronic
1177184222 21:17775763-17775785 CTGGCATTCCAGATGCCACTGGG + Intergenic
1179711981 21:43268777-43268799 CTGGCAACTCAGCTGGAAATGGG - Intergenic
1180103195 21:45599508-45599530 ATGGCAGCCCAGAGGGAACAAGG - Intergenic
1182733248 22:32512166-32512188 CTGGGAACCTGGATGGATCTTGG + Intergenic
951366187 3:21785929-21785951 CTGGCAACCAAGCTTGACCTTGG + Intronic
952918872 3:38270871-38270893 CTGGCATTGCAGTTGGAACTTGG + Intronic
953406765 3:42663631-42663653 CTGCCCACCCAGATGCACCTCGG + Intronic
953790887 3:45947055-45947077 CTTGCCACCCAGATGACACTGGG + Exonic
954014008 3:47669871-47669893 CTGGGAACCCAGAGGGCACCAGG + Intronic
954869401 3:53756341-53756363 CTGCCAACCCAGAGGGAGGTGGG + Intronic
958069290 3:88588894-88588916 CAGTAAACCCAGATTGAACTGGG + Intergenic
959258273 3:104042497-104042519 CTGGAAACCCAGATAGGAATTGG - Intergenic
959605878 3:108241652-108241674 CTGGTGACCCAGATGGAATTGGG + Intergenic
960611656 3:119560152-119560174 GTGGCAACCTAGTTGGAAATGGG - Intergenic
961210130 3:125119270-125119292 CTGGCAACCTAGAGGCAACTGGG - Intronic
964305242 3:155332663-155332685 CTGGCACAGCAGATGCAACTGGG - Intergenic
965291165 3:166882871-166882893 CTTACAAGCCAGAAGGAACTGGG + Intergenic
967525370 3:190486659-190486681 CTAGCAGCACAGATGGCACTGGG + Intergenic
968840566 4:3002205-3002227 CTGGCAACTAGGATGTAACTGGG + Intronic
970114986 4:12684869-12684891 CTGGCAAGCAATATGGAACAAGG + Intergenic
975723623 4:77271419-77271441 CTGGCAACTCAAATGCCACTTGG + Intronic
977088764 4:92641928-92641950 GTGGCAAACTAGATGGAGCTAGG - Intronic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
977683621 4:99822630-99822652 CTGACAAACCAGATGGGTCTTGG - Intronic
981131549 4:141162923-141162945 CTGGCATTCCAGATGCCACTAGG - Intronic
981748079 4:148069746-148069768 CTGGCTACCTAGATGCATCTGGG - Intronic
984160018 4:176240902-176240924 CTGCCAACCCAGATCCAAGTAGG - Intronic
984700198 4:182814174-182814196 CTAGCTGCCCAGATGGAAGTAGG + Intergenic
984748372 4:183245991-183246013 CTGGCACCCCAGAATCAACTGGG - Intronic
984857566 4:184208064-184208086 CTGGAAACCCAACTTGAACTGGG + Intronic
986308838 5:6536231-6536253 AAGGCAACCAAGATGGTACTGGG + Intergenic
986516616 5:8571336-8571358 CTGACATCCCCGATGGAACCTGG + Intergenic
990652494 5:57917869-57917891 ATGGCAACATGGATGGAACTGGG - Intergenic
995894286 5:116994521-116994543 CTGGGGACCCAGATAGACCTGGG - Intergenic
997193688 5:131963196-131963218 CTGACATGCCAGATGGCACTAGG + Intronic
1003494334 6:6651015-6651037 GTGGCAACATGGATGGAACTGGG - Intronic
1003670535 6:8153800-8153822 GTGGCAAGCAACATGGAACTGGG + Intergenic
1003711323 6:8594023-8594045 GCAGCAACACAGATGGAACTGGG + Intergenic
1005286505 6:24333243-24333265 CTGGGAACCTGGATGGAACTTGG - Intronic
1006177064 6:32128801-32128823 CGGGCAGCCCAGGAGGAACTGGG - Exonic
1006359228 6:33578180-33578202 CTGGCCAGCCAGAGGGAAGTAGG - Intronic
1006486911 6:34350308-34350330 CTGGTACCCCAGATGGCACCAGG + Intronic
1007136619 6:39528256-39528278 GTGACAACATAGATGGAACTGGG - Intronic
1007717320 6:43864832-43864854 ATGGTAACTCAGGTGGAACTGGG + Intergenic
1008832041 6:55776793-55776815 CTGGCAACCCAAAGGAAACTTGG - Intronic
1011006838 6:82654930-82654952 TTGGGAACCAAGATGGAATTTGG - Intergenic
1012599222 6:101073554-101073576 CTGGCAAGTCAGATGGAGATAGG - Intergenic
1014068739 6:117156918-117156940 TTGGCCACCCAGCTGGGACTTGG - Intergenic
1014421187 6:121247136-121247158 CTTACAAGCCAGAAGGAACTGGG + Intronic
1017760817 6:157566740-157566762 CTAGTGACCCAGATGGGACTGGG - Intronic
1019067792 6:169317013-169317035 GTGGAAAGCCAGATGGAATTTGG - Intergenic
1020358307 7:7301328-7301350 CTGGCATTCCAGATGCCACTGGG + Intergenic
1022972136 7:35528151-35528173 CTGGAGGCCCAGCTGGAACTGGG - Intergenic
1024255990 7:47540373-47540395 TTGGAAACCCAGCTGGAACTAGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1027976716 7:85166671-85166693 ATGGGAACCCAGGTGGGACTAGG + Intronic
1029259999 7:99295485-99295507 CTGGCAACTCAGTTTGAACCAGG - Intergenic
1031105493 7:117536991-117537013 TTGGTAACTCACATGGAACTGGG + Intronic
1034328294 7:150258173-150258195 CTGGCAACTGAGCAGGAACTTGG - Intronic
1034764922 7:153711291-153711313 CTGGCAACTGAGCAGGAACTTGG + Intergenic
1035478340 7:159159502-159159524 CTGTCTTTCCAGATGGAACTGGG - Intergenic
1035645302 8:1214248-1214270 CAACCAACCCAGGTGGAACTGGG + Intergenic
1036993253 8:13624858-13624880 AGGGCAACCCTGATGGAAATTGG + Intergenic
1038157859 8:25007764-25007786 CTTCCAACACAGAGGGAACTTGG - Intergenic
1038455129 8:27667938-27667960 CTGAGAACCCAGATGGGAGTGGG - Intronic
1039246958 8:35619609-35619631 CTGGTAATCCAGTTGCAACTGGG + Intronic
1041050780 8:53932247-53932269 CTGGCATTCCAGGTGAAACTGGG - Intronic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044906233 8:97006736-97006758 CTGGCAACCCAGGAGGACCCAGG + Intronic
1051403872 9:16713181-16713203 ATGGAAACCCAAATGGAAATGGG + Intronic
1051817095 9:21121074-21121096 CTTGGAACCCAGGAGGAACTAGG - Intergenic
1052766317 9:32644790-32644812 CTGGCAAATTAGATGGAGCTGGG + Intergenic
1057134308 9:92676436-92676458 ATGCCCAGCCAGATGGAACTGGG + Intergenic
1059958809 9:119545319-119545341 CTCCCAACCCAGAGGCAACTCGG + Intergenic
1062312170 9:135944756-135944778 GTGGCAACACAGAGGAAACTGGG + Intronic
1062328283 9:136023171-136023193 CTGGAAACCCGGATGGAAAGGGG + Intronic
1186781773 X:12919454-12919476 CTGGCAAACCAGAGGGTATTTGG - Exonic
1186813821 X:13216208-13216230 CTGGCTACCTAGATGAAACGAGG - Intergenic
1188895136 X:35658640-35658662 TTTTCAACCCAGATGGACCTGGG + Intergenic
1191836821 X:65472139-65472161 CTTACAAGCCAGAAGGAACTGGG - Intronic
1192023886 X:67427379-67427401 CTGGCATCCCAGATGCCACTGGG + Intergenic
1192740995 X:73892650-73892672 CTGGCATTCCAGATGCCACTGGG - Intergenic
1193148066 X:78097775-78097797 GTGGCAAGCTACATGGAACTAGG + Intronic
1193622370 X:83771914-83771936 TCTGCAACCCAGATGGACCTGGG + Intergenic
1194697545 X:97073237-97073259 CTGTCAGGCCAGATGAAACTTGG + Intronic
1197157195 X:123283364-123283386 CTGGCATTCCAGATGCCACTGGG - Intronic