ID: 1086233181

View in Genome Browser
Species Human (GRCh38)
Location 11:84594813-84594835
Sequence CAGGTTTCCATGGATACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086233175_1086233181 27 Left 1086233175 11:84594763-84594785 CCTGCCACAGAGGGACTAGTTTA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1086233181 11:84594813-84594835 CAGGTTTCCATGGATACAACTGG 0: 1
1: 0
2: 0
3: 13
4: 132
1086233178_1086233181 1 Left 1086233178 11:84594789-84594811 CCTACTGCAATTATGGAACTGTT 0: 1
1: 0
2: 1
3: 16
4: 151
Right 1086233181 11:84594813-84594835 CAGGTTTCCATGGATACAACTGG 0: 1
1: 0
2: 0
3: 13
4: 132
1086233176_1086233181 23 Left 1086233176 11:84594767-84594789 CCACAGAGGGACTAGTTTAGAGC 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1086233181 11:84594813-84594835 CAGGTTTCCATGGATACAACTGG 0: 1
1: 0
2: 0
3: 13
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086233181 Original CRISPR CAGGTTTCCATGGATACAAC TGG Intronic
900726893 1:4222495-4222517 CAGGTTTCCAGGATTAGAACGGG - Intergenic
901101763 1:6724567-6724589 ATGGTTTCCATGGAAACAAAAGG + Intergenic
902328835 1:15720552-15720574 CTGGTGTTCATGGATAAAACTGG + Intronic
902662412 1:17914273-17914295 TTGGTTTCCATGACTACAACTGG + Intergenic
902974186 1:20076983-20077005 CAGGTTTCCATGGCTACCCTTGG + Intronic
904700948 1:32357813-32357835 CAGGTTACCATGGAGACAGCAGG - Intronic
905590011 1:39155126-39155148 CTGGTCTCCAAGAATACAACTGG + Intronic
905758718 1:40535219-40535241 CAGTCTCCCATGGATACCACAGG - Intronic
909892243 1:81022003-81022025 CAGGATTCCATGGCTAAGACAGG - Intergenic
914749314 1:150522789-150522811 CAAGTTTTCATGTAAACAACAGG - Intergenic
915301708 1:154955399-154955421 CTGGTTTCCATGGAGACAGTGGG - Intronic
919848487 1:201656470-201656492 CAGCTCTCCATGGAAACACCTGG - Intronic
922212852 1:223498787-223498809 TGGGTGTCCATGGACACAACTGG + Intergenic
922570205 1:226630103-226630125 CAGGTTTGCAAGGACACAAACGG + Intergenic
1063771998 10:9214241-9214263 CAGGTTTCCTTGGAGCCAAGAGG + Intergenic
1063852586 10:10209809-10209831 CAGGTCTCCATGGAGCCAATCGG - Intergenic
1065446173 10:25803415-25803437 CAGATTTCCATGTATCCACCAGG - Intergenic
1073203955 10:101758753-101758775 GAGGTTTCCAGGGATCTAACAGG - Intergenic
1074868722 10:117560851-117560873 CTGGTTTACCTGGATCCAACAGG - Intergenic
1075253959 10:120909621-120909643 CAGGTTTCTCTGGATACAGCAGG - Intergenic
1075734738 10:124657393-124657415 CAGGAGTCCATGGATTCCACAGG - Intronic
1076271001 10:129152122-129152144 CAGGTTTTCTTGGGAACAACTGG + Intergenic
1076482263 10:130792384-130792406 CAGGTTTCCAGGGAGACTGCTGG + Intergenic
1078024740 11:7684129-7684151 CAGGTATCCAGGTATAGAACAGG - Intergenic
1082290756 11:50367162-50367184 AAGGTTTCCTTTGATTCAACAGG + Intergenic
1085926219 11:81025398-81025420 AAGGTTTCCATGTATACATAAGG + Intergenic
1086233181 11:84594813-84594835 CAGGTTTCCATGGATACAACTGG + Intronic
1087592281 11:100205865-100205887 CAGTCTTCCATGGATACAGAAGG + Intronic
1089103472 11:115983117-115983139 CAGGATTCCAGGGAAACAAGAGG + Intergenic
1089829661 11:121315756-121315778 CAGGTTAGCATGGCTACAATGGG + Intergenic
1091092229 11:132782275-132782297 TGGGTTTCCATGGAGACAGCTGG + Intronic
1093164355 12:15788863-15788885 CAGGTTACCATGAATATCACTGG + Intronic
1095053522 12:37575339-37575361 CAGTATTCCATGGTTACAGCTGG - Intergenic
1095420493 12:42019201-42019223 GGGGTTTCCAGGGATACACCTGG - Intergenic
1104759526 12:131288701-131288723 CAGGTTTCCCTGCAGAGAACTGG - Intergenic
1105580030 13:21687046-21687068 TATGTTTCCAAGGACACAACAGG + Intronic
1107326279 13:39246577-39246599 CAGGTGTCCATGCAAAGAACAGG + Intergenic
1107741017 13:43450554-43450576 ATGGTTTCCATGGAAAGAACAGG + Intronic
1110245905 13:73324214-73324236 CAGGTTTCTAAGGATACAAAGGG + Intergenic
1111797402 13:92940038-92940060 CAGGTTACCAAGGATACAAAAGG - Intergenic
1113836191 13:113330093-113330115 CGGGTTTCCATGCACACACCCGG - Intronic
1113836256 13:113330392-113330414 CGGGTTTCCATGCACACACCTGG - Intronic
1113836328 13:113330692-113330714 CGGGTTTCCATGCACACACCTGG - Intronic
1113836367 13:113330871-113330893 CGGGTTTCCATGCACACACCTGG - Intronic
1113836429 13:113331150-113331172 CCGGTTTCCATGCACACACCCGG - Intronic
1118654558 14:67932966-67932988 CAGGTTTACACATATACAACAGG - Intronic
1119545325 14:75467708-75467730 CAGGCTTCCATGGATTCACGAGG + Intronic
1120754102 14:88225895-88225917 ATGGTTTCCATGGAGACTACTGG + Intronic
1124424346 15:29551005-29551027 CATGTTTCCTTGGCTACAGCAGG + Intronic
1125405757 15:39351326-39351348 CAGCTTTTCAGGGATGCAACAGG + Intergenic
1125477510 15:40057239-40057261 CAGGTTTCTATTGATAGTACTGG + Intergenic
1130824540 15:87530523-87530545 CAGGATTCAGTGGAGACAACAGG + Intergenic
1135038047 16:19094741-19094763 CACATTTCCATGAATTCAACGGG + Intergenic
1136428992 16:30186261-30186283 GAGGCTTCCATGGGCACAACTGG - Intronic
1141826151 16:86481761-86481783 CAGGTTTTCATGGCTAGAACAGG - Intergenic
1146637855 17:34519406-34519428 CTGGTTTCCATGGAGACAGGTGG - Intergenic
1146781833 17:35681121-35681143 CAAGTTTTCCTGGATAAAACTGG + Intronic
1146941431 17:36846641-36846663 CAGGTTTCCTTGGAGCCACCAGG + Intergenic
1153508341 18:5826828-5826850 CAGGCCTCCATGGACACTACAGG + Intergenic
1155801644 18:30112592-30112614 CAATTTTCCATGGATACCAAGGG - Intergenic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1162929787 19:13952174-13952196 CGGGTTTCCATGGAGACCACAGG - Intronic
1163558730 19:18006875-18006897 CAGGTTTCAATGGATACTAGAGG - Intronic
1164923396 19:32106891-32106913 TAGGTTTGCATGGATCCAAAGGG - Intergenic
1168507215 19:56946346-56946368 CTGGTTTCCATGGCAACAGCTGG - Intergenic
926707055 2:15844315-15844337 CCTGTTTCCATGGAAACACCTGG + Intergenic
927124305 2:19999360-19999382 AAGGTTTCAATGGAGACAAGTGG - Intronic
927381083 2:22479768-22479790 CATGTAGCCATGGATAAAACAGG - Intergenic
927941488 2:27105853-27105875 CATTTTTCTATGCATACAACTGG + Intronic
929584468 2:43105171-43105193 CAGGTCTCCATGGTAGCAACAGG - Intergenic
929904327 2:46032986-46033008 CAGGGTTTCATGTATAGAACTGG + Intronic
932561894 2:72880270-72880292 CATGTTTCCCTGTTTACAACAGG - Intergenic
934608138 2:95713553-95713575 CAGGTTTCCATGGAGGCAGAAGG - Intergenic
936541476 2:113355439-113355461 CAGGTTTCCATGGAGGCAGAAGG - Intergenic
936998733 2:118441961-118441983 CAGGTTTCCAGAGATGGAACTGG - Intergenic
937584423 2:123529106-123529128 CAGACTTCCCTGAATACAACAGG - Intergenic
938582772 2:132662243-132662265 CAGGTTTCCATGTCTAGCACTGG + Intronic
941689333 2:168482641-168482663 CTGTTTTCCATTTATACAACTGG + Intronic
942847868 2:180447580-180447602 CACATTTCCATGTATACTACAGG + Intergenic
946241135 2:218356832-218356854 CTGGTTGCCATGGAGACAGCTGG + Intergenic
947905650 2:233759843-233759865 CAGGTTTCCATGGCGAAAGCGGG + Intronic
1178589606 21:33898379-33898401 CATGTTTCCATGGAGACCCCAGG + Exonic
949881402 3:8663766-8663788 CTGGTTTCCATAGGTACCACAGG + Intronic
954043642 3:47910228-47910250 CATGTTCCCATGGAAACCACAGG - Intronic
959907308 3:111724114-111724136 CAGGATTTCATGGATACAGAAGG + Intronic
961143381 3:124574287-124574309 CAGGTGTCCATGGAAAGAGCTGG + Intronic
962947186 3:140182790-140182812 CAGGATGCCATGGACAGAACTGG - Intronic
966445062 3:179993368-179993390 CAATTTTCCATGGATACCAAGGG - Intronic
969307583 4:6334749-6334771 CCGGTTTCCATGGGGACAGCTGG - Intronic
970222101 4:13821805-13821827 CAGGTTTTCAGGGAGATAACTGG + Intergenic
970573093 4:17401781-17401803 CAGGTTTTGATGGATTCAAAGGG + Intergenic
972919673 4:43922735-43922757 CATGTTTCCTTGGAAACAATAGG + Intergenic
973563892 4:52164256-52164278 CATGTTTCCATGGAGACCATGGG - Intergenic
974508512 4:62807555-62807577 CAGGTCTCCATTGTTACAGCTGG - Intergenic
976844252 4:89469511-89469533 CACATTTTAATGGATACAACTGG + Intergenic
978086501 4:104662165-104662187 CAGGAGTCCATGGATCCAAGAGG - Intergenic
982585046 4:157225263-157225285 CAGGTACCCATGGAAACAAATGG - Intronic
984097818 4:175453400-175453422 CACTTTTCCATGGATACCCCAGG - Intergenic
986034317 5:3923648-3923670 CAGGTGTTCATGGAGACAGCGGG + Intergenic
986081971 5:4404409-4404431 CAAGTTTCCAGGAATACAGCAGG - Intergenic
987199213 5:15557731-15557753 TGGGTTTCCATTGATCCAACAGG - Intronic
995297809 5:110540443-110540465 CAGGTTTCAAGGGTTACATCTGG - Intronic
995739691 5:115342781-115342803 CAGATTTCACTGGATAAAACAGG + Intergenic
996021188 5:118592441-118592463 GAGGTCACCATGGATACATCTGG + Intergenic
1001228008 5:169962375-169962397 AAGGTTTCCATAGAGGCAACCGG + Intronic
1002008681 5:176258438-176258460 CAGGTTTCCAAGGGAACATCAGG + Intronic
1002218041 5:177653813-177653835 CAGGTTTCCAAGGGAACATCAGG - Intergenic
1002220378 5:177674973-177674995 CATGTTTGGATGTATACAACTGG - Intergenic
1007026065 6:38575988-38576010 CACGTTTCCATACATACAACAGG + Intronic
1009777173 6:68219204-68219226 CAGCTTTCCATGGCTAGAAGAGG + Intergenic
1009923358 6:70090928-70090950 CAGCTTTCCCTGGATGCACCTGG + Intronic
1011064142 6:83306483-83306505 TAGGTAACAATGGATACAACAGG + Intronic
1014303868 6:119716154-119716176 CAAGTTTCTAAGGTTACAACTGG + Intergenic
1016217967 6:141626281-141626303 GAGCTATCCATGGATACAACTGG - Intergenic
1016711986 6:147184278-147184300 CAGGTTTTCAAGGACACCACTGG + Intergenic
1018568757 6:165185137-165185159 CAGGTCTCCACAGATAAAACTGG + Intergenic
1018882547 6:167899346-167899368 CTGGTTTCCTTGGATGCCACAGG - Intronic
1023267005 7:38417239-38417261 CAGGTTTCCAGGCAGACAAATGG + Intronic
1023860647 7:44216102-44216124 CAGGTTGCCATGGAGACATGAGG + Intergenic
1023951898 7:44852866-44852888 CAGGTTTCCCAGGAAACAAATGG - Intergenic
1024686140 7:51747682-51747704 CAGTTCCCCATGGATACAAAGGG - Intergenic
1025797818 7:64756346-64756368 CAGCTTGCCATGGTTACCACAGG - Intergenic
1027882194 7:83854760-83854782 CAGCTTTCCATGGCTTCCACTGG - Intergenic
1028449963 7:90970719-90970741 AAGGTTTCCATGGAGACTGCTGG + Intronic
1029091434 7:98051321-98051343 CTGGTTACCATGGATACAGCAGG - Intergenic
1029210643 7:98905540-98905562 CAGGGTTCTATAGAAACAACCGG - Intronic
1029534386 7:101147582-101147604 CATGTTTCCATTTATACAAGTGG + Intergenic
1035213471 7:157346802-157346824 CAGGTTTCCTTGGAGACACGTGG + Intronic
1035688684 8:1545705-1545727 CATGTTTCCATGCATCCATCAGG + Intronic
1037054708 8:14425165-14425187 CAGGGTTTCATGAATACCACGGG + Intronic
1039143714 8:34421697-34421719 CAGTTTGCCATGGTTACTACAGG + Intergenic
1049422630 8:142523714-142523736 CAGGTTTCCATGGGCACCACAGG + Intronic
1049675002 8:143885437-143885459 CTGGTTTCCCTGGAAACAAGTGG - Intergenic
1050870652 9:10564603-10564625 CAGTTAGCCATGGATTCAACAGG - Intronic
1055042236 9:71886709-71886731 CAGGGTTTCATGGATGAAACGGG + Intronic
1056185872 9:84134481-84134503 TAGGTTTCCATGGATAGGGCTGG - Intergenic
1057207978 9:93184667-93184689 CAGGGTTCCAGGGACACCACAGG + Intergenic
1057847701 9:98538370-98538392 CAGGGTTCCATGGAGAGAATTGG - Intronic
1058556984 9:106179624-106179646 CAGGTTTCCAGGAATAAAAAGGG - Intergenic
1058801414 9:108547874-108547896 CAGATTTCCATGTATAGAACTGG + Intergenic
1062359263 9:136179869-136179891 CAGGTATCCATGAACACACCAGG - Intergenic
1192175054 X:68880211-68880233 CAGCTCTCCAAGGATGCAACTGG - Intergenic
1196914096 X:120513958-120513980 GAGGTTTCCATGGAAGGAACAGG - Intergenic
1197854342 X:130899300-130899322 CAGATTTGCATGAATATAACTGG - Intronic
1199025458 X:142931944-142931966 CAGGTATGCATGTATACAAATGG + Intergenic
1199315052 X:146367057-146367079 CAGATTTACATGGATACACGTGG + Intergenic