ID: 1086236325

View in Genome Browser
Species Human (GRCh38)
Location 11:84635318-84635340
Sequence GTGGTAATGGGCATCAGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086236325_1086236331 15 Left 1086236325 11:84635318-84635340 CCAATACTGATGCCCATTACCAC 0: 1
1: 0
2: 1
3: 10
4: 77
Right 1086236331 11:84635356-84635378 TAAAAGCCCAATGTCTACTGTGG 0: 1
1: 0
2: 2
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086236325 Original CRISPR GTGGTAATGGGCATCAGTAT TGG (reversed) Intronic
905148573 1:35907764-35907786 GTGGTAATGTGCATTAGGATGGG - Intronic
905849598 1:41263785-41263807 GTGGTAAAAGTCATCAGTAAAGG - Intergenic
909315649 1:74214540-74214562 GTGGGAATGGGCCTGAGCATAGG - Intronic
918192798 1:182192251-182192273 GAGGAAATGGGCATCAGTGTAGG + Intergenic
922098519 1:222462806-222462828 GAGATAACGTGCATCAGTATTGG + Intergenic
922505769 1:226124585-226124607 GTGGGAATGGGCCTGAGTGTAGG - Intergenic
923190752 1:231618214-231618236 GTTGCAATGTGCATCAGTTTTGG + Intronic
1063322613 10:5065604-5065626 GTGGTAATGGGCATGAGCATAGG + Intronic
1065017603 10:21476251-21476273 GATGTGATGGGCATCAGTATAGG + Intergenic
1070267250 10:74915785-74915807 GTGGCAATGAGCAGCAATATGGG - Intronic
1075591655 10:123695973-123695995 GTGGTAATGGGCATCAGGCAAGG - Intergenic
1076447863 10:130530713-130530735 GTTGAAATGTGCATCAGGATCGG - Intergenic
1077157849 11:1099359-1099381 GTGGTGATGGGCGTCAATGTTGG - Intergenic
1077703509 11:4462705-4462727 GTAGTAATGGAGATAAGTATTGG - Intergenic
1079319086 11:19435666-19435688 GTGGTACTGTAAATCAGTATAGG - Intronic
1086236325 11:84635318-84635340 GTGGTAATGGGCATCAGTATTGG - Intronic
1087627160 11:100608194-100608216 GAAGTAAAGGGCATCTGTATAGG + Intergenic
1093786657 12:23199596-23199618 GTGGTACTGGGATTCAGTACTGG + Intergenic
1108389312 13:49932583-49932605 GTGGTAGTGGCCACAAGTATGGG - Intronic
1108467147 13:50727753-50727775 GGTGTAATGGGGATCAGTGTAGG - Intronic
1109854592 13:68110731-68110753 GGGGTATTGGGTATGAGTATGGG - Intergenic
1111959723 13:94796963-94796985 GTGTGATTGGGCATCAGTATGGG + Intergenic
1116641659 14:47470992-47471014 GTGGCAATGGGCAGAAATATGGG + Intronic
1118260458 14:64241866-64241888 GAGGTAAAAGGCATCAATATTGG - Intronic
1121175394 14:91887173-91887195 GTGGTAATGGGCTTTCGCATTGG - Exonic
1122654219 14:103246556-103246578 GTGGTAGTGGGCCTGAGCATAGG - Intergenic
1125454822 15:39846367-39846389 ATGGTAACAGGCATCAGTAGAGG + Intronic
1125682775 15:41543092-41543114 GGGGTTATGGGCACCAGTTTTGG + Intronic
1127762373 15:62151717-62151739 GTTTTGATGGGCCTCAGTATAGG + Intergenic
1129087226 15:73107814-73107836 GGGTGAATGTGCATCAGTATTGG + Intronic
1135234976 16:20746783-20746805 GAGGTGATGGGGATCAGTATAGG - Intronic
1143280206 17:5748249-5748271 CTGGCAATTGGCATCAGAATTGG + Intergenic
1143720096 17:8803295-8803317 GTGTTGATGGGCATCAGAAGGGG + Exonic
1149943654 17:60898708-60898730 GTGGCAATGGTGAACAGTATGGG + Intronic
1150846343 17:68662604-68662626 GTGGTTATGGGCATATGCATTGG - Intergenic
1155312761 18:24540609-24540631 GTGGTCATGGGGATTAGTAAGGG + Intergenic
1157796546 18:50580319-50580341 GTGGGAATGGGCTGCAGGATTGG + Intronic
1158736981 18:60093558-60093580 ATGGTTATGGGCATGAGTTTTGG - Intergenic
1166500172 19:43334561-43334583 GTGGGACTGGGCATGAGGATTGG - Intergenic
925731809 2:6924455-6924477 GTGGAAATGGGACTCAGCATAGG + Intronic
927602863 2:24459628-24459650 ATAGTAATGGGCCTCACTATGGG + Intergenic
929175790 2:38974479-38974501 GTGGTTATGGAAATCAGTAAAGG + Exonic
930213659 2:48670458-48670480 TTGGGAATGGGCTTCTGTATTGG + Intronic
930357532 2:50340887-50340909 GTGGTGATGGTCAACAGTAAAGG + Intronic
933144393 2:78833724-78833746 GTGGTGTTGGGCATCAGAACTGG - Intergenic
934853752 2:97716723-97716745 GTGGTGATGGGCATCATGAAGGG + Intronic
935512622 2:103994838-103994860 GTGTTTATGGGCATGAGCATTGG - Intergenic
938193985 2:129309777-129309799 GTGGTAGTGGGCAGCAATATTGG + Intergenic
939598194 2:144154236-144154258 GAGGTAATGACCATCAGTAAAGG + Intronic
942616153 2:177793894-177793916 GCAGGAATGGGCACCAGTATTGG + Intronic
942790125 2:179751766-179751788 GTGGGAATGGACAGCAGGATTGG - Intronic
946730836 2:222707819-222707841 GTGATAAATGACATCAGTATGGG - Intronic
1173633738 20:44536564-44536586 GTGGGAAGGGGCATCAGTCCTGG + Intronic
1185046272 22:48530116-48530138 GTGGTACAGGTCATCAGTACAGG - Intronic
1185072781 22:48666488-48666510 CTGGTCATGGGCCTCAGTATTGG - Intronic
949247887 3:1946760-1946782 GTGCCAGTGGGCATCAGTAGGGG - Intergenic
951171403 3:19546004-19546026 GTGGGAATGGGCCTCTATATTGG + Intergenic
951445410 3:22774146-22774168 GTGGTCCTGGGCATCATTGTAGG + Intergenic
952113182 3:30148476-30148498 ATGCTAATTGGCATCAGTTTAGG - Intergenic
954417335 3:50399739-50399761 GTGGTAAAGCCCAGCAGTATTGG + Intronic
962429809 3:135308576-135308598 GTGGTAATGGACAAAAATATGGG - Intergenic
968214538 3:196877318-196877340 GTGGTGGTGGGCACCAGTAATGG - Intronic
972746510 4:41937798-41937820 GTGGTAATAGACATAAGTATTGG + Intronic
973025815 4:45269062-45269084 GTGGTGAGGTGCACCAGTATGGG - Intergenic
976299298 4:83502897-83502919 GTGGTGATGGACACCAGTTTTGG - Intronic
983833006 4:172353786-172353808 ATGGTAATGTGGATCATTATAGG - Intronic
990120354 5:52443543-52443565 TTGGCAATGGGCATCACTCTTGG - Intergenic
996979076 5:129468168-129468190 ATGTTAAAGGGCATGAGTATTGG + Intronic
1002182357 5:177437300-177437322 GAGGCAATGGGCATCAGCTTTGG - Intronic
1003267029 6:4574924-4574946 GTGGTAGAGGGCATGAGTATTGG + Intergenic
1005123348 6:22416263-22416285 GTGGGAATGTAAATCAGTATAGG - Intergenic
1008134434 6:47757448-47757470 TTGGAAATGGTCAACAGTATTGG + Intergenic
1017480318 6:154847063-154847085 ATTGTAATGTCCATCAGTATTGG + Intronic
1027473742 7:78604450-78604472 GAGATAATGGGATTCAGTATGGG - Intronic
1030143834 7:106332646-106332668 GTGGGAGTGAGCATGAGTATAGG - Intergenic
1031031286 7:116738245-116738267 GGGGTATTGGGCAGGAGTATAGG + Intronic
1032201806 7:129827486-129827508 GTGGAAATGGGGATGTGTATGGG + Intergenic
1038961743 8:32527754-32527776 ATTGAAATGGGCATCAGTTTGGG - Intronic
1039474830 8:37834126-37834148 GTGGTAATGGGGGTCAGCAGAGG + Exonic
1039940406 8:42085314-42085336 GTGGAAATGGGGATCACTAGTGG + Intergenic
1040739706 8:50558074-50558096 GAGGAAATGTGCATCAGTACAGG - Intronic
1041866854 8:62583613-62583635 GTGGTAGTGGGCAGCAGAACTGG + Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043458080 8:80431981-80432003 GTGGGAATGGGCCTAAGCATAGG + Intergenic
1059323327 9:113486171-113486193 GTAATAAAGGCCATCAGTATGGG + Intronic
1060300443 9:122371687-122371709 CTGGCAATGGGAATCAGGATGGG - Intronic
1194430217 X:93794580-93794602 CTGGAAATGGGCATCAGTTCAGG - Intergenic
1199357721 X:146881083-146881105 GTGGGAATGGGCCTGAGCATAGG - Intergenic
1201423813 Y:13828049-13828071 GTGGGGATTGGAATCAGTATTGG - Intergenic