ID: 1086224359

View in Genome Browser
Species Human (GRCh38)
Location 11:84489780-84489802
Sequence TTGAATATGGATGATTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086224359_1086224362 22 Left 1086224359 11:84489780-84489802 CCTTCCTAATCATCCATATTCAA 0: 1
1: 0
2: 0
3: 26
4: 208
Right 1086224362 11:84489825-84489847 TCATATATTCTATCATGTCTTGG 0: 1
1: 0
2: 0
3: 26
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086224359 Original CRISPR TTGAATATGGATGATTAGGA AGG (reversed) Intronic
901337981 1:8467938-8467960 TTGAAAATGGATGTTTGGGCCGG - Intronic
901780324 1:11590038-11590060 TTGACTACGGAGGATCAGGAGGG - Intergenic
901784505 1:11615900-11615922 TAAAATATGGATGATGATGATGG - Intergenic
907962922 1:59299238-59299260 TGGCACATGGTTGATTAGGATGG + Intronic
908947999 1:69523253-69523275 CTGAATGTGGGTGATTATGAAGG + Intergenic
908952934 1:69584041-69584063 ATGAATATGGCTCATTAGGATGG + Intronic
910269871 1:85382560-85382582 ATGAATATGGTTGATGAAGATGG + Intronic
910972992 1:92875356-92875378 TTGAATAGTAATGATTTGGAGGG - Intronic
911483548 1:98476052-98476074 TTGACTATGAATTATTGGGAAGG - Intergenic
911532094 1:99055606-99055628 TTGAATATGGCAGAATATGAAGG + Intergenic
912832772 1:112968464-112968486 TTGAATTTGGATGCCTAGAAGGG - Intergenic
913270089 1:117084666-117084688 TTGAAGAGGGATGCTCAGGAAGG + Intronic
913360160 1:117971620-117971642 ATGAATAATGATGACTAGGAGGG + Intronic
915072426 1:153281617-153281639 TTGGATGTGGATGAAGAGGAAGG + Intergenic
915710043 1:157887522-157887544 TTGAATAAGAATGATTAGGGTGG - Intronic
916141712 1:161705656-161705678 TTGAATATGGGTGCTGGGGAAGG - Intergenic
920224609 1:204429464-204429486 TTGCATATGGACAAATAGGAAGG + Intronic
923312570 1:232749104-232749126 TTGAATATGGCTAATTAGGCGGG - Intergenic
924133435 1:240937101-240937123 TTGAATATGGCTAATTAGGTGGG - Intronic
1062961602 10:1576798-1576820 TTGAAGGTGGAGGATGAGGAGGG + Intronic
1063326366 10:5107470-5107492 CTGAATATGGATAATTAGGGTGG - Exonic
1063336335 10:5218727-5218749 CTGAAAATGGATAATCAGGATGG - Exonic
1063666455 10:8063514-8063536 TTAAATAATGAAGATTAGGATGG - Intronic
1064520616 10:16197084-16197106 TTGAATATGGCTAATTAGGCGGG - Intergenic
1064898760 10:20270471-20270493 TTGAATATGTAGGATGAAGAAGG + Intronic
1068262123 10:54596070-54596092 TTGAATATTGGTGGTTAGGTTGG - Intronic
1072195516 10:93114566-93114588 TTGAAAATGGAAGGTGAGGAGGG + Intergenic
1073906908 10:108292606-108292628 TTGACTATGAATGATTGTGAAGG - Intergenic
1076577659 10:131480829-131480851 TTAAATAGGGATGATGAGAAAGG + Intergenic
1078491696 11:11775359-11775381 TGGAAGATGGTAGATTAGGAAGG + Intergenic
1078525590 11:12098654-12098676 TGGAATATAGATCATTAAGAGGG + Intronic
1078585003 11:12577377-12577399 TTGAAAATGGAGCAATAGGAAGG - Intergenic
1079531934 11:21464643-21464665 TTAAATATGGATGTTGAGGCTGG + Intronic
1079932617 11:26583998-26584020 TTTAATATGGTTGATTAGAAGGG - Intronic
1082202271 11:49386411-49386433 TTGAATGTGGCTGAATAGAATGG - Intergenic
1084449604 11:69228223-69228245 TGGAATAATGATGATGAGGATGG + Intergenic
1086224359 11:84489780-84489802 TTGAATATGGATGATTAGGAAGG - Intronic
1086653400 11:89319731-89319753 TTGAATGTGGCTGAATAGAATGG + Intergenic
1087707854 11:101515134-101515156 TTGAATAATTATGATTAAGAAGG - Intronic
1088548875 11:110990111-110990133 TTGTAAATGGAAGAATAGGAGGG + Intergenic
1091415843 12:283117-283139 TAGTTAATGGATGATTAGGAAGG + Exonic
1092721779 12:11448315-11448337 ATAAATATAGATGATAAGGATGG + Intronic
1092838735 12:12517618-12517640 TTGCTTTTGGATGATTGGGAAGG + Intronic
1093256967 12:16880736-16880758 TAGATTATGGAAGTTTAGGAGGG + Intergenic
1097509371 12:60517736-60517758 TTGAATATGGTTAACTAGGCAGG - Intergenic
1097877916 12:64660850-64660872 TTGAATTTGGAGGATTTGGCGGG + Intronic
1098354186 12:69595021-69595043 TTGAAAATGAATGAATAGGTTGG + Intronic
1100056864 12:90522806-90522828 TTGAATATGGACGAGAAGGGAGG + Intergenic
1101699019 12:107154181-107154203 TTGAATGTGGAGAATGAGGATGG - Intergenic
1102063348 12:109952219-109952241 TTGAGAATGGATGAATAGGAAGG - Intronic
1105748461 13:23399514-23399536 TTGAATATGGCTAATTAGGTGGG - Intronic
1106791570 13:33160960-33160982 TTGAATATGAATGTTTAGAGTGG + Intronic
1106823022 13:33487636-33487658 TTGAACAAGGAAGATTATGAAGG - Intergenic
1107005533 13:35605553-35605575 TTGAAAAAAGATGATCAGGATGG + Intronic
1107105001 13:36633594-36633616 TTCAATATGAATTATTATGAAGG - Intergenic
1110776530 13:79414109-79414131 TTGAAACTGGATGATGGGGATGG + Intergenic
1110957456 13:81573327-81573349 TTCAATATGACTGATAAGGATGG + Intergenic
1111224820 13:85255447-85255469 TTGAAGATGGAGGCTTTGGAAGG + Intergenic
1112336062 13:98517169-98517191 TTTAATATGAATTATTATGATGG - Intronic
1113004483 13:105683634-105683656 TTGAATATGGATTCAGAGGATGG + Intergenic
1114133161 14:19816732-19816754 TTGAATAAGGATGGTGAGAAAGG + Intronic
1115540948 14:34420899-34420921 TTGAATAGGGCTAATTAGGCAGG + Intronic
1116348628 14:43829601-43829623 TTGAATATGAATGGTGAAGAAGG + Intergenic
1116657402 14:47669963-47669985 TTGAATCTGGATGGATAGGAAGG - Intronic
1119177558 14:72580367-72580389 ATGAATATGGATGCCAAGGATGG - Intergenic
1119989252 14:79176682-79176704 TTGAACATGAATGGGTAGGAGGG - Intronic
1121261024 14:92566262-92566284 TTGAAGATGGAGGAATAGAAGGG - Intronic
1121991752 14:98564455-98564477 TTAAAGATGGATGGTTTGGAAGG - Intergenic
1122531246 14:102428814-102428836 TTGAACTTGGAGGATTTGGAGGG + Intronic
1123817574 15:23995407-23995429 TTGAATATGGTTAATTAGGCAGG + Intergenic
1126879586 15:53080162-53080184 TTGTTTAGGAATGATTAGGAAGG - Intergenic
1128838036 15:70827192-70827214 TTGAATACGGGAGATTTGGAAGG + Intergenic
1130288317 15:82573494-82573516 TTAAATATGGATGTTTTTGAAGG - Intronic
1132192980 15:99885006-99885028 TTGAAGATGGAAGATGGGGAAGG - Intergenic
1134802739 16:17100340-17100362 TTAAAAATGGGTGATTAGGAGGG - Intergenic
1136129954 16:28213391-28213413 TTGAATAGGAATGATGAGAAAGG + Intergenic
1137973814 16:53012995-53013017 TAGAATATATATAATTAGGAGGG + Intergenic
1138798384 16:59996768-59996790 TTGAAAATGGAATATTAGCATGG - Intergenic
1139158339 16:64471860-64471882 TTCAAAATGGATAATTGGGATGG - Intergenic
1140747240 16:77991900-77991922 TTGAATATGGCTAATTAGATGGG - Intergenic
1141332671 16:83126377-83126399 TTGAATATGGCTAATTAGGCAGG + Intronic
1144159956 17:12548183-12548205 TGGAGTATGGTTGATGAGGAGGG + Intergenic
1144237203 17:13273014-13273036 ATGAATATGGAGGATCAAGATGG - Intergenic
1146130884 17:30274037-30274059 TTCAATATGGAAGATAAGGTTGG - Exonic
1146987355 17:37232916-37232938 TTGAGTTTGGGTGAATAGGATGG - Intronic
1150998627 17:70348306-70348328 TTGATTATCATTGATTAGGATGG + Intergenic
1153910254 18:9700469-9700491 TTGCATATAGAGGATAAGGAAGG - Intergenic
1154343915 18:13526962-13526984 ATGAATATAGATGATCTGGATGG + Intronic
1155651080 18:28142643-28142665 TTGGATATTGATGATTAAGGAGG - Intronic
1156681438 18:39593605-39593627 TTAACTATGGCTGATTAGCAAGG + Intergenic
1156856415 18:41786849-41786871 TTGGATATGAATTATTGGGAGGG + Intergenic
1156999522 18:43508453-43508475 TTGAATATGGCTAATTAGGTGGG + Intergenic
1157350237 18:46877605-46877627 TTGAATATGAATAATTAGGTAGG - Intronic
1157913593 18:51642173-51642195 TTGAATCTGGAGTATTGGGAGGG - Intergenic
1158115645 18:53992384-53992406 TTAAAGCTGGATCATTAGGAGGG - Intergenic
1158238511 18:55348776-55348798 TTGAATATGAAGCATAAGGAGGG + Intronic
1158268808 18:55689932-55689954 TGGAATAAAGATGATTAGAAAGG + Intergenic
1160107532 18:75992098-75992120 GGGAAAATGGATGATTAGAATGG - Intergenic
1160332197 18:78004258-78004280 TTTAATATGGAAGATTAGAATGG + Intergenic
1160368248 18:78348226-78348248 TTTAATATTGGAGATTAGGATGG - Intergenic
1166285009 19:41820226-41820248 TTGAATAAGGATGATGAGAGTGG + Intergenic
1167394591 19:49219799-49219821 TTGAATATCTAGGATTGGGATGG + Intergenic
925089324 2:1141061-1141083 TTCAAAATAGATGATTTGGAAGG - Intronic
927388662 2:22567287-22567309 TTGCATATGGCTGCTCAGGAAGG - Intergenic
927791550 2:26013967-26013989 TTGAATTTGGATGTATTGGAGGG + Intergenic
929241858 2:39661823-39661845 TAGAATATGCATGGTTAGGATGG + Intergenic
930007248 2:46907868-46907890 TTCAAAATGCATGATTATGATGG - Exonic
931749270 2:65316644-65316666 TGGAATTTGGCTGAATAGGAGGG + Intronic
932293613 2:70606282-70606304 TTGAATGTGGAGGAATAAGAGGG + Intergenic
936265462 2:111001884-111001906 ATCATTAAGGATGATTAGGATGG + Intronic
937400324 2:121577161-121577183 TTGAAGCTGGATGATGAGTATGG + Intronic
938908657 2:135864168-135864190 TTGAGTATGGAAGACAAGGATGG + Intronic
942866031 2:180675998-180676020 TTGAATATTGATCAATAGTATGG + Intergenic
943742512 2:191425891-191425913 TTGAGGATGGAAGACTAGGATGG + Intergenic
945545834 2:211150355-211150377 TTTACTATGGATGATTTGAAAGG + Intergenic
945629019 2:212248201-212248223 TTTAATTTTGATGATTATGAAGG - Intronic
946526842 2:220529884-220529906 CAGAATATGAATGATTAGTAAGG - Intergenic
947314323 2:228839055-228839077 TTGAATTTGGATCATTCGAAGGG + Intergenic
1170145308 20:13167155-13167177 TAGAATAAGGTTAATTAGGAGGG + Exonic
1170200722 20:13740974-13740996 GTGAATATTGAGGATTAGGGAGG - Intronic
1173571665 20:44081074-44081096 TTGAATATGGAGGCTAAGCATGG - Intergenic
1177011222 21:15731774-15731796 TAGAATAGGGAGGATTAGGAAGG - Intronic
1181375248 22:22453004-22453026 TTGAGTATGGCTAATTAGGTGGG - Intergenic
1181376060 22:22459190-22459212 TTGAATATGGCTAATTAGGTGGG - Intergenic
1182837776 22:33358321-33358343 TTGATTTTGGAGGATTGGGATGG - Intronic
1183068105 22:35377592-35377614 TTGAAGATGGAGGATGAGGCTGG - Intergenic
1183267196 22:36835694-36835716 TTGAAGATTGATGTTTAGGGTGG + Intergenic
1184408657 22:44314044-44314066 TTTAATCTTCATGATTAGGAGGG + Intergenic
949183592 3:1164579-1164601 GTGAATATGGAGGCTTTGGAGGG + Intronic
949647439 3:6112453-6112475 GTTATTATGGATGATTAGTATGG - Intergenic
951714575 3:25626470-25626492 TTTAATATGTATCATAAGGATGG + Intronic
957988982 3:87607366-87607388 TTGAATATGGCTAATTAGACAGG + Intergenic
957990085 3:87615866-87615888 TTGAATATAGTTAATTAGGCAGG + Intergenic
958621228 3:96564439-96564461 TTGAATATGGAACACTAGTAAGG + Intergenic
960769298 3:121174652-121174674 TTGAATATGGACTAATATGAAGG + Intronic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963970370 3:151422596-151422618 TTGAAATTAGATAATTAGGATGG - Intronic
964363302 3:155921364-155921386 TTGAAGCTGGATGATAAGTAAGG + Intronic
964755660 3:160088965-160088987 GTGAATATGGCTGGTTAGTATGG - Intergenic
965361036 3:167738207-167738229 GTGAATATGTATGATGAGAAAGG + Intronic
966033511 3:175379762-175379784 TTGAATATGGCTTATTATCAAGG + Intronic
967420709 3:189269241-189269263 TGGAAAATGTATGTTTAGGATGG - Intronic
967465152 3:189796553-189796575 TTGAAAGTGGAGGATTAGGTTGG - Intronic
967709708 3:192692104-192692126 TTTAAAATAGATGAATAGGATGG - Intronic
969486685 4:7476149-7476171 TAGGACATGGATGGTTAGGAAGG + Intronic
971245609 4:24924818-24924840 TTGAGTATGGATGAGTATCAAGG + Intronic
971434286 4:26603888-26603910 TTGAAGATGGATGGTGAGGATGG - Intronic
972982157 4:44718308-44718330 TTTAATATGGATGAATATGTAGG - Exonic
974159253 4:58116564-58116586 TTGGGTTTGGATGATTAGGATGG + Intergenic
974578873 4:63768135-63768157 TTAGATATGGATTATTAGAATGG + Intergenic
974786304 4:66622980-66623002 TTCAAAATGGATAATTAGAATGG + Intergenic
974816970 4:67017677-67017699 TTGAATAATGATGATGATGATGG - Intergenic
976683954 4:87789646-87789668 TTGAATAATGAAGATTGGGAAGG + Intergenic
978850084 4:113324654-113324676 TAGAATTTGGAGAATTAGGAAGG + Intronic
979012684 4:115391359-115391381 TTGAATAGGAATGATGAGGGAGG - Intergenic
981808046 4:148739834-148739856 GTTAGTATGGATGATTATGAAGG + Intergenic
982661814 4:158216362-158216384 TTGATTATAGGTGATTAGGAGGG + Intronic
984184853 4:176531415-176531437 TTGAATGTAGATGAAAAGGAAGG - Intergenic
984895465 4:184535705-184535727 TTGAATAATGATGATGATGATGG + Intergenic
986501133 5:8401041-8401063 GTGAAGATGGATGGTGAGGAGGG + Intergenic
988118988 5:26935340-26935362 TTGAATAGGAGTGATTAAGAGGG - Intronic
990664448 5:58055712-58055734 TGGATTTTGGATGATTATGATGG - Intergenic
991100790 5:62790434-62790456 TTGAATAGGGTTGTTAAGGAAGG + Intergenic
993526227 5:88969021-88969043 TTGGATAGGGAAGGTTAGGATGG + Intergenic
993564979 5:89462914-89462936 TTATATAGGAATGATTAGGAGGG + Intergenic
993920584 5:93795593-93795615 TTGAATGTAGAGGATTAAGATGG - Intronic
994218954 5:97172408-97172430 TTGGATATGGATGTGAAGGAAGG - Intronic
995962362 5:117857990-117858012 TTGACTAGGGATATTTAGGAAGG - Intergenic
997728508 5:136143895-136143917 GTGAATATGACTGATTAAGAAGG - Intronic
999928116 5:156401859-156401881 TTGGAGATGGATGATGATGATGG - Intronic
1003433107 6:6058375-6058397 TTGAACATGAAGGATTGGGAAGG - Intergenic
1004094976 6:12544584-12544606 TTGATGATGGATAATTAAGAAGG - Intergenic
1005033239 6:21531079-21531101 TTGAATATTAATGGTTAAGAGGG - Intergenic
1005623294 6:27639687-27639709 TTGGATGTGGATGATGAGAAGGG + Intergenic
1007683056 6:43647523-43647545 TTGAATAAGGATGGTTATAAAGG + Intronic
1012493988 6:99814033-99814055 TTGAATATGCTTGATTTAGAAGG + Intergenic
1015722132 6:136253573-136253595 TTGAAAATGAATAATTAGGCCGG + Intergenic
1015985683 6:138881989-138882011 CTGAACATTGCTGATTAGGAAGG - Intronic
1017377106 6:153783953-153783975 TTGGATATGAATGATAAAGATGG - Intergenic
1018313666 6:162535551-162535573 ATGAATATGGATGATTGAGTGGG - Intronic
1020538544 7:9431159-9431181 TTGAAGAAGGATGATGATGAAGG - Intergenic
1020641484 7:10759504-10759526 TTGAATATGGCTACTTAGGTGGG + Intergenic
1020732140 7:11893474-11893496 TTTAATATGGATGCATAGGCTGG + Intergenic
1021895783 7:25234371-25234393 TTGTGTAAGGCTGATTAGGAAGG + Intergenic
1021916041 7:25433275-25433297 TGGTAAATGGATGATTAGAATGG + Intergenic
1022557953 7:31318670-31318692 TTGGAAAAGGATCATTAGGAGGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023231595 7:38037028-38037050 TTGAATATGTATTTTTTGGAGGG - Intergenic
1024804095 7:53115945-53115967 TTGCCTACAGATGATTAGGAAGG - Intergenic
1026158947 7:67852194-67852216 TAGAATAAGGAAGATGAGGAGGG + Intergenic
1027717931 7:81697280-81697302 TTGGATAGGGATGTTGAGGATGG + Intergenic
1028476638 7:91261016-91261038 TTGAATGTGGATAATTAGCAGGG - Intergenic
1028771909 7:94635315-94635337 TTGGATAAGAATGATTAAGAAGG + Intronic
1028858269 7:95616963-95616985 TTGAATATGAGTGGTTAGAAAGG - Intergenic
1030090312 7:105852345-105852367 TTGTATAGGGAGGGTTAGGAAGG - Intronic
1030448451 7:109677424-109677446 TTCATTATGGATTATTTGGAGGG + Intergenic
1032107401 7:129045265-129045287 TTGAAGATGGATGATGGTGATGG + Intronic
1032258147 7:130313234-130313256 TTGAAAAAGGTTGATTAGGCAGG + Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033792684 7:144810485-144810507 TTGCATAACGCTGATTAGGAGGG - Intronic
1040904435 8:52451388-52451410 AGGAAAATGGATGAGTAGGAAGG + Intronic
1041607954 8:59806784-59806806 TTGAATAAGGGTGATAAGGATGG - Intergenic
1041859328 8:62494061-62494083 TTGAATAGGAGTGATTAGAAAGG + Intronic
1043051377 8:75390181-75390203 TTGAAACTGAATGATTAAGAGGG - Intergenic
1043663264 8:82773898-82773920 TATAATATGTATGATTTGGAGGG - Intergenic
1046058227 8:109104322-109104344 TTGAAAAATGATGATTAGCAAGG + Intronic
1046618996 8:116507860-116507882 TTGAATATGGATTATCAGAGAGG + Intergenic
1048959564 8:139564661-139564683 TTGAATGTGGCTAATTAGGCAGG + Intergenic
1050893508 9:10855462-10855484 TTGAAAGTGGTTTATTAGGAAGG - Intergenic
1051617799 9:19023091-19023113 TTAAATATTGATGATAAGAATGG - Intronic
1052011841 9:23420182-23420204 TTGAAGATGGGTGAATAGGATGG - Intergenic
1052721350 9:32174777-32174799 GAGAATCTGGATGATTAGGGAGG - Intergenic
1055215698 9:73858889-73858911 CTGAAGATGGATGTTTAGAAAGG - Intergenic
1056134600 9:83619651-83619673 TTGAATCTGTATAATTTGGAGGG + Intergenic
1056510002 9:87295591-87295613 TTGAAGATTGATGCTAAGGAAGG - Intergenic
1056942306 9:90966035-90966057 TTGCATATGGAAAATCAGGAAGG + Intergenic
1057737152 9:97673778-97673800 TTGAAAATGAAAGATGAGGAAGG + Intergenic
1058202064 9:102055970-102055992 CTCAATCTGGATGATTGGGATGG - Intergenic
1059624863 9:116052260-116052282 TTCAATATGGATGATCAACATGG + Intergenic
1061435668 9:130559887-130559909 TTAAAAATGGATGTTTAGGCTGG + Intergenic
1185447263 X:265634-265656 TGGAGTATGAATGATTAGCATGG + Intergenic
1187560680 X:20400132-20400154 TTGAAAATGGATGGTGATGATGG - Intergenic
1188796837 X:34477546-34477568 TTGAATAAGAATGATGAGAAAGG + Intergenic
1188938060 X:36201825-36201847 TTAAATATGAATCACTAGGAGGG + Intergenic
1192747454 X:73953573-73953595 TTGAATAAGGAAGATAAGAATGG - Intergenic
1193396415 X:80988843-80988865 GTGAATAAAGATGATTAGAAGGG - Intergenic
1194624343 X:96211320-96211342 TTAAATATAGATGTTAAGGAGGG - Intergenic
1194671033 X:96733034-96733056 TTGAATATTTATGAACAGGAGGG + Intronic
1195279527 X:103317668-103317690 GTGAATATGGTTGATCAGGGTGG - Intergenic
1195346075 X:103952540-103952562 TAGACTATGGAGGATTAGCAAGG + Intronic
1196059500 X:111392007-111392029 TTGATTCTGGAAGGTTAGGAGGG + Intronic
1197558007 X:127980674-127980696 TTCAATATGACTGATAAGGATGG + Intergenic
1199776803 X:151019151-151019173 TTGAATAAGGATGATTATCATGG + Intergenic
1200275387 X:154727375-154727397 TTCAATATGGATGATCAGAGAGG - Intronic
1201242022 Y:11968330-11968352 TTGAATATGACTGATGAGCACGG + Intergenic