ID: 1086243080

View in Genome Browser
Species Human (GRCh38)
Location 11:84720039-84720061
Sequence CTACAAGAGCAGATGCAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086243080_1086243081 -1 Left 1086243080 11:84720039-84720061 CCGAGCTGCATCTGCTCTTGTAG 0: 1
1: 0
2: 1
3: 12
4: 155
Right 1086243081 11:84720061-84720083 GCCTCTGTATGTTAGAGACCAGG 0: 1
1: 0
2: 1
3: 9
4: 105
1086243080_1086243083 0 Left 1086243080 11:84720039-84720061 CCGAGCTGCATCTGCTCTTGTAG 0: 1
1: 0
2: 1
3: 12
4: 155
Right 1086243083 11:84720062-84720084 CCTCTGTATGTTAGAGACCAGGG 0: 1
1: 0
2: 3
3: 20
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086243080 Original CRISPR CTACAAGAGCAGATGCAGCT CGG (reversed) Intronic
902555570 1:17244667-17244689 TTCCAAGAGCAGAGGCAGCCTGG - Exonic
904959502 1:34320949-34320971 CTAAAAGAGCAGATGATGCCAGG + Intergenic
905811843 1:40918848-40918870 CTAGAGGAGCAGCAGCAGCTTGG - Intergenic
906163169 1:43666193-43666215 CTATAAGAACAGAGGCAGCTTGG + Intronic
908890187 1:68837693-68837715 CTACAAAGGCAGATTGAGCTTGG - Intergenic
915853423 1:159352865-159352887 CTTCAGAAGCAGATGCAGATGGG + Intergenic
920086798 1:203423337-203423359 TTAGGAGAGCAGATGTAGCTTGG - Intergenic
920355095 1:205366060-205366082 CTACAACAGGAGAGTCAGCTAGG - Intergenic
920758321 1:208756955-208756977 ATACAGGAGCAGATGCAGACTGG - Intergenic
1063921837 10:10941162-10941184 AAACAAGAGCAGAAGGAGCTTGG + Intergenic
1068139282 10:52984337-52984359 CTCCAAGAACACATGTAGCTAGG - Intergenic
1069411097 10:68154293-68154315 CTGCCAGAGCAGCTGCTGCTGGG - Intronic
1070591661 10:77806093-77806115 CTACTACAGCATATTCAGCTCGG + Intronic
1071506083 10:86232473-86232495 ATACAACAGGAGAGGCAGCTGGG - Intronic
1071577422 10:86739472-86739494 ATACAAGAGGAGAAGCAGGTTGG - Intergenic
1072566414 10:96620440-96620462 CTCCAGGAGCAGGTGAAGCTGGG - Exonic
1072944680 10:99799059-99799081 CTAGAAGGGCAGAAGCAACTAGG + Intronic
1078836529 11:15035411-15035433 CTCCAAGAGCACAGGAAGCTCGG + Intronic
1079318146 11:19427378-19427400 ATAGAAGAGCACATGCAGCTAGG + Intronic
1083964741 11:66036393-66036415 CTACAAGAGGGGATATAGCTGGG + Intergenic
1084701835 11:70791376-70791398 ATGCAAGAGGAGATGCATCTTGG - Intronic
1085641202 11:78194025-78194047 CTACAAGCTCAGATGCGGCCGGG - Intronic
1086146985 11:83562873-83562895 CTTAAAGACCAGATGCAGATTGG - Intronic
1086243080 11:84720039-84720061 CTACAAGAGCAGATGCAGCTCGG - Intronic
1088112126 11:106274346-106274368 CTACAAAAGCATTTGCAGCAAGG - Intergenic
1088180505 11:107103939-107103961 CCACCACTGCAGATGCAGCTGGG + Intergenic
1090911263 11:131121632-131121654 CTACATGGGAAGATGAAGCTGGG + Intergenic
1091164695 11:133464796-133464818 GTACAAGAGCGGAGGCTGCTGGG + Intronic
1091286380 11:134410969-134410991 CTACAAGAATCCATGCAGCTAGG + Intronic
1092123495 12:6060388-6060410 GTGCAAGAGGAGGTGCAGCTAGG - Intronic
1092161958 12:6320110-6320132 GTACAAGAGTAGACGCAGCAGGG + Intronic
1092943876 12:13435581-13435603 ATACAACTTCAGATGCAGCTTGG - Intergenic
1093498576 12:19784148-19784170 CTGCATTAGCAGCTGCAGCTGGG - Intergenic
1095450032 12:42320743-42320765 GAACAAAAGCAAATGCAGCTGGG - Intronic
1095689297 12:45069258-45069280 CGACTAGAGCTGAAGCAGCTGGG + Intergenic
1096181530 12:49553768-49553790 CTTGTAGAGCAGAGGCAGCTAGG + Intronic
1096817057 12:54208475-54208497 CTAGAAGAGCAGAGGAAGATGGG + Intergenic
1098359500 12:69641137-69641159 CTAAAAGAGCAGATACAGGGTGG - Intergenic
1100961956 12:99972540-99972562 CATCAAGAGCTGATGGAGCTGGG + Intronic
1102143497 12:110636692-110636714 CCACAACAACAGAGGCAGCTGGG - Intronic
1104369794 12:128214656-128214678 CTTCAAGACCAGATACACCTTGG - Intergenic
1105278051 13:18947642-18947664 GTACAGGTGTAGATGCAGCTGGG - Intergenic
1106397994 13:29399999-29400021 CTACAAAAGGAGAAGCAGATAGG + Intronic
1106445937 13:29830950-29830972 CAACAACAGCAGATACAGCAAGG - Intronic
1110961927 13:81637582-81637604 CTATAAAAGCAGCTGCAGTTGGG + Intergenic
1113910886 13:113840721-113840743 CTGGCAGAGCAGAAGCAGCTCGG + Intronic
1116789014 14:49319580-49319602 CTAGAAAAGCAGATGGACCTGGG - Intergenic
1118483644 14:66193406-66193428 TTACAACAGCAGATGCATATGGG + Intergenic
1123017419 14:105382041-105382063 CTACAGGTGCAGCTGCAGGTGGG + Exonic
1126097539 15:45100169-45100191 CTGCAAGAGAAGATGCAGCGAGG - Exonic
1127792575 15:62411484-62411506 CTACAAGGGCCAATGCAGCATGG - Intronic
1136144623 16:28309130-28309152 CCACAAGAGAAGAAGCACCTGGG - Intronic
1136280949 16:29210924-29210946 CAACCAGAACAGATGCAGCACGG + Intergenic
1138155577 16:54700166-54700188 CTCCAAGAGGACATGCAGCCAGG + Intergenic
1138410295 16:56834019-56834041 CTGCAGGAGTAGATGCTGCTGGG + Intronic
1138728940 16:59173425-59173447 CTACAAGGTCTGCTGCAGCTTGG + Intergenic
1139701818 16:68712347-68712369 CAACAAGAGCAGCTGGAGCTGGG + Intronic
1141781524 16:86165111-86165133 AAACAAGAGCAGGTGCAGCAGGG + Intergenic
1142085307 16:88176847-88176869 CAACCAGAACAGATGCAGCACGG + Intergenic
1142980832 17:3670329-3670351 CTCCCAGAGGAGATACAGCTAGG + Exonic
1144001754 17:11061655-11061677 CTAAAAAAGCAGCTGCAGATGGG - Intergenic
1146638253 17:34521762-34521784 CCACAAGAGCAGCTGATGCTTGG + Intergenic
1147196306 17:38769136-38769158 AGACAAGAGCAAATGCAGCAGGG + Exonic
1147772428 17:42877249-42877271 CTACAAGACCTGAGGCAGCAGGG - Intergenic
1150069415 17:62138936-62138958 CTGCCAGTGCAGATGGAGCTGGG - Intergenic
1150128333 17:62652954-62652976 CTCCAAGAGCAGGTGGATCTGGG + Intronic
1150635321 17:66909031-66909053 ACAGAAGAGCAGATGAAGCTGGG - Intergenic
1150978091 17:70111340-70111362 CAAAAAGAGGAGATGGAGCTGGG + Intronic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1157722510 18:49936320-49936342 CTCCATGAGCAGATGCAGGGAGG + Exonic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158559398 18:58500939-58500961 CTAAATGAGCAAATGCAGCCAGG + Intronic
1160727112 19:622273-622295 CTGCCAGTGCAGATGGAGCTGGG - Exonic
1166331768 19:42081911-42081933 CCCCAAGAGCAAATGCAGGTAGG + Intergenic
926292556 2:11542336-11542358 CTCCAAGAGCAGATGCAGCCGGG - Intronic
926428990 2:12766917-12766939 CCACAAGTGCAGATGCAACCTGG + Intergenic
926597284 2:14805105-14805127 CCACAGGATCAGAAGCAGCTGGG + Intergenic
927614122 2:24572668-24572690 GTAAAATAGCAGGTGCAGCTCGG - Intronic
928181227 2:29070467-29070489 CTCCAAGAGAAGAGGCAGTTGGG - Intronic
929902204 2:46015028-46015050 CTACAAGATCAGATGCCTATCGG + Intronic
932055658 2:68440646-68440668 CTACAAGATGAGATTCAGGTGGG + Intergenic
932624449 2:73286062-73286084 CTGCAAGAGCAGATGGATTTGGG - Intergenic
933317876 2:80736987-80737009 CTACCTGAGAAGATCCAGCTTGG + Intergenic
936704698 2:115058323-115058345 CTAAAAGAGCAGTAGAAGCTGGG - Intronic
946812356 2:223539390-223539412 CTAGAACAGCAGACCCAGCTGGG + Intergenic
947633968 2:231670948-231670970 CTACAAGTTCAGATCCAGCCTGG - Intergenic
948005760 2:234606322-234606344 CTACAAGAGCACCTGGCGCTTGG + Intergenic
948459184 2:238120958-238120980 TTCCAAGAGCAGCAGCAGCTTGG + Intronic
1170322818 20:15119395-15119417 GTACAACAGCAGAGCCAGCTAGG - Intronic
1173344777 20:42188966-42188988 CTCAAAGAGCATATGAAGCTGGG + Intronic
1173905840 20:46628133-46628155 CTTCAAGGGCAGATTCAGGTAGG + Intronic
1174626465 20:51918917-51918939 CTTCAAGAGCTGATGCAGGTGGG + Intergenic
1174925087 20:54750518-54750540 CTTCAAGAGCCCATGCAGATTGG - Intergenic
1175084305 20:56445803-56445825 CTCCAAAAGCAGAGACAGCTGGG - Intronic
1177496166 21:21894898-21894920 CTACTGGAGCTGAAGCAGCTGGG + Intergenic
1179305860 21:40153554-40153576 GTACAAGCACAGATGAAGCTAGG + Intronic
1183468003 22:37989790-37989812 CTGCAAGTGCAGCTGCAGGTTGG + Intronic
949912060 3:8919644-8919666 CTATTTGAGCAGATGAAGCTGGG - Intronic
950762363 3:15243357-15243379 CTCCAAATGAAGATGCAGCTAGG + Intronic
950841754 3:15974698-15974720 CTACAGGAGCTGCTGCAGCTGGG + Intergenic
953735546 3:45491351-45491373 CTACAAAGGCAGAAGCACCTAGG + Intronic
957216392 3:77325385-77325407 ATACCAGAGCAGACGCAACTGGG + Intronic
960254273 3:115494980-115495002 GTGCAAGAGCAAATGCTGCTGGG - Intergenic
960853356 3:122078367-122078389 CTTCTAGAGCAGAGGCTGCTCGG - Intronic
962759578 3:138497290-138497312 TTAGAAGAGGAGATGAAGCTTGG - Intronic
963736767 3:149026176-149026198 CTACAAGAACAGATGCTACTTGG + Intronic
965493772 3:169372680-169372702 AGACAACAGCAGAAGCAGCTTGG - Intronic
965731322 3:171774979-171775001 CTGAAGGAGCAGCTGCAGCTGGG + Intronic
969160561 4:5254078-5254100 CTACAAAAAAAGATTCAGCTGGG - Intronic
971419787 4:26464876-26464898 CTCCAACAGCAGATCCAGCCTGG + Intergenic
972307032 4:37840682-37840704 CTCTAAAATCAGATGCAGCTGGG - Intronic
972328959 4:38046067-38046089 ATAAAAGAGCAGATGGGGCTGGG + Intronic
977282992 4:95065775-95065797 CTACAAGAAAATATGCAACTAGG + Intronic
977991333 4:103445990-103446012 CTACAATAGCAGCTGCAGACTGG - Intergenic
978810252 4:112841765-112841787 CTACAAGTGCGGACACAGCTAGG - Intronic
981923208 4:150109630-150109652 CTACAAAAGGAAATGCAGCCAGG - Intronic
983760543 4:171400900-171400922 CTACAAGGACATATGAAGCTAGG + Intergenic
984003060 4:174274147-174274169 CTGAAAGAGCAGCTGCAGCTGGG - Intronic
986248113 5:6029433-6029455 CTGGAAGAGCAAAGGCAGCTGGG + Intergenic
986572463 5:9179805-9179827 CTGTAAGAGCAGATGCAGTGTGG + Intronic
986899236 5:12412114-12412136 CTCCTAAAGCAGATACAGCTTGG - Intergenic
987526696 5:19059827-19059849 CTTCTAGAGCAGATCAAGCTGGG - Intergenic
991677833 5:69106220-69106242 CCACAGTAGCAGCTGCAGCTTGG + Intronic
992855025 5:80850707-80850729 CTACAAGAAAAGATGTGGCTGGG + Intronic
998565175 5:143210412-143210434 CTACAAGATGAGATTCAGGTGGG + Intronic
998954667 5:147426792-147426814 TTAGAAGAGCAGAGGAAGCTAGG - Intronic
999272396 5:150304206-150304228 CTAGGAGAGAAGATGCACCTGGG - Intronic
1004498742 6:16189745-16189767 AAACAAGAGAAGAGGCAGCTTGG - Intergenic
1006234461 6:32616427-32616449 CAATAAGAGGAGGTGCAGCTGGG + Intergenic
1006309901 6:33250090-33250112 CTAAAATAGCAGATGCTGCAAGG - Intergenic
1011141370 6:84161136-84161158 CTACTAGAGCATAAGCATCTTGG - Intronic
1015263116 6:131261162-131261184 CAACAAGAGCGAATGCAGCCTGG + Intronic
1015881339 6:137873055-137873077 CTACAAAAGCAGGTGCATTTTGG + Intronic
1018766857 6:166940831-166940853 CACCAAGAGCAGATGCAGCCAGG + Intronic
1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG + Intergenic
1019653558 7:2173962-2173984 CAACAATAGCAGCAGCAGCTGGG - Intronic
1022214050 7:28240610-28240632 CTACAGGAGCAGAGGCAACCGGG + Intergenic
1023019569 7:35998636-35998658 CTACAAGATGAGATGTAGGTGGG - Intergenic
1028856471 7:95598740-95598762 CTACAAGTGGAGATGCAATTTGG - Intergenic
1031033008 7:116755087-116755109 GACAAAGAGCAGATGCAGCTTGG - Intronic
1031685169 7:124724575-124724597 TTCCAGGGGCAGATGCAGCTGGG + Intergenic
1035451345 7:158979129-158979151 CTACAGCTGCAGATGGAGCTGGG + Intergenic
1035968428 8:4220838-4220860 CTACAAGAGGAAAAGTAGCTTGG + Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1038132402 8:24747495-24747517 CTTCAAGAGTAGATCCAGCCTGG + Intergenic
1038351402 8:26779479-26779501 CTGTAAGAGCAGATGCTTCTAGG + Intronic
1039603609 8:38863202-38863224 CAAAAAGAGCAGGTGCGGCTGGG + Intergenic
1042660934 8:71153625-71153647 CTACAAGATGAGATTCAGTTGGG + Intergenic
1044856375 8:96480254-96480276 CTGGAATACCAGATGCAGCTGGG - Intergenic
1045675847 8:104607482-104607504 CTGCCACAGCTGATGCAGCTGGG - Intronic
1049315458 8:141964636-141964658 CTCCAGGCGCAGGTGCAGCTGGG + Intergenic
1053002038 9:34582350-34582372 CTCAGAGAGCAGAAGCAGCTTGG + Intronic
1053545376 9:39017955-39017977 CAGAAAGAGGAGATGCAGCTGGG - Intergenic
1054811994 9:69442331-69442353 CTATAAGAGCTGAGGCAGCGGGG + Intronic
1055633023 9:78243584-78243606 CTGCAAAAGCACATGCACCTAGG - Exonic
1055956001 9:81773971-81773993 ATACAAGAGGAGAAGCAGGTTGG - Intergenic
1058273218 9:103002645-103002667 CTACAAGAGTAAATGCAGCCAGG - Intronic
1058938159 9:109788557-109788579 CCAGAATAGCAGTTGCAGCTGGG - Intronic
1059332807 9:113546782-113546804 CTACAGCAGCAGCTCCAGCTGGG - Intronic
1060291929 9:122311224-122311246 ATACAAGATCAGAAGCAGTTAGG - Intronic
1061625666 9:131839291-131839313 CTCCAAGCTCAGCTGCAGCTGGG - Intergenic
1188833705 X:34931773-34931795 CTACAAGAGCAAGTCAAGCTTGG - Intergenic
1193556573 X:82961101-82961123 CCACAAGAGCAGTTCTAGCTGGG + Intergenic
1193823014 X:86189470-86189492 GGACAAGAGCATATGCAGATAGG + Intronic
1195407597 X:104533484-104533506 CTAGAACAGCAGCTGCAACTTGG + Intergenic
1195765103 X:108287814-108287836 GTAGATGAGGAGATGCAGCTGGG - Intronic
1197931187 X:131697941-131697963 CTACAAATGCGGATGCAGCTTGG + Intergenic
1198758560 X:140006549-140006571 CTCCAAGAGCAGGTGCACTTTGG + Intergenic
1199564904 X:149205654-149205676 CTAGGAGAGCAGAGGCAGTTAGG + Intergenic