ID: 1086236713

View in Genome Browser
Species Human (GRCh38)
Location 11:84640250-84640272
Sequence GTGCAGACCTCGTCTTGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086236713_1086236717 17 Left 1086236713 11:84640250-84640272 CCATTACAAGACGAGGTCTGCAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1086236717 11:84640290-84640312 AATGTCGTTATCTAGGAGAATGG 0: 1
1: 1
2: 4
3: 23
4: 134
1086236713_1086236718 18 Left 1086236713 11:84640250-84640272 CCATTACAAGACGAGGTCTGCAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1086236718 11:84640291-84640313 ATGTCGTTATCTAGGAGAATGGG 0: 1
1: 1
2: 3
3: 13
4: 79
1086236713_1086236715 10 Left 1086236713 11:84640250-84640272 CCATTACAAGACGAGGTCTGCAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1086236715 11:84640283-84640305 CCCTATCAATGTCGTTATCTAGG 0: 1
1: 0
2: 1
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086236713 Original CRISPR GTGCAGACCTCGTCTTGTAA TGG (reversed) Intronic
909491150 1:76227897-76227919 GTGCTGAGCTCCTTTTGTAAGGG + Intronic
913450882 1:118991747-118991769 GTCCAGGCCTAGTCTTGGAAGGG + Intergenic
919601609 1:199629839-199629861 GTGCAGACCACATCCTGTAGAGG - Intergenic
1074252767 10:111769085-111769107 CTGCAGACCTCCTCATGTCAAGG - Intergenic
1077265328 11:1645680-1645702 ATGCAGACCTCGGCTGGTTATGG - Intergenic
1086236713 11:84640250-84640272 GTGCAGACCTCGTCTTGTAATGG - Intronic
1093188237 12:16046614-16046636 ATGCAAACATGGTCTTGTAATGG + Intergenic
1098356598 12:69618207-69618229 GTGCAGAACTGGTCTTGTGATGG + Intergenic
1101659182 12:106750769-106750791 GTGCAGAGCTCCTGTGGTAAGGG - Exonic
1101907477 12:108838503-108838525 GTGCAGGCCTCCTATTGTGAAGG + Intronic
1102323050 12:111955463-111955485 GTGCAGAGCTAGTCATCTAAGGG + Intronic
1105600805 13:21885347-21885369 CTGCTGACTTCCTCTTGTAAGGG - Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1128279078 15:66379630-66379652 ACACAGACCTCATCTTGTAACGG + Intronic
1128921567 15:71615110-71615132 GTGCAGATTTGGTTTTGTAAGGG + Intronic
1130262865 15:82372603-82372625 ACACAGACCTCATCTTGTAACGG + Intergenic
1133484044 16:6201272-6201294 GTGCAGACCTCTTCTTTATAAGG + Intronic
1138227429 16:55309463-55309485 GTGCATAACTGGCCTTGTAAAGG - Intergenic
1146088859 17:29856016-29856038 GCACAGACCTCATCTTGTAATGG - Intronic
1164660097 19:29956703-29956725 ACACAGACCTCATCTTGTAATGG + Intronic
926725343 2:15993299-15993321 GTGCAGAGCCCGTCCTGGAATGG + Intergenic
928740210 2:34342650-34342672 ATGCAGATCTGGCCTTGTAAAGG - Intergenic
928923236 2:36548216-36548238 GTGCAGACCTTGTGTTTCAAGGG - Intronic
933221554 2:79695846-79695868 GAGCAGACCTCCTCTTGGTAGGG - Intronic
941357140 2:164508138-164508160 GTGCAGACTTAGTCATGTATAGG + Intronic
941365538 2:164606570-164606592 GTGCAGGCATGGTTTTGTAAAGG + Intronic
941641738 2:167996402-167996424 GTACAGACTTCTTCTTATAATGG - Intronic
1174679334 20:52390129-52390151 GTACATATCTCGTATTGTAAGGG - Intergenic
1176662264 21:9648460-9648482 GTGCAGACCTCTTGGTGTCAAGG + Intergenic
950956454 3:17058514-17058536 GGGCAGGCCTGGTCTTGAAAGGG + Intronic
952938901 3:38425043-38425065 GTGCATTCCTCGTCTTTTACAGG + Intergenic
953650900 3:44802719-44802741 GTGCATACCTAGTTTTCTAATGG + Intronic
959573054 3:107906254-107906276 GTGCAGACATTGCCTTGAAAAGG - Intergenic
961859598 3:129904999-129905021 GTGCATTCCTCGTCTTTTACAGG + Intergenic
964666690 3:159182362-159182384 GTGCAGAACTCCACATGTAAAGG - Intronic
972476615 4:39456511-39456533 ACACAGACCTCATCTTGTAACGG + Exonic
985413129 4:189708067-189708089 GTGCAGACCTCTTGGTGTCAAGG - Intergenic
988146067 5:27310159-27310181 GTGAAGACTTCCTCTTTTAAGGG - Intergenic
988505899 5:31822851-31822873 ACACAGACCTCATCTTGTAACGG + Intronic
993908341 5:93649365-93649387 GTGCAGAGCTCTTCTTTGAAGGG - Intronic
997885512 5:137626378-137626400 ATGTAGACCCAGTCTTGTAAAGG - Intronic
1002580510 5:180207514-180207536 GTGCAGACCCCGGCCTGAAAAGG + Intronic
1020502336 7:8939058-8939080 GCACAGATCTCTTCTTGTAATGG - Intergenic
1029460152 7:100689631-100689653 GAGCAGGCCTCGGCTTGTCATGG - Intergenic
1034994920 7:155571269-155571291 GTGGAGACCTCAACTGGTAATGG - Intergenic
1042446704 8:68893264-68893286 GTGCATTCCTCGTCTTTTACAGG + Intergenic
1046665627 8:116999304-116999326 GTCCAGACCAGGTCTTCTAAAGG - Intronic
1187879894 X:23837035-23837057 ACACAGACCTCATCTTGTAACGG + Intronic
1195458015 X:105091220-105091242 CTTCAGACCATGTCTTGTAAAGG - Intronic