ID: 1086230397

View in Genome Browser
Species Human (GRCh38)
Location 11:84562515-84562537
Sequence CACAAACAATTCCAAAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 382}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086230397 Original CRISPR CACAAACAATTCCAAAATAC AGG (reversed) Intronic
900372502 1:2338199-2338221 CAGAAATATTTCCAAATTACAGG + Intronic
900685537 1:3945606-3945628 CACAAACACCTCCAAAAGACGGG + Intergenic
901155313 1:7133131-7133153 CACAAACCTTTCCAGAATATAGG - Intronic
907189565 1:52637228-52637250 CACAGACAATTGCAAAGTGCAGG + Intronic
907220330 1:52902776-52902798 CAAAATAAATGCCAAAATACCGG + Intronic
908470324 1:64437658-64437680 GACAAACAACTCCCAAATGCTGG - Intergenic
910082846 1:83362154-83362176 CACAGACAAATCCAAAATATAGG + Intergenic
910723118 1:90309492-90309514 CACAGACACATCCAAAATAGTGG + Intergenic
912461732 1:109838082-109838104 CACAAATAATTTCCAAATTCTGG - Intergenic
912490159 1:110058292-110058314 CACAGACAATCCCACAAAACAGG + Intronic
912606693 1:110997988-110998010 CTCAAACTATTCCAAAAAATAGG - Intergenic
912620778 1:111155027-111155049 CTGAAACTATTCCAAAATACTGG - Intronic
912732088 1:112116137-112116159 AACAAACAATTCCAGAATCCTGG - Intergenic
913360553 1:117975791-117975813 CAAAAACTATACCAAACTACTGG - Intronic
915211981 1:154316933-154316955 CACAAATAATTTCCAAATTCTGG - Intergenic
915578483 1:156797774-156797796 CACAAATAATTCAGAATTACAGG + Intronic
916048585 1:161019209-161019231 CACTAGCAGTTCTAAAATACAGG + Intronic
918021498 1:180697025-180697047 CTCAAGCTATTCCAAAAAACTGG - Intronic
918331252 1:183463177-183463199 TGCCAACATTTCCAAAATACAGG - Intergenic
919784862 1:201252592-201252614 CCCCAACAACTCCAAGATACAGG - Intergenic
920579617 1:207093932-207093954 GACAGGCAATTCCAAAATAATGG + Intronic
921354182 1:214270073-214270095 CAAAAACAATAGCAAAACACAGG + Intergenic
921680149 1:218021779-218021801 CACAAATAATTTCCAAATTCTGG - Intergenic
921769555 1:219020311-219020333 CACAAACACTTCCCAAAGAGAGG - Intergenic
921787811 1:219252827-219252849 CAGAAACCGTTCCAAAAAACTGG - Intergenic
922458594 1:225797360-225797382 CAAAAATGATCCCAAAATACTGG - Intergenic
922995773 1:229958828-229958850 AACAAATAATTCCAAACTATAGG + Intergenic
1063284330 10:4667410-4667432 CACAAACTCTTCCAAAAAAGTGG - Intergenic
1063525150 10:6778346-6778368 CAAATCCAATTCCAAAACACTGG + Intergenic
1064036637 10:11918823-11918845 CATAAACATTTCCAAAATTCAGG + Intergenic
1064730099 10:18321812-18321834 CAAAAACAATTCAAAAAGAGGGG - Intronic
1067075830 10:43181252-43181274 TACAAAGAATTCCAACTTACTGG - Intronic
1067676166 10:48379496-48379518 CACAAATAGTTCCCAAATTCTGG + Intronic
1068332049 10:55583751-55583773 CACAGAGAATTCCACAATATCGG + Intronic
1068875846 10:61995914-61995936 TCCAAACAATGCCAAAATTCTGG + Intronic
1068912034 10:62388711-62388733 CAGTAACATTTCCACAATACAGG - Intronic
1070268580 10:74929276-74929298 CCAAAAAAATCCCAAAATACTGG + Intronic
1070358719 10:75665868-75665890 AAGAAACAATTGCATAATACAGG - Intronic
1070653184 10:78252743-78252765 CAGCATCAATCCCAAAATACAGG - Intergenic
1070870881 10:79751568-79751590 TAAAAACTATTCCAAAAAACTGG + Intergenic
1071219679 10:83450678-83450700 CACAAACTTTTCCAAAATTAGGG + Intergenic
1071637807 10:87273779-87273801 TAAAAACTATTCCAAAAAACTGG + Intergenic
1071657437 10:87464171-87464193 TAAAAACTATTCCAAAAAACTGG - Intergenic
1072429019 10:95355132-95355154 CACAAATAAATCCAAAAAATGGG - Intronic
1074969011 10:118520372-118520394 CACAAACAAATCCAAAAGGGTGG - Intergenic
1078047770 11:7932773-7932795 CTCAATAAATTCCAAAATCCTGG + Intergenic
1078512442 11:11995400-11995422 TACAAGCAACTCCAAGATACTGG - Intronic
1080357253 11:31464391-31464413 CTCAAACTATTCCAAAAAACTGG + Intronic
1081416227 11:42819614-42819636 TACAAACAATTGCAAAGTAGGGG + Intergenic
1082917738 11:58456511-58456533 CTCAAACTATTCCAAAAGATTGG + Intergenic
1083417954 11:62537487-62537509 CTCAAACAATCCCAAAGTGCTGG + Intronic
1084490121 11:69473753-69473775 TACAAACTATCCCAAAACACAGG - Intergenic
1085420629 11:76355464-76355486 CATAGATAATTCCAAAACACAGG + Intronic
1086156533 11:83672686-83672708 CACAAACACACCAAAAATACTGG - Intronic
1086230397 11:84562515-84562537 CACAAACAATTCCAAAATACAGG - Intronic
1086430704 11:86733177-86733199 CACAAACTCTTCCAAAAAATAGG + Intergenic
1086923953 11:92619401-92619423 CACAAACTCTTCCAAAATATAGG - Intronic
1087553313 11:99680382-99680404 CATATACCATTCCAAAATCCTGG + Intronic
1087905990 11:103698082-103698104 CACAAATAATTCAATAATAAAGG - Intergenic
1089761763 11:120731608-120731630 CTCAAACTATTCCAAAAAACAGG - Intronic
1090814049 11:130274904-130274926 TACAAACTCTTCCAAAAAACGGG - Intronic
1091854388 12:3727649-3727671 AACAACCATTTCCTAAATACCGG + Intronic
1091940862 12:4480216-4480238 CACAAACAAAACCAAAAAGCAGG - Intergenic
1092751840 12:11726474-11726496 CACAAATAATTTAAAAGTACAGG + Intronic
1093469960 12:19490105-19490127 CACGCACAATTCCAACATTCTGG - Intronic
1093553288 12:20440937-20440959 CAGAAACAATTTCACAAAACGGG - Intronic
1093800795 12:23370059-23370081 GACAAACTATTCCAAAATGAAGG + Intergenic
1095275542 12:40278375-40278397 CACAAACAATTGCAATAAACTGG - Intronic
1095802790 12:46285765-46285787 CACACACAACTTCAAAATAAAGG + Intergenic
1096284339 12:50285000-50285022 CAAAAACAACTCCAAACTAATGG + Intergenic
1096408891 12:51363179-51363201 CACAAATAATCCCAAACCACAGG + Intronic
1097817937 12:64096188-64096210 CACAAACAAATAACAAATACTGG - Intronic
1099315848 12:81081338-81081360 AAAAAACAAATCCAAATTACAGG + Intronic
1100319501 12:93476734-93476756 GACAAACAATTACAACATAGAGG - Intronic
1102335438 12:112075034-112075056 CATAAGCACTTCCAAAATAGAGG + Intronic
1102958682 12:117076951-117076973 CACAAACCTTTCCAAAACACGGG + Intronic
1103114193 12:118311158-118311180 CACAAAGAATTCACAAATAGGGG + Intronic
1105243322 13:18626644-18626666 TACAAAAAATACCAAAAAACTGG - Intergenic
1105463919 13:20619145-20619167 CATAAACAATTCCAGAAAAAAGG - Intronic
1106763035 13:32886306-32886328 AACAAACAATTCTAGAATATGGG - Intergenic
1106841698 13:33691182-33691204 CACAAAGGATTCTACAATACGGG - Intergenic
1107124237 13:36828692-36828714 GAAAAACAATGACAAAATACTGG - Exonic
1108135743 13:47356324-47356346 CTCAAACACTTCCAAAAAATTGG - Intergenic
1109961215 13:69634512-69634534 CTCAAACTATTCCAAAAAATTGG - Intergenic
1110086190 13:71383661-71383683 CACAAAAAATTTAAAAATGCGGG - Intergenic
1110335818 13:74328821-74328843 GACAAACAAATCCACATTACAGG - Intergenic
1112760217 13:102686929-102686951 AACAAACAAACCTAAAATACTGG + Exonic
1113041651 13:106109962-106109984 CACATAAATTTCCAAAATAATGG + Intergenic
1113205552 13:107911827-107911849 CACAATCCAATCCAAAATCCAGG + Intergenic
1114071874 14:19116942-19116964 TATATTCAATTCCAAAATACAGG + Intergenic
1115244274 14:31279115-31279137 CACAAATAGTTCCCAAATTCTGG - Intergenic
1115765842 14:36623070-36623092 CACAAACTCTTCCAAAAAATAGG - Intergenic
1116039647 14:39670089-39670111 CAAAAAAAATTCCTAAAAACTGG - Intergenic
1116106657 14:40516369-40516391 CTCAAACTATTTCAAAAAACAGG + Intergenic
1116840130 14:49811962-49811984 CACAAACTCTTCCAAAAAATAGG - Intronic
1118045223 14:61962552-61962574 CACCAAAACTTCCTAAATACTGG - Intergenic
1118552817 14:66975192-66975214 AACAAAAATATCCAAAATACGGG - Intronic
1118631497 14:67708085-67708107 CACAAATAATTTCCAAATTCTGG + Intronic
1119896167 14:78221558-78221580 AACAAACAATCACAAAAAACTGG + Intergenic
1120295764 14:82638148-82638170 CACTAAAAATACAAAAATACAGG + Intergenic
1120530995 14:85631366-85631388 CACAAAAAATTACAATATATAGG - Exonic
1120763924 14:88311066-88311088 GACAACCAATTCCAAACTTCTGG - Intronic
1120783292 14:88506402-88506424 AATAAACAATTCAAAAATGCTGG + Intronic
1121139984 14:91533061-91533083 CACGAACAATCTCAAAACACCGG + Intergenic
1121237123 14:92400078-92400100 CACCACCAATTCTAACATACTGG - Intronic
1122132846 14:99615381-99615403 TACAAAAAATTCAAAAATATGGG + Intergenic
1123487976 15:20758001-20758023 TACAAAAAATACCAAAAAACTGG + Intergenic
1123544478 15:21327071-21327093 TACAAAAAATACCAAAAAACTGG + Intergenic
1125272903 15:37959302-37959324 TTCAAACTATTCCAAAACACAGG + Intronic
1126192509 15:45892684-45892706 CAAAAACAAATGCAAAATTCAGG + Intergenic
1126817169 15:52465451-52465473 CATAAACAAACCCAAAATACAGG + Intronic
1127024865 15:54793035-54793057 ATAAAACAATTCCCAAATACAGG + Intergenic
1127803441 15:62497066-62497088 AACAAAAAATTCCAACACACAGG - Intronic
1127855434 15:62949976-62949998 CCCAAACAATTCCTCATTACAGG - Intergenic
1127987833 15:64088149-64088171 TGCTAACAAATCCAAAATACTGG + Intronic
1128923437 15:71632504-71632526 AACTAACAATTCCAACATGCTGG - Intronic
1129912900 15:79242848-79242870 TGCAGACAATTCCAGAATACTGG - Intergenic
1130121480 15:81051990-81052012 CACAAAGAACTACAAAACACTGG - Intronic
1131563515 15:93464546-93464568 CACAAACTAGTCCATAACACTGG + Intergenic
1131907555 15:97159983-97160005 CACAAATGATTCCATTATACAGG + Intergenic
1202952820 15_KI270727v1_random:54340-54362 TACAAAAAATACCAAAAAACTGG + Intergenic
1134099319 16:11440574-11440596 CACACACACTGCCAAAATAAGGG + Intronic
1134802259 16:17096010-17096032 CATAAACATTTTCAAAATGCAGG + Intergenic
1136040192 16:27572563-27572585 CAGAACCAATTCCAAATTCCTGG + Intronic
1136676316 16:31910295-31910317 CTCAAAAACTTCCAAAACACAGG - Intronic
1136869752 16:33795689-33795711 CACAGACACTTCCACAATAAAGG - Intergenic
1137666810 16:50254837-50254859 AAAAAACAATTCTAAAATTCAGG + Intronic
1138469384 16:57220948-57220970 CAGCAACATTTCCAAAATACAGG - Intronic
1139117995 16:63980061-63980083 CACAAACACTTCCAAAAAGTTGG - Intergenic
1139737062 16:68999577-68999599 CACAAATAATTTCCAAATTCTGG + Intronic
1139930683 16:70523845-70523867 CACCACCAACTCCAACATACTGG - Exonic
1142170653 16:88620624-88620646 CACAAACTAACCCAAAATCCTGG - Intronic
1203102420 16_KI270728v1_random:1320366-1320388 CACAGACACTTCCACAATAAAGG + Intergenic
1144361142 17:14494595-14494617 CACAAACATTTCCAAAAAATTGG - Intergenic
1150034266 17:61776909-61776931 ATCAGATAATTCCAAAATACTGG + Intronic
1203158601 17_GL000205v2_random:28555-28577 CACATACTATTCCAGAACACTGG - Intergenic
1153906240 18:9663845-9663867 CACAAAAAAAGCCAAAAAACTGG + Intergenic
1154273442 18:12939525-12939547 CAAAAACAATCCCAAATTGCCGG - Intergenic
1154445613 18:14433257-14433279 TACAAAAAATACCAAAAAACTGG + Intergenic
1154954981 18:21244246-21244268 CATAAAGAATTCCAAAATGGAGG - Intronic
1155882648 18:31169210-31169232 CACAAACATCTCCAAGGTACAGG - Intergenic
1156003633 18:32414184-32414206 CACAGACAATGACAAAATAAGGG + Intronic
1156274665 18:35572978-35573000 CACAAACAATCCCCAAATTGTGG - Intergenic
1156589537 18:38470362-38470384 AAAAAAAAATTCTAAAATACAGG - Intergenic
1156791029 18:40975491-40975513 CACAAGCTAATCCAAAAAACTGG - Intergenic
1156817294 18:41326577-41326599 CACAAAGAATTCCAGTATTCAGG - Intergenic
1158979164 18:62742057-62742079 TAAAATCAATTCCAAAACACTGG - Intronic
1161252497 19:3288159-3288181 CACGAACAAATGCAAAATTCAGG + Intronic
1162215323 19:9129170-9129192 CACAAACAAAAACAAAATTCAGG + Intergenic
1162687933 19:12402976-12402998 CTCAAACTATTCCAAAACAGAGG - Intronic
1163709058 19:18834616-18834638 CACAAACAAATCCAAATTACAGG - Intronic
1163838813 19:19593162-19593184 CTCAAGCGATTCCAAAGTACTGG + Intronic
1164291542 19:23873595-23873617 CACTAAAAATTTCAAAATTCTGG + Intergenic
1164450128 19:28354734-28354756 CTCAAACTTTTCCAAAACACTGG + Intergenic
1164664071 19:30011634-30011656 AACAAACAATTCCAAAAAAAAGG - Intronic
1165463222 19:35956927-35956949 CATAAACATTTTCAAAATGCAGG + Intergenic
1165552718 19:36602496-36602518 CACAAGCCATACAAAAATACAGG + Intronic
1167811440 19:51835495-51835517 AAGAAACACTTCCAAAAGACAGG + Intergenic
1168461283 19:56560689-56560711 CACAAAAAATTTAAAAATTCTGG - Intergenic
1168623658 19:57899058-57899080 CAACAATGATTCCAAAATACTGG + Intronic
929736193 2:44552469-44552491 CAATAACAACTCCAAAATCCTGG + Intronic
929845706 2:45523775-45523797 CACAAACTCTTCCAAAAAACAGG + Intronic
931483247 2:62664770-62664792 TCCAAAGAATCCCAAAATACAGG - Intergenic
931551467 2:63450857-63450879 CAAAAACAAATTCAAAAAACTGG + Intronic
931896440 2:66736070-66736092 CAACAACAATTCCTAAATATTGG + Intergenic
932142225 2:69290018-69290040 AGTAAAAAATTCCAAAATACAGG - Intergenic
933044676 2:77520659-77520681 CAAAAACAACTCTAAAATAATGG - Intronic
933069416 2:77838286-77838308 CACAAACAGTCCCAAAATTCTGG - Intergenic
933078261 2:77956093-77956115 CACAAACTAGTCCAAAAAATAGG + Intergenic
933334104 2:80934103-80934125 CTCAATCATTTCCAAAATATAGG + Intergenic
933453882 2:82496965-82496987 CATAAACAATTCCAAAAACAAGG + Intergenic
935545053 2:104392024-104392046 AACAGACAATTCCAAATGACTGG + Intergenic
935803175 2:106719257-106719279 CACAAAAAATTCAAAACTTCAGG - Intergenic
937121543 2:119442801-119442823 CCCACACAGTTCCAAAAAACGGG + Intronic
938816955 2:134914753-134914775 CACAAACCATTCTGAAATAGAGG - Intergenic
938952672 2:136269798-136269820 CACATGCAAGTCCAAAATCCAGG - Intergenic
939017826 2:136921738-136921760 CACAAATAGTTGCAAAAAACAGG - Intronic
939411262 2:141827600-141827622 CTCAAACAATATCTAAATACTGG - Intronic
939411281 2:141828013-141828035 CTCAAACAATATCTAAATACTGG - Intronic
940767315 2:157803742-157803764 CAAAAACATTTAAAAAATACTGG - Intronic
942154260 2:173110847-173110869 CAAAAACAATTGCAAAATCATGG - Intronic
942194194 2:173501242-173501264 CACAAACAGTTTCCAAATTCTGG - Intergenic
942880151 2:180850197-180850219 CACACACAATTTCTAAATGCAGG + Intergenic
943227602 2:185199537-185199559 CAAAAACAAAAACAAAATACAGG - Intergenic
943360237 2:186910622-186910644 AACAAACAATTCTGTAATACTGG - Intergenic
944048023 2:195436430-195436452 CACAGACAGTTGTAAAATACGGG - Intergenic
945243112 2:207694860-207694882 CAGATACTGTTCCAAAATACCGG - Intergenic
945708189 2:213261961-213261983 TACAAACCACTCCAAAATTCAGG - Intergenic
947090513 2:226505876-226505898 CACTAAGAATTACAAAATACTGG + Intergenic
947228350 2:227861163-227861185 CACACACAAAGCCAAAATCCTGG + Intergenic
948151861 2:235750994-235751016 TAAAAACAATTCCAAAAGGCTGG - Intronic
1169577134 20:6976503-6976525 CTCAGACAATTCTAAAGTACAGG - Intergenic
1172397795 20:34621855-34621877 AGTAAACAATTACAAAATACAGG + Intronic
1172892192 20:38273436-38273458 TTCAAACAATACCAATATACTGG - Intronic
1173712184 20:45168620-45168642 CTGAAACTATTCCAAAAAACTGG + Intergenic
1174604405 20:51750478-51750500 CCCAAAAAATTCCAGAAAACAGG + Intronic
1176306690 21:5127279-5127301 CAGAAACATTTGCAAAACACGGG + Intronic
1176450364 21:6856605-6856627 TACAAAAAATACCAAAAAACTGG - Intergenic
1176828533 21:13721623-13721645 TACAAAAAATACCAAAAAACTGG - Intergenic
1176985722 21:15433320-15433342 TGCAAACATTTACAAAATACTGG + Intergenic
1177465186 21:21468749-21468771 CACAATGTATTCCAAAATAGGGG - Exonic
1177762956 21:25422684-25422706 CACAAACAATACGGAAATAAGGG + Intergenic
1178150702 21:29790614-29790636 TACAAAAAATACAAAAATACAGG - Intronic
1178227151 21:30734219-30734241 CACAAACATTTCAAAATTTCTGG - Intergenic
1178481392 21:32982570-32982592 CACAAATACTTGCAACATACGGG - Intergenic
1179176244 21:39010235-39010257 CACAAACAATGCCAACATGCTGG + Intergenic
1179244607 21:39620807-39620829 CACAAACAACCCCAAAATCTCGG - Intronic
1179400889 21:41082051-41082073 AACAAACAACTCCTAAATCCCGG - Intergenic
1179850367 21:44134751-44134773 CAGAAACATTTGCAAAACACGGG - Intronic
1180519241 22:16180220-16180242 CACAAAGGATTCCAAAATGGAGG - Intergenic
1182380158 22:29881268-29881290 TACAAAAAATACCAAAAAACTGG - Intergenic
1183013303 22:34965433-34965455 CAAAAACAATTCCAAGCTTCTGG - Intergenic
1184917781 22:47584280-47584302 CACAAATAGTTTCAAAATTCTGG - Intergenic
949464919 3:4334153-4334175 AAAAAAAAATTCCAAAAAACAGG + Intronic
950916314 3:16649324-16649346 CACAAACATTTTCCAAATTCTGG - Intronic
951318217 3:21213204-21213226 AACAAACAAATAAAAAATACTGG - Intergenic
951847053 3:27095971-27095993 CACACACAATGCCCAATTACTGG - Intergenic
953081726 3:39626000-39626022 CAAAAGCAAATCCAAAAAACTGG + Intergenic
953466198 3:43122011-43122033 GACAAACTATCCCAAAATTCAGG + Intergenic
953898720 3:46825316-46825338 TACAAACAATTAGAAAAAACTGG - Intergenic
954603772 3:51893113-51893135 CACAAACAAGCCTTAAATACTGG - Intergenic
954860317 3:53682838-53682860 CATAAACAACTACAAAAGACTGG + Intronic
955543998 3:60008030-60008052 CATAAACAATGACAAAATCCAGG + Intronic
956317797 3:67958250-67958272 CTCAAACTATTCCAAAAAAGTGG + Intergenic
956476438 3:69625733-69625755 CTCAAACTATTCCAAAAAATAGG + Intergenic
957721318 3:84003600-84003622 CTGAAACTATTCCAAAAGACAGG - Intergenic
957778037 3:84781157-84781179 AACAAACAATTGAAAAATAAAGG + Intergenic
958005701 3:87808161-87808183 CTCAAACTATTCCAAAAAATTGG - Intergenic
959083793 3:101830126-101830148 CACAGACAATCCCAAATTAAAGG - Intronic
959268237 3:104171265-104171287 CAAATACAATTCCAAAAAACAGG + Intergenic
959712443 3:109398521-109398543 CAAAAAAAATTACAAAAGACTGG + Intergenic
960188566 3:114674869-114674891 CACACACAAGTCAAAAATATGGG + Intronic
960508888 3:118525077-118525099 CATAAACAATTGTAAAATAATGG + Intergenic
963956239 3:151257344-151257366 CATAAACAATTTAAAAAAACAGG - Intronic
964453822 3:156838756-156838778 CACCTCCAATTCCAACATACTGG + Intronic
964970019 3:162548543-162548565 CACAAACAGTTTCTAAATTCTGG + Intergenic
966426575 3:179786291-179786313 CACCCCCAATTCCAAAAAACAGG - Exonic
966721472 3:183066958-183066980 CACAAATAATTTCCAAATTCTGG - Intronic
968043617 3:195610470-195610492 CACAAACAGTTGCCAAATTCTGG - Intergenic
968580416 4:1388973-1388995 CACAAACTCTTCCAAAAAATAGG - Intergenic
970034774 4:11720722-11720744 CACACACATATCCAAAATATTGG - Intergenic
970664678 4:18323071-18323093 AACAGACAAGTCCAAAATCCTGG + Intergenic
971435555 4:26619124-26619146 AAGAAACATATCCAAAATACAGG - Intronic
971514042 4:27464594-27464616 CAGAAGCAATTAAAAAATACAGG + Intergenic
971579196 4:28312356-28312378 TAAAAACAATTCAGAAATACTGG - Intergenic
971823852 4:31595774-31595796 CACAAACATTTCCCAACTCCAGG - Intergenic
971842590 4:31873148-31873170 CAAAAACAATACCATAGTACTGG + Intergenic
972961649 4:44460510-44460532 GACAAACCATCCCAAAAAACAGG - Intergenic
973020980 4:45206282-45206304 CACAAATAAATCCAAATGACTGG - Intergenic
973897714 4:55432034-55432056 AACAAACTATTCCAAATCACTGG + Exonic
975364765 4:73516701-73516723 CACAAACAGTCTCAAAATAAAGG - Intergenic
975396698 4:73883368-73883390 CACATAAAATTCCAAATTTCTGG + Intergenic
976058314 4:81095792-81095814 CAAAAACAATGTTAAAATACAGG + Intronic
976921233 4:90446167-90446189 CACAAAGAACTCAAATATACTGG - Intronic
978085565 4:104648529-104648551 CCCAAACTATTCCAAAAAATAGG + Intergenic
978950279 4:114549777-114549799 CACAAATAGTTTCAAAATTCTGG + Intergenic
979221000 4:118224769-118224791 TACTAACATTTCCAAAATGCAGG - Intronic
980184428 4:129444494-129444516 CAAAAACAAAACCAAAAAACAGG + Intergenic
980419709 4:132544083-132544105 CACAAATAGTTTCAAAATTCTGG - Intergenic
981285208 4:143009617-143009639 CTCAAACTCTTCCAAAATAATGG - Intergenic
981505139 4:145491531-145491553 TACAAAGAATAACAAAATACAGG - Intronic
981780324 4:148422166-148422188 AGCAACCAAGTCCAAAATACAGG + Intronic
981819627 4:148870869-148870891 CACATGCAATTCTAAAATAAAGG + Intergenic
982012214 4:151116783-151116805 AACTAACAATACCAAAATATTGG - Intronic
982368455 4:154606463-154606485 CACATATAATGCCAAACTACTGG + Intronic
982406472 4:155025868-155025890 CACACACAACTGCAATATACTGG - Intergenic
983588957 4:169386392-169386414 CACAAGCTGTTCCAAAATAGAGG - Intergenic
983651028 4:170036999-170037021 CACAAAAACTTCCAAAATGAGGG + Intergenic
984203032 4:176750765-176750787 CACAAACAATTTCAAAGAATTGG + Intronic
984207498 4:176803097-176803119 CATAAACAATTATAAAAAACTGG - Intergenic
984610750 4:181834387-181834409 CACAAACCATTTTAAAATATGGG + Intergenic
986524979 5:8664093-8664115 CACATCCCATTCCAACATACAGG - Intergenic
987732458 5:21793038-21793060 GACAACCAAGTCCAAAATAAGGG - Intronic
987904844 5:24062577-24062599 TACTTACAATTCCAAAATGCGGG - Intronic
988258652 5:28853534-28853556 AACAAACAAATACAAAATACAGG + Intergenic
988308757 5:29529556-29529578 CAAAAACAATTCCAAAAATCTGG + Intergenic
989027963 5:37088358-37088380 GACAAACAAAGCCAAAATATTGG + Intergenic
989199886 5:38752624-38752646 CACAAGAAATGCCAAAGTACAGG + Intergenic
990070657 5:51778542-51778564 CACAAATAATTTCCAAATTCTGG + Intergenic
990285933 5:54300655-54300677 CACATCCAATTACAAAATTCTGG + Intronic
990372042 5:55129925-55129947 CAGACACAATTCAAAATTACTGG + Intronic
991624230 5:68582600-68582622 CAGTAACAATTCCAAAATATTGG + Intergenic
992588679 5:78270531-78270553 ACCAAAAAATTCCAAAACACAGG + Intronic
992602463 5:78416416-78416438 CAAACACACTTCCAAAGTACAGG - Intronic
993166625 5:84363544-84363566 TAGAAACAATTCCATAATATTGG + Intronic
993422152 5:87715705-87715727 CACAAACAGTTTCCAAATTCTGG + Intergenic
994232182 5:97319286-97319308 CAAATACAATACCAAAATAATGG - Intergenic
996121302 5:119675317-119675339 CTCAAACTATTCCAAAAAATTGG - Intergenic
996212099 5:120823639-120823661 TACAAACACTACCATAATACTGG - Intergenic
996516121 5:124371683-124371705 CAGAAACAGTTCCAAGATGCTGG - Intergenic
997905466 5:137812247-137812269 CACAAACACTGCAAAAATAGAGG - Intergenic
999098287 5:149001021-149001043 CAAAATCAAGACCAAAATACAGG + Intronic
999455492 5:151713116-151713138 CTCAAACTATTCCAAAAAACAGG - Intergenic
1000066626 5:157698907-157698929 CACAAATAATTTCCAAATTCTGG - Intergenic
1000525712 5:162355108-162355130 AACATACATTTCCAAAATAGTGG + Intergenic
1001606722 5:172965703-172965725 CACAAGCTCTTCCAAAATGCTGG + Intronic
1001720665 5:173854380-173854402 CAGAAACAATTTCACCATACTGG + Intergenic
1001804149 5:174569084-174569106 AAAAAAAAATTCCAAATTACAGG - Intergenic
1002651683 5:180701575-180701597 CACATAAAATTCCAAAGTAGAGG + Intergenic
1002690829 5:181049284-181049306 TAAAAACAATTGCAAAATAGTGG + Intronic
1003610558 6:7611058-7611080 CACAAACATTTCTAATCTACTGG + Exonic
1003959766 6:11198158-11198180 CACATAAAATTCCAAATTTCTGG - Intronic
1004698206 6:18053884-18053906 CAGAAAAAATTTCAAAATCCAGG - Intergenic
1005362725 6:25046951-25046973 CTGAAACTATTCCAAAAAACTGG + Intergenic
1006278991 6:33031459-33031481 CACAAGCGATTCCAAAAGACGGG - Intergenic
1007920814 6:45607986-45608008 CCCAAAGACTTCCAAAACACAGG - Intronic
1008069647 6:47086427-47086449 CCCAAATTAGTCCAAAATACTGG + Intergenic
1008833010 6:55792104-55792126 CATAAACAATTCAAATATTCTGG - Intronic
1010428479 6:75751270-75751292 CACAAAAAATACAAAAATAATGG - Intronic
1010625730 6:78134734-78134756 AACACACAAAGCCAAAATACTGG + Intergenic
1011666224 6:89637081-89637103 CATAAACATTTTCAAAATGCAGG + Exonic
1011833307 6:91400748-91400770 GAAAAACAATACCAAAATTCAGG - Intergenic
1011956348 6:93029408-93029430 CCCATACAAGTCCAAAATCCAGG + Intergenic
1012947134 6:105478954-105478976 CATAACAAATTCCAAAAAACAGG - Intergenic
1014552206 6:122802078-122802100 CAAAAACAATAACAAAATAGTGG - Intronic
1016132101 6:140486976-140486998 CACAATCAATTCCAAAGTCAAGG - Intergenic
1016726655 6:147378173-147378195 CACAAACTCTTCCAAAAGATAGG + Intronic
1016774725 6:147892762-147892784 CTGAAAGAATTTCAAAATACAGG - Intergenic
1017127239 6:151077714-151077736 CAAAAACAAAACCATAATACTGG + Intronic
1018004313 6:159606055-159606077 CACAAACAGTTCCAAAACATAGG + Intergenic
1018276425 6:162136875-162136897 CACAGATAACTCCAAAATAAAGG + Intronic
1018812667 6:167308801-167308823 AACAATCAATTCCAAAAGGCAGG + Intronic
1019311291 7:362126-362148 CACAAACAATTGCAGAAGTCTGG + Intergenic
1020177045 7:5890506-5890528 TACAAAAAATACAAAAATACAGG - Intergenic
1020546321 7:9536486-9536508 CTGAAACTATCCCAAAATACTGG - Intergenic
1020704246 7:11523534-11523556 GACAAAAAATTACAAAAAACAGG + Intronic
1021245357 7:18255262-18255284 CCTGACCAATTCCAAAATACTGG - Intronic
1021421909 7:20455162-20455184 TCCAAATATTTCCAAAATACTGG + Intergenic
1021867144 7:24969730-24969752 GACAAATAATATCAAAATACTGG - Intronic
1022305974 7:29146818-29146840 CAGAAATAATTTCAAAATACAGG - Intronic
1023101390 7:36721913-36721935 CAGAGAGAATTCCAAAAGACAGG - Intronic
1024209905 7:47194270-47194292 CACAAAAAGTACCAAAATAGGGG + Intergenic
1024439407 7:49398589-49398611 CTCAAACAATTCAGAAATTCAGG - Intergenic
1024621864 7:51166551-51166573 TTCAAACTATTCCAAAAAACAGG + Intronic
1027299681 7:76818360-76818382 CACAAACAAATCCAAAATATAGG + Intergenic
1027780156 7:82509656-82509678 CTCAGACAAATCCAAAATAAGGG - Intergenic
1029723265 7:102384481-102384503 CACAAACAATGTACAAATACAGG - Intronic
1029924973 7:104305682-104305704 CACGAACACTTCCAAAGTATAGG + Intergenic
1030025159 7:105316472-105316494 CACTAACAATTCTAAAAACCAGG + Intronic
1030027488 7:105338781-105338803 AATAAACAGTTCCAAACTACAGG - Intronic
1030079740 7:105767189-105767211 CACAAAAATTTCCAAGATGCTGG + Intronic
1030128019 7:106173028-106173050 CAAAAAAAATTCAAAAAGACCGG - Intergenic
1030166321 7:106559523-106559545 AACTGACAATTCCAAAAAACAGG - Intergenic
1030490605 7:110228902-110228924 CACAGATGATTCCAAAATAATGG - Intergenic
1030993034 7:116324432-116324454 TACAGACTATTCCAAAATCCTGG + Intronic
1031437377 7:121749576-121749598 CATAACCAATTCCAGAACACTGG + Intergenic
1031633072 7:124067459-124067481 CACACACCATGCCAAAACACTGG - Intergenic
1032520392 7:132539329-132539351 CACAATACATTCCAAATTACCGG + Intronic
1032841300 7:135715859-135715881 CACACACAAACCTAAAATACAGG + Intronic
1032970656 7:137159679-137159701 CAGAAACAAAGCCAAAATAAAGG + Intergenic
1033160941 7:138996088-138996110 CATAAACATTTCTATAATACAGG + Intergenic
1034306140 7:150047012-150047034 AAAAAAAAATACCAAAATACTGG - Intergenic
1034800704 7:154053638-154053660 AAAAAAAAATACCAAAATACTGG + Intronic
1036161929 8:6397463-6397485 CACAAATAGTTCCCAAATTCTGG - Intergenic
1036730879 8:11263398-11263420 CACAAACTTTTCCAAAAAACGGG - Intergenic
1036763580 8:11530572-11530594 CACAAATAATTTCCAAATTCTGG + Intronic
1037220809 8:16518188-16518210 CACAAACATTCATAAAATACGGG + Intronic
1037693176 8:21200714-21200736 AACAAACACTTGAAAAATACTGG + Intergenic
1037978018 8:23226999-23227021 AACAAACAATTTGAAAATAAGGG - Intergenic
1038973781 8:32668552-32668574 AAGAAACAGTTCCAAGATACTGG - Intronic
1039851450 8:41369072-41369094 AGGAAACAATTCCAAAATCCAGG + Intergenic
1039893499 8:41700003-41700025 CACAAAGAGTTTCAAACTACGGG + Intronic
1041474823 8:58252365-58252387 CATACACAATTCCCAAATCCAGG + Intergenic
1042357448 8:67844506-67844528 CACAAATAATTTCCAAATTCTGG - Intergenic
1042800278 8:72710974-72710996 GACAAACAATACCAAAATCCCGG + Intronic
1044011396 8:86998414-86998436 CACAAAAAATGCAAAAAAACTGG + Intronic
1044893882 8:96867112-96867134 CACACAAAATGCCACAATACAGG - Intronic
1046385468 8:113503016-113503038 CACAAACAGTTTCCAAATTCTGG + Intergenic
1046387762 8:113525544-113525566 CACAAATAATTTCTAAATTCTGG - Intergenic
1046746699 8:117883513-117883535 CACAGACAATTCCGAAAGGCTGG + Intronic
1047083290 8:121488644-121488666 CTCAAACCATTCCAAAATAATGG + Intergenic
1047516505 8:125559187-125559209 CACAAACAAGACCAAATTACAGG - Intergenic
1047538198 8:125738527-125738549 TTCAAGCAATTCCAAGATACAGG + Intergenic
1048429526 8:134357000-134357022 CACAAATAATAACAAAATATGGG + Intergenic
1050888502 9:10794661-10794683 CAAAGACAATTGCATAATACAGG + Intergenic
1050892990 9:10849013-10849035 CAGAAACAATCCCAAAAACCTGG + Intergenic
1051857614 9:21586875-21586897 AACAAAAAACTCCAAAATTCTGG + Intergenic
1052586227 9:30431359-30431381 CTCAAACTATTCCAAAATAGAGG + Intergenic
1052604954 9:30687475-30687497 CATAAAAAATTCTAAAACACTGG - Intergenic
1053519119 9:38760038-38760060 CACAACAAAGTACAAAATACAGG - Intergenic
1056372504 9:85971377-85971399 CAGAAAGAAATCCAAAAGACTGG - Intronic
1056931865 9:90885037-90885059 CAAAAGCAATTTCAAAAAACTGG + Intronic
1057297239 9:93855856-93855878 CAAAAACAAAACCAAAAAACAGG - Intergenic
1058042825 9:100323053-100323075 CACAAAGAAGTACAAAATAGTGG + Intronic
1058734625 9:107883116-107883138 CTCATACAATTCCAAAGTGCAGG - Intergenic
1060774787 9:126365050-126365072 CAAAAAAAATCCCAAAAAACAGG - Intronic
1203518818 Un_GL000213v1:27912-27934 TACAAAAAATACCAAAAAACTGG + Intergenic
1186588287 X:10900250-10900272 AAAAAACAAATCCAAAATATTGG + Intergenic
1187269084 X:17763473-17763495 CATAAACAAGTCCACAATAGGGG + Intergenic
1187320443 X:18233183-18233205 CATAAACAAGTCCACAATAGGGG - Intergenic
1187544657 X:20236698-20236720 CAGAAACAGTGCCAAAATTCAGG + Intronic
1188318338 X:28704517-28704539 CAGAAGCAATTCCAACATAAAGG + Intronic
1188589225 X:31813933-31813955 CACAGACAATACCTAAATAAAGG - Intronic
1189082061 X:37984582-37984604 CACAAACTCTTACAAAATAATGG + Intronic
1189347411 X:40252562-40252584 GGCAAGCAAGTCCAAAATACAGG + Intergenic
1189356572 X:40314152-40314174 AACAAACCACTCCAAAATAGTGG + Intergenic
1189581344 X:42410245-42410267 CTGAAACTATTCCAAAATATTGG - Intergenic
1189896422 X:45661187-45661209 CACAAACTCTTCCAGAATATTGG - Intergenic
1190524978 X:51320027-51320049 CACAATCAACTCCAACATATGGG - Intergenic
1191055917 X:56240691-56240713 AACAAACTATTTCAAAGTACAGG + Intronic
1192806025 X:74510033-74510055 CACAAACTCTTCCAAAAAATTGG - Intronic
1193079024 X:77387003-77387025 CTCAAACTATTCCAAAAAATAGG + Intergenic
1193175907 X:78392315-78392337 CTCAAATAATTCCAAAACAGAGG + Intergenic
1193247612 X:79248169-79248191 CACAAAGAAATCCAAAGCACGGG + Intergenic
1193297984 X:79854256-79854278 CAAAAACAATTCCATTAAACAGG + Intergenic
1194013883 X:88595849-88595871 CACTAAAGATTCCAAAAAACTGG + Intergenic
1194016895 X:88633778-88633800 CTCAAACTATTCCAAAAAAATGG + Intergenic
1195629509 X:107040182-107040204 CTCAAACATTTCCAAAATATTGG + Intergenic
1196583121 X:117398378-117398400 CATAAACATTTTCAAAATGCAGG - Intergenic
1197112026 X:122787517-122787539 CACATACCATTCCAAAATACTGG - Intergenic
1197189277 X:123627616-123627638 CTAAAACAATTTCAAAATATAGG + Intronic
1197400647 X:125985514-125985536 CACAAATAACTACAAAATAAAGG - Intergenic
1197606866 X:128595554-128595576 CACACACAGTTTCAAAATAAAGG - Intergenic
1198934395 X:141890685-141890707 CAGAAACAATTCCAAAAATGAGG + Intronic
1199355693 X:146860945-146860967 CACAAACAGTTTCCAAATTCTGG + Intergenic
1199642655 X:149878940-149878962 TCCAAATAATCCCAAAATACGGG + Intergenic
1200806531 Y:7439159-7439181 GACAAACAACTACAAAACACTGG + Intergenic
1202068777 Y:20968877-20968899 AACACACAAGGCCAAAATACTGG + Intergenic