ID: 1086230509

View in Genome Browser
Species Human (GRCh38)
Location 11:84564123-84564145
Sequence CACTTGCAATAGGCTTACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086230509_1086230515 18 Left 1086230509 11:84564123-84564145 CCAGGGTAAGCCTATTGCAAGTG 0: 1
1: 0
2: 0
3: 0
4: 71
Right 1086230515 11:84564164-84564186 ACAATAACAGGTGGTTGCAAAGG 0: 1
1: 0
2: 0
3: 13
4: 225
1086230509_1086230514 9 Left 1086230509 11:84564123-84564145 CCAGGGTAAGCCTATTGCAAGTG 0: 1
1: 0
2: 0
3: 0
4: 71
Right 1086230514 11:84564155-84564177 GAAGCTGTGACAATAACAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 163
1086230509_1086230513 6 Left 1086230509 11:84564123-84564145 CCAGGGTAAGCCTATTGCAAGTG 0: 1
1: 0
2: 0
3: 0
4: 71
Right 1086230513 11:84564152-84564174 ACTGAAGCTGTGACAATAACAGG 0: 1
1: 1
2: 0
3: 9
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086230509 Original CRISPR CACTTGCAATAGGCTTACCC TGG (reversed) Intronic
900497297 1:2981734-2981756 CACTTGGAGTAGGTTTTCCCTGG + Intergenic
907955533 1:59224572-59224594 CAATGTCAATAGGCTTGCCCTGG - Intergenic
921269809 1:213457381-213457403 CACCTGCCATAGGCCTTCCCTGG - Intergenic
924226291 1:241924385-241924407 CACTTGCAATGAGCAAACCCTGG - Intergenic
1062843372 10:688059-688081 CATTTGCAAAAGGCCCACCCTGG - Intronic
1066189944 10:33046991-33047013 CACTTTCATTACCCTTACCCAGG - Intergenic
1070306962 10:75245485-75245507 CACCTGTAATAGGATTACACAGG - Intergenic
1073875096 10:107914076-107914098 CACTTGCTGTAAGCTTACTCTGG - Intergenic
1075515430 10:123104448-123104470 CACTTTCATGAGGCTGACCCTGG + Intergenic
1079545804 11:21630418-21630440 CAACTGCAATAGCCTTGCCCGGG - Intergenic
1081444944 11:43122052-43122074 CACTTCCAAGAGGCTTTTCCAGG + Intergenic
1081907363 11:46678396-46678418 CACTTGGGAAAGGCTGACCCAGG + Exonic
1086230509 11:84564123-84564145 CACTTGCAATAGGCTTACCCTGG - Intronic
1099024051 12:77443454-77443476 CACTTGAAATAGGATTTCCAGGG + Intergenic
1102245400 12:111352738-111352760 CACATGCAATGGGCTGACTCAGG - Intergenic
1104000323 12:124855986-124856008 CACCTGGAATCGCCTTACCCTGG - Intronic
1107932904 13:45321064-45321086 CACTTTAAATTGGCTTATCCTGG - Intergenic
1109603944 13:64667345-64667367 CACATGCAATAGGGTGATCCTGG - Intergenic
1113185729 13:107683963-107683985 CTCTGGCAATAGGCCAACCCTGG + Intronic
1116806429 14:49498582-49498604 CACTTGCAAGTGGCATACCTAGG + Intergenic
1119717520 14:76869169-76869191 CACTTGCCATCAGCTTCCCCAGG - Intronic
1119800654 14:77442016-77442038 CACTTCCATGAGGCTTTCCCTGG + Intronic
1121102750 14:91261392-91261414 CGCTGGCAATACGCATACCCAGG - Intergenic
1122056914 14:99105341-99105363 CAGATGCAAAAGGGTTACCCAGG - Intergenic
1122184626 14:99981560-99981582 ACCTTGCAGTAGACTTACCCTGG + Intronic
1123878108 15:24645358-24645380 CACTTGCAAGAAGCTCACTCGGG - Intergenic
1138081538 16:54095359-54095381 CACTTACAATACCCTTCCCCAGG + Intronic
1138084077 16:54117842-54117864 CCCTTGAAATAGACTGACCCTGG - Exonic
1139696324 16:68677888-68677910 CCCTTGCAATAGGCTCATCTAGG + Intronic
1140565153 16:76033227-76033249 CACTAGCAATATTCTGACCCTGG - Intergenic
1152863585 17:82709587-82709609 CACTTCCCATGGGCTCACCCGGG - Intergenic
1155233078 18:23793311-23793333 CTCTGGGAATTGGCTTACCCTGG + Intronic
1156361040 18:36384866-36384888 CACTTGCCAAGGGCTTAGCCTGG - Intronic
1157284486 18:46368188-46368210 AACTTCCAATAAGCTTAGCCTGG - Intronic
1160693268 19:470059-470081 CACTTCCAAGAAGCCTACCCTGG + Intronic
925820161 2:7792300-7792322 CACTTGCTTCAGGCTTTCCCAGG - Intergenic
928055778 2:28052693-28052715 CACTTGAAATGGGCTTTTCCAGG - Intronic
929326896 2:40624660-40624682 CATTTGCAATAGCCTCAACCTGG + Intergenic
929870684 2:45756556-45756578 CACTTGTAATAGTCTTAAACTGG + Intronic
930956643 2:57210983-57211005 CACTAGCAACAGGCTCACCATGG - Intergenic
933408599 2:81895819-81895841 CACTTGCAGCAGGGTTTCCCAGG + Intergenic
935837916 2:107075587-107075609 AACTTGGAGGAGGCTTACCCAGG + Intergenic
940364036 2:152826186-152826208 CACCTGCAACAGGATTACCAGGG + Intergenic
942679897 2:178466931-178466953 AACTTGCAATGGGTTGACCCTGG - Intronic
947179752 2:227401543-227401565 CACTTGTTCTAGGCTTTCCCTGG - Intergenic
1174730460 20:52911219-52911241 CACTTGCTCTAGGCTTACATAGG - Intergenic
1176934977 21:14857028-14857050 CACTTGCAATATGCTTCACGGGG + Intergenic
1179729485 21:43359742-43359764 CAGCTGCAAGAGGCTTATCCTGG + Intergenic
1181055426 22:20258544-20258566 CACTTGCAAGGGGCTACCCCAGG - Intronic
951247955 3:20363122-20363144 CAATTGCAATAGGCTAATTCTGG + Intergenic
952386222 3:32843411-32843433 CTCTTGGGACAGGCTTACCCAGG + Intronic
953242941 3:41165809-41165831 CAATTCTAATAGGCTCACCCTGG + Intergenic
958015507 3:87935441-87935463 CACTTGCAGAAGCCTCACCCTGG - Intergenic
963145958 3:141995002-141995024 AACTTGCAACACTCTTACCCAGG + Exonic
966867937 3:184270991-184271013 CTCTTCCAGTAGGCTTGCCCAGG - Intronic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
974213889 4:58818890-58818912 CACATACAATAGAATTACCCAGG + Intergenic
976970199 4:91094254-91094276 CACTTGGACTCGGCTTCCCCAGG - Intronic
979010881 4:115366465-115366487 CACTTGCAATATGCCTAGTCTGG + Intergenic
980073571 4:128268859-128268881 CACTTGAAATGGCCTTACTCAGG - Intergenic
986443127 5:7798501-7798523 CACTTGCAAAAGGCCCACACTGG + Intronic
995033001 5:107500420-107500442 CAGTGGGACTAGGCTTACCCTGG - Intronic
1000535280 5:162471092-162471114 CACTTTCATTAGGCTCTCCCAGG + Intergenic
1002408357 5:179053908-179053930 CACTTGGACTCGGCTTCCCCAGG - Intergenic
1017688284 6:156935746-156935768 CACATGAAATAGACTTATCCAGG - Intronic
1055212914 9:73819872-73819894 CACTGTCAATAGGCTTAGTCAGG - Intergenic
1057456621 9:95218966-95218988 CACTTGCCCTAGCCTTTCCCTGG + Intronic
1193232869 X:79068907-79068929 AACTTGCAAGAGGCATACCTGGG - Intergenic
1194965640 X:100285612-100285634 CATTTGCCATAGACTCACCCTGG - Intergenic
1197304036 X:124818988-124819010 CCCTTGCAATAACCTTACTCTGG - Intronic
1198969896 X:142268686-142268708 CACTTGGACTTGGCTTCCCCAGG + Intergenic
1201680681 Y:16641307-16641329 CACTTGGACTTGGCTTTCCCAGG - Intergenic