ID: 1086245293

View in Genome Browser
Species Human (GRCh38)
Location 11:84744583-84744605
Sequence TTCAATTTTAAAATAGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1085
Summary {0: 1, 1: 1, 2: 5, 3: 88, 4: 990}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086245293_1086245294 29 Left 1086245293 11:84744583-84744605 CCTTAATCTATTTTAAAATTGAA 0: 1
1: 1
2: 5
3: 88
4: 990
Right 1086245294 11:84744635-84744657 CAAAGTCAAATTCCCACCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086245293 Original CRISPR TTCAATTTTAAAATAGATTA AGG (reversed) Intronic
900249076 1:1657227-1657249 TTAATTTTTAGAATAGATTTTGG + Intronic
900995044 1:6117604-6117626 TCCAATTTTAAAGTAGACAAAGG + Intronic
901118189 1:6866000-6866022 TTCAAGTTGATAATAGCTTAAGG - Intronic
901482515 1:9535292-9535314 TTTAATATTAAAATAGAGTTGGG + Intergenic
901618926 1:10565710-10565732 TACAATTTTTAAATTGAGTAAGG - Intronic
902463419 1:16597747-16597769 TACAATTTTAACATGGATAAAGG + Intronic
902868363 1:19296195-19296217 TCCATTTGCAAAATAGATTAGGG - Intergenic
903158098 1:21462954-21462976 TACAATTTTAACATGGATAAAGG - Intronic
903198078 1:21708558-21708580 ATAAATTTTAAAATATATTATGG - Intronic
904550204 1:31310195-31310217 ATTTATGTTAAAATAGATTAAGG + Intronic
904726541 1:32552710-32552732 TCCAATATTAAAATATATTATGG - Intronic
904847068 1:33428464-33428486 TTTATTTTTAGAATGGATTATGG - Intronic
905080737 1:35318029-35318051 TTCAAATTTAGAAGGGATTATGG + Intronic
905837509 1:41139723-41139745 TTCAATTTTATAAAAAATTTAGG - Intronic
905842891 1:41199862-41199884 TTGAATTTTAATTTAGATTCAGG - Intronic
905955361 1:41989658-41989680 TACAATTTTAAAATAAACTATGG - Intronic
906451695 1:45954851-45954873 TTAAATTTTAAATAAGGTTAAGG + Intronic
906585232 1:46970153-46970175 CTCAATTTTCAAAAATATTAAGG - Intergenic
906877432 1:49554490-49554512 TTCCATTTGCAAATAGATCAAGG + Intronic
906974454 1:50554704-50554726 TTCATTTTTAAAATAAATTTTGG - Intronic
907217209 1:52874550-52874572 TTTAATTTAAAAATATTTTATGG - Intronic
907737323 1:57127161-57127183 TTAAAATTTAAAATAAATGAGGG + Intronic
907971452 1:59386015-59386037 TTTAATTTTAAAATAGTTTTAGG + Intronic
908164323 1:61443037-61443059 CTCAATATTAAAAAACATTAAGG - Intronic
908331574 1:63075832-63075854 TTGAATTTTAAAAGTGAATATGG + Intergenic
908404359 1:63799569-63799591 TTCAAATTGGAAATGGATTATGG + Intronic
908464598 1:64379786-64379808 TTGAATTTTAACATAGACTTTGG + Intergenic
908776298 1:67644186-67644208 TTCAAACTTAAAATACATAAAGG + Intergenic
908873229 1:68638782-68638804 TTCATTTTTCAAAAATATTAAGG + Intergenic
908985251 1:70010213-70010235 TTCAATTGTTAAATAAATAATGG + Intronic
909138945 1:71838421-71838443 ATCTATTTTAAAAATGATTAGGG + Intronic
909210102 1:72812442-72812464 TTAAATTTTAAAAAAGGTAAAGG - Intergenic
909255229 1:73411963-73411985 TTCTATTTTAAAATAGTGCAAGG - Intergenic
909762021 1:79301432-79301454 TTGTATTTTAAATTAGTTTATGG + Intergenic
909784569 1:79594583-79594605 TTAAATTTTCAAATATAGTAAGG - Intergenic
909799196 1:79784240-79784262 TTCAAAATGAAAATAGATAATGG - Intergenic
909939558 1:81595188-81595210 CTCAATTTTAAACTGGATTCAGG - Intronic
910527661 1:88199382-88199404 TTTAAAGTTAAAATAAATTAAGG + Intergenic
911255669 1:95630365-95630387 TTCATTTTATAAATAGATTAGGG - Intergenic
911281127 1:95930440-95930462 ATTAATTTTAAAATTAATTATGG - Intergenic
911641684 1:100296428-100296450 TTCCATTTTAAAATAAAATCAGG - Intergenic
911815011 1:102337840-102337862 TGCATTTGTAAAATAAATTATGG + Intergenic
911934993 1:103959547-103959569 TGCAGTTTTAAAACAAATTATGG - Intergenic
911945666 1:104105494-104105516 TTAAATTTTAAAATAAATTTGGG - Intergenic
912285984 1:108369940-108369962 TGCAATTTTAAAGTAGATAAAGG - Intergenic
912460877 1:109830286-109830308 TTCAATTTTATTTTAAATTATGG + Intergenic
912882591 1:113431590-113431612 GTCTTTTTTAAAATAGATTTTGG - Intronic
913066806 1:115263559-115263581 TTCATTTGTAAAATAGATTGAGG + Intergenic
913115980 1:115697384-115697406 TTTATTTTTATAATAGTTTACGG + Exonic
913417423 1:118626042-118626064 TTCAATTTTAAAATTGTTTTAGG + Intergenic
913544126 1:119850279-119850301 TACAATTTTAACGTGGATTAAGG + Intergenic
914465357 1:147923228-147923250 TTCATTTTAGAAATATATTATGG - Intergenic
914710255 1:150206617-150206639 TTGAATTTTTAAATTGATTGAGG + Intergenic
915640659 1:157222328-157222350 TTCAATTTTAAAATGGACAAAGG - Intergenic
916340880 1:163732720-163732742 TTTAATTTTAAAAGAAATTGTGG + Intergenic
916437985 1:164794289-164794311 TTAAATTTTAAAATAGAAATAGG + Intronic
916598025 1:166264604-166264626 TCCAATTTTAAAATGCATAAAGG - Intergenic
917367746 1:174251859-174251881 TTCAGTTTTAAAACAAATTTAGG - Intronic
917570834 1:176263536-176263558 TTTAGTCTTAAAATAGATAAAGG + Intergenic
917989041 1:180353657-180353679 TAAATTTTTAATATAGATTATGG - Intronic
918331775 1:183468100-183468122 ATAAATATTAAAATAAATTAGGG + Intergenic
918736206 1:188066742-188066764 TTCATTTCTGAAATAGTTTAGGG + Intergenic
918758071 1:188362250-188362272 TTCAATGTTAAAATTAATTTTGG + Intergenic
918849122 1:189661630-189661652 TTCAATTTAAAAAAACAATATGG + Intergenic
918972800 1:191441833-191441855 TTCTATTTTAGAATACATTGTGG - Intergenic
919044017 1:192428681-192428703 TTCAAATTTGAAATAGTTTGAGG - Intergenic
919068306 1:192721897-192721919 TTCAATATTAATATTTATTATGG + Intergenic
919156196 1:193768900-193768922 TACATTATTAAAATAGAATATGG - Intergenic
919541645 1:198853927-198853949 TGCAAGTTTAAACTACATTAAGG + Intergenic
919705824 1:200674482-200674504 TTCAATTTTAATATGCTTTATGG + Intergenic
919722976 1:200860788-200860810 TTAAATTTAAACATAGGTTAGGG - Intergenic
919954820 1:202403314-202403336 TTTAATTTTAAAATACCATATGG + Intronic
920023440 1:202973559-202973581 ATAAAATTTAAAATAGATCATGG - Intergenic
920607723 1:207406238-207406260 TGTAATTTTACAATAAATTATGG - Intergenic
920735641 1:208530655-208530677 TTCAAAATTAAATTAAATTAAGG - Intergenic
920927417 1:210355718-210355740 TTCCATTTTAAAAAATATTATGG + Intronic
921695832 1:218208608-218208630 TTTAATTATTAAATAAATTAAGG - Intergenic
922181516 1:223238012-223238034 TCAAATTTTAAAATAGATATAGG + Intronic
922515764 1:226207176-226207198 TTCATTTGTAAAATAAATTGTGG + Intergenic
922688853 1:227670864-227670886 TTCAACTTTAAAATAACTTTTGG + Intronic
922847646 1:228701196-228701218 TTGAATTTTAAATTTGATTTTGG + Intergenic
922920462 1:229297724-229297746 TTCAAGATTAAACTAGATTTAGG + Intronic
923209444 1:231789931-231789953 ATCATTTTTAAAAATGATTACGG - Intronic
923909175 1:238420662-238420684 TTCTATTATAAAATATATTTAGG + Intergenic
924596512 1:245449688-245449710 TTCTATTTTAGTCTAGATTATGG + Intronic
924723074 1:246641389-246641411 TTTTAGTCTAAAATAGATTATGG - Intronic
924761916 1:246995527-246995549 TCTGATTTTAAAATACATTATGG + Intronic
1063047660 10:2409633-2409655 TATATTTTTAAAATATATTAAGG + Intergenic
1063182301 10:3615159-3615181 TCCAATTTTAGGATATATTAGGG + Intergenic
1063287565 10:4707207-4707229 TGCAATTTTAACTTATATTATGG + Intergenic
1063483468 10:6397394-6397416 TTCAATTTAAAAATAGGCAAAGG - Intergenic
1063727764 10:8657418-8657440 TTCATTTTTAAATGATATTATGG - Intergenic
1064498049 10:15936651-15936673 TTTAATTTTAGAATAGTTTTAGG + Intergenic
1064579092 10:16775388-16775410 TTCCATTTAAAAATATATTGTGG + Intronic
1065044161 10:21730728-21730750 CTCAATTTTAGGGTAGATTATGG + Intronic
1065300449 10:24316365-24316387 TTCAATTTTAAAACTGAGAAAGG + Intronic
1065766050 10:29030603-29030625 TGCAATTTGAAAATAAATCAGGG - Intergenic
1066018596 10:31273657-31273679 TTTAATTTTAAAATATATACAGG + Intergenic
1066172539 10:32866415-32866437 ATCAATTTAAAAATAGTTGAGGG + Intronic
1066218785 10:33315128-33315150 TTCAACTCCAAAACAGATTATGG + Intronic
1066429008 10:35335430-35335452 TTCAATATTAAAATAGCTCTGGG + Intronic
1066511761 10:36107109-36107131 TGAAATTTTAAAATAGATTTAGG + Intergenic
1066538661 10:36420172-36420194 TTTAACTTGAAAATAGATTTTGG - Intergenic
1066609408 10:37224356-37224378 TTTAGTTTTAAAATATATTATGG + Intronic
1066621595 10:37359095-37359117 TTCTATTTTAAAACAGAGTTGGG - Intronic
1066645614 10:37605489-37605511 TTTAACTTGAAAATAGATTTTGG - Intergenic
1066701370 10:38133018-38133040 TTAAAGTTTAAAAGAGATAAAGG - Intergenic
1067378114 10:45746948-45746970 TCCAATTTTAAAACAGAAGAGGG - Intronic
1067483638 10:46624244-46624266 TTTAACTATAAAATAGGTTAGGG + Intergenic
1067611118 10:47717399-47717421 TTTAACTATAAAATAGGTTAGGG - Intergenic
1067846538 10:49727298-49727320 TTCAATTAAAAAATAAATTTAGG - Intergenic
1067885813 10:50087623-50087645 TCCAATTTTAAAACAGAAGAGGG - Intronic
1068269327 10:54699958-54699980 ATCATTTGTAAAATAGATTTAGG - Intronic
1068412021 10:56668399-56668421 TTCTTTTTTAAAATAAATAAAGG + Intergenic
1068758102 10:60678188-60678210 TTGAATTTTAAAATTTATTAAGG + Intronic
1068923428 10:62510189-62510211 TTCTATTCTACAATAGATAAGGG + Intronic
1069287711 10:66736809-66736831 TTGAGTTTTCAAATAGATTTAGG + Intronic
1069306448 10:66977078-66977100 ATCAATGGGAAAATAGATTAAGG + Intronic
1069330127 10:67282198-67282220 TAAAATTTTAAAATAAATTTTGG - Intronic
1070025983 10:72632539-72632561 TTCCATATTAAAAGAGACTAAGG + Intergenic
1070036326 10:72728710-72728732 TTCTATTTTAACATAGTTTGAGG + Intronic
1070450168 10:76550170-76550192 TTGTATTTAAAAATTGATTAAGG + Intronic
1070656852 10:78277556-78277578 ATCAATTTTACAATTAATTAAGG - Intergenic
1071102257 10:82052576-82052598 TTCATTCTTAAAACAGATCAGGG - Intronic
1071159780 10:82732332-82732354 TTCATTTTTAAAATAAATCATGG + Intronic
1071218190 10:83432142-83432164 TCCAGTGTTAAAACAGATTAGGG - Intergenic
1071249916 10:83807117-83807139 CTCACTTATAAAATAAATTAAGG - Intergenic
1071626536 10:87177636-87177658 TTTAACTATAAAATAGGTTAGGG - Intronic
1071726261 10:88201019-88201041 TTCTATTTAAAAATAGCTTTTGG + Intergenic
1072117661 10:92379339-92379361 GTCATTTTTAAAAGAGATGATGG - Intergenic
1072354905 10:94599148-94599170 TTTAACTTTGAAATAGTTTAGGG + Intronic
1072515541 10:96178885-96178907 TTCAATTTTTTAATAGATATAGG - Intronic
1073847847 10:107579458-107579480 TTGAATTTTAGAATAGAAAAAGG - Intergenic
1074376112 10:112941960-112941982 TTCAGTTTGAAAATAAATGATGG - Intergenic
1074928555 10:118099527-118099549 TTCAATTTTATATTAGATTATGG - Intergenic
1075577751 10:123591488-123591510 CTTAATTTTTAAATAGATTTAGG - Intergenic
1075585499 10:123654759-123654781 TTGAGTTTTAAAATATATTTTGG - Intergenic
1075851125 10:125588003-125588025 TGCAATGATTAAATAGATTATGG - Intronic
1076018441 10:127049086-127049108 ATAAATTATAAAATAGATTCAGG - Intronic
1076127455 10:127986553-127986575 TTCAATTTTAAAATGTACTTAGG + Intronic
1076413603 10:130269181-130269203 TTCAATTTAACATTAAATTACGG + Intergenic
1076492374 10:130871155-130871177 CTCTATTTTAAAGGAGATTATGG + Intergenic
1076514786 10:131037923-131037945 TTAAATTCTGAAATAGCTTAAGG + Intergenic
1076564750 10:131390459-131390481 TACAGTTTTCAAAAAGATTATGG - Intergenic
1076814366 10:132907528-132907550 TTAAATTTGAAAATAAATAAGGG - Intronic
1077574084 11:3366510-3366532 TTTGATTTAAAAATAGATGAAGG + Intronic
1077652870 11:3989611-3989633 TTACATTTTAAAATAGTTTAGGG + Intronic
1078118219 11:8477650-8477672 TTTCATTTTAAGATAGATTTTGG + Intronic
1078263087 11:9729970-9729992 TTTACTTTTTAAATAGATTTTGG + Intronic
1078326103 11:10382341-10382363 ATAAATTTTCAAATGGATTACGG + Intronic
1078471616 11:11591983-11592005 CTCAATTTTATAATAGAAAAAGG + Intronic
1079001836 11:16764224-16764246 TCAAATTTTAAAAGAGATAATGG + Intergenic
1079044710 11:17091045-17091067 TTAAATTTTAAAACATTTTAAGG - Intronic
1079151135 11:17900417-17900439 TCAAATTTTAAAATATATTCAGG - Intronic
1079288089 11:19158229-19158251 ATAAATTTTAAAATATATTCAGG + Intronic
1079302769 11:19293959-19293981 TTTTTTTTTAAAATAGATTCTGG + Intergenic
1079701506 11:23554382-23554404 ATCAATTTTATAATTCATTAAGG + Intergenic
1079793075 11:24764151-24764173 GTCAGTTTTAAAATAGGGTAGGG + Intronic
1080140618 11:28915129-28915151 TTTAATTTTAAAATTAATTTTGG + Intergenic
1080212730 11:29805786-29805808 GTGAGTTTTAAAATAGGTTATGG + Intergenic
1080476603 11:32598610-32598632 TTCACATGTAAAATAGATAACGG + Intronic
1080676162 11:34429529-34429551 TTCCAGTTTAAAAAAGACTAAGG - Intergenic
1080775940 11:35386888-35386910 TTCATTTTTAAAAAAGAACAAGG + Intronic
1080912667 11:36619337-36619359 TTCAAATTCAAAATAGCTTTGGG - Intronic
1081334348 11:41845679-41845701 TTCATTTTAAAAATAAATAAAGG - Intergenic
1081412297 11:42774062-42774084 CTCATTTTTAAAATGGATAATGG + Intergenic
1081467753 11:43338763-43338785 TTCAATTTTAATATGAATTCAGG - Intronic
1081856326 11:46306205-46306227 TGCAATTTTAAGAAAGATTATGG - Intronic
1081901099 11:46628625-46628647 TTCATTTTTAGAATAAATCAAGG + Intronic
1082010297 11:47445779-47445801 ATCAAGTTTAAAATAAGTTAAGG + Intronic
1082046618 11:47734670-47734692 TTCAGTTATAAAATAAATTTTGG + Intronic
1082213951 11:49544344-49544366 TACAATTTTTAAATGCATTAAGG + Intergenic
1082776698 11:57250670-57250692 TTTTCATTTAAAATAGATTATGG - Intergenic
1082898283 11:58216085-58216107 TTGAAATATACAATAGATTATGG - Intergenic
1083715572 11:64573771-64573793 TTCAATTTTAAAATAGATTTAGG - Intergenic
1084136379 11:67185663-67185685 TTCAATTTCAACATAAATTTTGG - Intronic
1084781633 11:71413559-71413581 TTTAATTTAAAAATAAATTCTGG - Intergenic
1085140463 11:74136102-74136124 TTCAATTTTATTTTAGATTCAGG - Intronic
1085242038 11:75064915-75064937 GTCAATTTTAAAAAACATGAAGG + Intergenic
1085312213 11:75523560-75523582 TGCCACTTTAAAATAGGTTATGG - Intronic
1085437725 11:76523882-76523904 TTAAGTTTTAAAATAAATTTTGG - Intronic
1085469072 11:76745316-76745338 TTTTATTTTAAAATAAAGTATGG - Intergenic
1085730528 11:78994602-78994624 TTCATTTTTACAATCGCTTACGG + Intronic
1085919039 11:80929497-80929519 TAGAATTTAAAAATAGATCAGGG - Intergenic
1086245293 11:84744583-84744605 TTCAATTTTAAAATAGATTAAGG - Intronic
1086302147 11:85438406-85438428 TTTAATTTTAAAATATATCAGGG - Intronic
1086313158 11:85559040-85559062 TTCAATTTAGAAATAGATAGTGG + Intronic
1086635650 11:89080145-89080167 TACAATTTTTAAATGCATTAAGG - Intergenic
1086748350 11:90457860-90457882 TTCAATTTTATTTTAGATTCAGG - Intergenic
1087163835 11:94977959-94977981 TTAAAATATAAAATAGATTAAGG - Intronic
1087304231 11:96470265-96470287 TGCAATGTTAAAATACATTTAGG + Intronic
1087317901 11:96625758-96625780 TAGAATTTTAAAATAGAATATGG + Intergenic
1087336707 11:96852638-96852660 TACAATTTGAAATGAGATTAGGG - Intergenic
1087639190 11:100737054-100737076 TTCTATGTTAAAAGGGATTAAGG + Intronic
1088056534 11:105587221-105587243 TTCAATTTGAAAATAGGTTCAGG - Intergenic
1088254730 11:107892486-107892508 TTCTTTTTTAAAAAAAATTAAGG + Intronic
1088368365 11:109062435-109062457 CTCAATTATAAAAGAGATAAAGG - Intergenic
1088440983 11:109869995-109870017 TTCAAAATTAAAACAAATTATGG - Intergenic
1088454244 11:110016793-110016815 TTTATTTTTAAAATAAATTTTGG + Intergenic
1089031223 11:115331444-115331466 TTTAATTTTAAATTAAATTAAGG + Intronic
1089276908 11:117343190-117343212 TTCAATTTTACAATATATTATGG - Intronic
1090181130 11:124700776-124700798 TCAAATTTTATTATAGATTAAGG + Intergenic
1090341801 11:126029352-126029374 TTCTACTATATAATAGATTATGG - Intronic
1090540416 11:127696707-127696729 TCAAATGTTAAAATATATTAAGG - Intergenic
1090861716 11:130659621-130659643 TCCATTTTTAAAATAGATACAGG - Intergenic
1091510377 12:1117997-1118019 TACAATGTGAAAATAAATTATGG + Intronic
1092044285 12:5417945-5417967 ATGAATTTCAAAATACATTAAGG + Intergenic
1092110175 12:5954954-5954976 TTGATTTTTAAACTACATTAGGG - Intronic
1092521788 12:9283593-9283615 GTTAATTATAAAATAGATTCTGG + Intergenic
1092740043 12:11619501-11619523 TTAAATTTTTAAAAAGATTTGGG - Intergenic
1092998064 12:13969311-13969333 TTCCATGTTAAAAAAGATAAAGG - Intronic
1093207639 12:16269506-16269528 GTGAATATTAAAATAGATTCTGG + Intronic
1093240250 12:16661527-16661549 GTAAATTTTAAAATGAATTAGGG + Intergenic
1093338623 12:17942057-17942079 ATCAATTTTAAACTGGCTTAGGG + Intergenic
1093467971 12:19469858-19469880 TTCTATTTTAAAATGAATTAAGG - Intronic
1093662361 12:21772531-21772553 TTCAAAGTTTAAATAGAATAGGG - Intronic
1093735071 12:22612105-22612127 TTCAAATTTAAGATAGACTAAGG - Intergenic
1093827954 12:23718029-23718051 TTTAATTTTAAAATATTTTAAGG - Intronic
1094211552 12:27898464-27898486 TTCAATTTTAGAAGAGTTTTAGG - Intergenic
1094349821 12:29511829-29511851 TTTATTTTTAAAATAGCTTCAGG + Intronic
1094631014 12:32173907-32173929 TTCAATATGAAAATAGTTTCTGG - Intronic
1094802690 12:34055419-34055441 TTTAATTTTAAAGTAAATTCTGG - Intergenic
1095756950 12:45778681-45778703 TTAAATTTTTAAATAAATGACGG + Intronic
1096055341 12:48646082-48646104 ATTAATTTTAAAAAAGATTAAGG - Intergenic
1097480677 12:60121408-60121430 TTCAATATTAGAATTGATTTAGG + Intergenic
1097570735 12:61327953-61327975 GTACATTTTAAAATACATTAAGG + Intergenic
1097974512 12:65670161-65670183 TTGACTTTTATTATAGATTAAGG - Intergenic
1098026540 12:66209191-66209213 TTAAAGTTAATAATAGATTAAGG + Intronic
1098065415 12:66610001-66610023 TTGATTTTTAAAATACCTTAAGG - Intronic
1098266159 12:68722387-68722409 TTAAAATTTAAAACACATTATGG + Intronic
1098519124 12:71415902-71415924 TTCAAATTTAAAGAAAATTAGGG + Intronic
1098627279 12:72687825-72687847 TTCAATTTTAACGTTAATTATGG + Intergenic
1098816250 12:75167804-75167826 TTCAATTTTATTATAAAATAGGG - Intronic
1098884704 12:75948975-75948997 TTCAAATTTAAAAAAAATTGGGG - Intergenic
1099239335 12:80119796-80119818 TTCAATTTTAAAATACTACATGG + Intergenic
1099278110 12:80604157-80604179 TTCAATTTTTAAATACATATGGG - Intronic
1099324297 12:81193495-81193517 TTCAATTTTATATAAAATTAGGG + Intronic
1099418899 12:82427865-82427887 TTTAAATGTAAAATAGATTTAGG + Intronic
1099421112 12:82461666-82461688 TGTAATTCTAAAACAGATTAAGG + Intronic
1099679621 12:85808795-85808817 TTTTATTTTAAAATAAATAATGG + Intronic
1100152511 12:91757701-91757723 TTTAATTTTCAAATCGATTTTGG - Intergenic
1100264649 12:92963805-92963827 TTCTTTTCTAAAATATATTATGG - Intergenic
1100387428 12:94116734-94116756 TTCAAATTCCAAATACATTAGGG - Intergenic
1100425241 12:94478481-94478503 TTCCACTTTGAAATAGTTTAAGG - Intergenic
1100621665 12:96281923-96281945 TTTTACTTTAAAATAGAGTAAGG - Intronic
1101219365 12:102620979-102621001 TACATTTTTAAAATAGAAAATGG - Intergenic
1101447890 12:104750837-104750859 TTTAATTTTAAAATAATTTCAGG - Intronic
1101519941 12:105472917-105472939 TATAATTTTAAAATATATTCTGG + Intergenic
1101758711 12:107641901-107641923 TTTAACTTCAAATTAGATTACGG + Intronic
1101863968 12:108506115-108506137 TTGAAATATACAATAGATTATGG - Intergenic
1101917434 12:108906841-108906863 TTCAAATATAAAATATAGTAAGG + Intergenic
1102319715 12:111921550-111921572 TTCAATTTTTAAATAGATACAGG - Intergenic
1102424142 12:112827622-112827644 TTGATCTTTAAAATAGATTTAGG - Intronic
1103535577 12:121631592-121631614 TTCATCTTTAAAATGGAGTACGG + Intronic
1103666221 12:122568213-122568235 GTCAGTTTTAAAAAAAATTAAGG - Intronic
1104025336 12:125021857-125021879 TACAATTTGAAATTAGATTTGGG + Intronic
1104036898 12:125104025-125104047 TTCATTTTGAATAGAGATTAAGG + Intronic
1104314767 12:127687482-127687504 ATGTATTTTAAAATAGATTTTGG + Intergenic
1105633794 13:22197915-22197937 TTCATTTTTAAAATAGTTTTGGG - Intergenic
1107279475 13:38717165-38717187 TTTTGTTTTAAAATAGGTTAGGG + Intronic
1107470115 13:40683908-40683930 TTCATTTTTATAATATCTTAAGG + Intergenic
1107532042 13:41291478-41291500 TTCAATTTAGAAATAGTTTCAGG - Intergenic
1107571003 13:41657975-41657997 TTAAAGGTTAAAATAGATTTGGG + Intronic
1108113137 13:47099175-47099197 TTCAATTTTATTTTAGATTTGGG + Intergenic
1108575975 13:51791315-51791337 TTTAATTTTAAAAAAGTATACGG + Intronic
1108602007 13:52002866-52002888 TTTAATTTTAAAATATGTTATGG + Intronic
1108606333 13:52043236-52043258 ATCAATTTTTAAAGTGATTAAGG + Intronic
1108813353 13:54258954-54258976 GTCAATTTTTAAATGGAATATGG + Intergenic
1108939099 13:55927208-55927230 ATTAATTTTTAAATAAATTAAGG - Intergenic
1108979093 13:56487776-56487798 AACAAATTAAAAATAGATTATGG + Intergenic
1108979789 13:56496121-56496143 CTCAATTTTATAGTAGAGTACGG + Intergenic
1108984357 13:56565049-56565071 TTCAAATAAAAAATAAATTAGGG + Intergenic
1109131201 13:58588202-58588224 TTCAAATTGAAAAAAAATTAAGG + Intergenic
1109598064 13:64583258-64583280 TTCAACTTTAAAATAAAATGAGG + Intergenic
1110006143 13:70272693-70272715 TTAAATTTTAAAATGGATTTTGG + Intergenic
1110021242 13:70476636-70476658 TTCTATTTTAAAATATATTCTGG - Intergenic
1110452519 13:75652778-75652800 TTCAATTTTATAATAAAGTGAGG - Intronic
1110825656 13:79968633-79968655 TTAAATTTTATTATAGATTCAGG + Intergenic
1110941055 13:81348960-81348982 TTCAATGTTAAACTTGATTTGGG - Intergenic
1111035273 13:82664010-82664032 TTCAATAGGAAGATAGATTAGGG + Intergenic
1111071883 13:83180427-83180449 TAAAATTTCAAAATAAATTAAGG - Intergenic
1111117537 13:83800213-83800235 ATGAATTTTAAACCAGATTATGG - Intergenic
1111299670 13:86331231-86331253 TTCAATATTGAAATATATGAAGG - Intergenic
1111315319 13:86549333-86549355 TTCAATTTTAACATTAATTCAGG - Intergenic
1111410244 13:87867132-87867154 ATCAATTGAAAAATAAATTAAGG - Intergenic
1112074663 13:95898584-95898606 TTCAGTTTTAACATAAATTTTGG - Intronic
1112131179 13:96525237-96525259 TTCTATTTAAAAATAGATGGGGG + Intronic
1112200900 13:97273512-97273534 TTCAATTATAAAATATTTGAGGG - Intronic
1112278089 13:98039323-98039345 TACAATTTTAAAATTTTTTATGG + Intergenic
1112547371 13:100383985-100384007 TTAAATATTAAAATAAACTATGG - Intronic
1112673338 13:101667458-101667480 CTCAGTGTTAAATTAGATTAAGG - Intronic
1112792023 13:103013756-103013778 CTCAGTTTGAAGATAGATTAGGG + Intergenic
1112856606 13:103778266-103778288 TTTAATTTAAAAATAAATTATGG + Intergenic
1113172755 13:107523890-107523912 TTTCATTTTAAAATATAATAAGG + Intronic
1114063700 14:19041716-19041738 TTCACTTATAAAACTGATTATGG + Intergenic
1114098557 14:19358280-19358302 TTCACTTATAAAACTGATTATGG - Intergenic
1114357095 14:21922718-21922740 TTGAATTTTATAATAGAGTCGGG + Intergenic
1114875188 14:26708223-26708245 CTCAATTTTAAACAACATTAAGG - Intergenic
1114942350 14:27629486-27629508 TTTAATTTTAAAACATATTGAGG - Intergenic
1114963523 14:27926202-27926224 GTCAATATTAAAAAATATTAAGG + Intergenic
1115173668 14:30537308-30537330 TTCAATTTAAAAATAGACAAGGG - Intergenic
1115353530 14:32422878-32422900 ATCAATTTCAAAATACTTTAAGG + Intronic
1115628231 14:35216970-35216992 TCCAATTTTAAAATAGGCAAAGG - Intronic
1115805133 14:37042462-37042484 TTCTATTTTAAAAAAGAAAATGG - Intronic
1115913750 14:38286367-38286389 TTCTATTTTAATAGATATTAGGG + Intergenic
1116074562 14:40093838-40093860 TCCAATTGTAATATATATTAAGG - Intergenic
1116215215 14:42007915-42007937 TTCAATTTTTAAGTAGAGTCAGG + Intergenic
1116226871 14:42163942-42163964 TTAAGATGTAAAATAGATTATGG + Intergenic
1116228653 14:42186390-42186412 TTTGATTTTAATATAGATCACGG - Intergenic
1116441155 14:44954830-44954852 TTCAATTTTCAAATTTCTTATGG - Intronic
1116511089 14:45747688-45747710 TTCAATTTTAAGATAGGTTTGGG - Intergenic
1116980299 14:51162703-51162725 TTTAGTTTTAAATGAGATTAAGG + Intergenic
1117337946 14:54770794-54770816 CTCAATTTAAAACTATATTAAGG - Intronic
1117565106 14:56986374-56986396 TTTATATTTAAAATAGTTTATGG - Intergenic
1117691229 14:58309030-58309052 ACCAATTTTGAAAGAGATTATGG + Intronic
1117736074 14:58770191-58770213 TTTAATTTTAAAAAAGAAAATGG + Intergenic
1118134969 14:63013909-63013931 TTTAATTTTAAAAGAGAATAAGG + Intronic
1118268798 14:64322033-64322055 TTTATTTTTATTATAGATTAAGG - Intronic
1118796060 14:69145316-69145338 TTAAATTTTTAAGTAAATTAAGG - Intronic
1119289476 14:73483687-73483709 TTTATTTTTAAAATGGATGATGG + Intronic
1119536497 14:75407067-75407089 TTTCTTTTTAAAATAGATTTAGG + Intergenic
1119915934 14:78401618-78401640 TTAAATTTTAACATAAATTTTGG + Intronic
1120173838 14:81273260-81273282 TTCAATTTTGAAAGCTATTATGG + Intronic
1120364757 14:83552211-83552233 CTCATTTTTAAAATATATAATGG - Intergenic
1120949211 14:90025688-90025710 TTAACTTTTAAATTAGACTACGG + Intronic
1121215381 14:92243734-92243756 ATCATTTTTAACATAGAATATGG - Intergenic
1121234410 14:92381602-92381624 TACAATTTAAAAAAAAATTAAGG + Intronic
1121821810 14:96975105-96975127 TATAATTTTCAACTAGATTAAGG + Intergenic
1122391407 14:101388938-101388960 TTCAATTTTAATAATGAATATGG + Intergenic
1122720186 14:103717275-103717297 GTAAATTTTAAAAAAGATGAAGG - Intronic
1122739068 14:103860305-103860327 TTCAACATAAAAATAAATTAAGG - Intergenic
1124123747 15:26915858-26915880 CTCATTTGTAAAATAGATGAGGG + Intronic
1124408369 15:29413049-29413071 TTTAATTTCCAAATATATTAGGG + Intronic
1124969910 15:34477551-34477573 TTCAATTTTAGCAAAGATAAAGG + Intergenic
1125089643 15:35775175-35775197 TTCTTTTTCAAAAAAGATTATGG - Intergenic
1125363762 15:38891626-38891648 ATGAATTTTAAAATAGTTTTTGG - Intergenic
1125369027 15:38950161-38950183 TTTAATTTTAAATAAAATTATGG - Intergenic
1125405357 15:39347391-39347413 TACAAATTAAAAATATATTATGG + Intergenic
1125640687 15:41228409-41228431 TTCATTTGTAAATTAGGTTATGG - Intronic
1126227194 15:46284762-46284784 TTTAATTTTTAGATAGATTCTGG + Intergenic
1126240482 15:46436919-46436941 CTTAATTTTAAAATAGTTTATGG - Intergenic
1126246772 15:46516036-46516058 TTAATTTTTAAAATATATTTAGG + Intergenic
1127282633 15:57504920-57504942 TTCCTTTTTAAAACAGATGAGGG + Intronic
1127582664 15:60351899-60351921 CTCAATTTTTAAAAAAATTATGG - Intronic
1127594686 15:60467951-60467973 TTCCATTTTAAAAAAAATGACGG + Intronic
1128602255 15:69006377-69006399 TTAAATTTTAAATTTGATTTGGG + Intronic
1129098953 15:73240262-73240284 TTAAATTTTATGATAGATTGTGG + Intronic
1129184648 15:73898465-73898487 TAAAATTTTAAAATACATTGTGG - Intergenic
1129618550 15:77121084-77121106 TTCAATTTTATTTTAGATTCAGG + Intronic
1129774408 15:78226258-78226280 TTCATTTCTAACATAGAATATGG - Intronic
1129811557 15:78515159-78515181 TTTATTTTTAAAATAAAGTATGG + Intronic
1129947803 15:79556744-79556766 ATAAATTTTAAAAGAGACTATGG + Intergenic
1129988736 15:79942691-79942713 TCCAATTTTAAAATAGGCAAAGG + Intergenic
1130806132 15:87325124-87325146 TTTAATTCTAAGATATATTAAGG + Intergenic
1131621736 15:94075295-94075317 GGCAATTTTAAAGTTGATTAAGG + Intergenic
1131872791 15:96778678-96778700 TTCAATTAGAAAATATTTTAGGG - Intergenic
1132108627 15:99085681-99085703 TCCCATTGTAGAATAGATTATGG + Intergenic
1133636125 16:7667487-7667509 TTCGTTTTTAAAAGAGATGATGG + Intronic
1134427306 16:14162905-14162927 TTGAAATTTAAATTAGATTTAGG - Intronic
1135034591 16:19066557-19066579 TTCCATCTTAAAATATTTTATGG + Intergenic
1135925752 16:26692533-26692555 TGCCCTTTTAAAATATATTATGG + Intergenic
1136468285 16:30460305-30460327 ATCAATTTAAAAATAAATCAAGG + Intergenic
1136728948 16:32388535-32388557 TTTATTTTTAAAATAAATTTTGG - Intergenic
1137014248 16:35358488-35358510 TTAAATTTTAACATAAATTTTGG - Intergenic
1137630723 16:49942053-49942075 TTCAATTGAAAAATGGATCAAGG + Intergenic
1139107007 16:63838558-63838580 TTCAATTTTGAAATTCCTTATGG - Intergenic
1139121869 16:64029253-64029275 TCAATTTTTAAAATAGATTCAGG + Intergenic
1139141881 16:64274612-64274634 TTTTATTTTAAAATATTTTATGG - Intergenic
1139397859 16:66654757-66654779 TTCAACTGTAAAATGAATTAAGG + Intronic
1139771971 16:69285158-69285180 TTTTACTTTAAAACAGATTATGG - Intronic
1139813886 16:69650682-69650704 ATCAATTTTATAATAGAAAAGGG - Intronic
1139933496 16:70549622-70549644 TTTTATTTTAAAACAGATTTAGG + Intronic
1140340768 16:74158019-74158041 TTCAGTTTTTAAATAGATACCGG - Intergenic
1140601322 16:76478529-76478551 TTCAAAAGTAAAATAGATTCAGG + Intronic
1140658890 16:77168156-77168178 TTCAATTTTATCATAGAATTGGG - Intergenic
1140683303 16:77407081-77407103 TTCAATTTTTATTTAGATTCAGG - Intronic
1141039389 16:80658965-80658987 TTCAATAGTAAAATAAATAATGG + Intronic
1141890123 16:86920668-86920690 TTCAAATGTAAAATAGATGCTGG + Intergenic
1142387596 16:89775880-89775902 TTTTATTTTATAATAGATTTGGG - Intronic
1142820675 17:2464207-2464229 TACAACTTAAAAAAAGATTAAGG - Exonic
1142891296 17:2945173-2945195 TTCCATTTTAAAATAGCATTAGG - Intronic
1144060232 17:11576764-11576786 TTCAAGTTTTAAATACATGAGGG + Intergenic
1144391032 17:14793650-14793672 TACAATTTAAAAGTAGTTTATGG - Intergenic
1144469255 17:15522976-15522998 TTCACTTTTAACATTGTTTAGGG - Intronic
1144582942 17:16470188-16470210 TTGAGGTTTAAAATAGAGTATGG - Intronic
1145198209 17:20914694-20914716 TTCACCTTTAAAATACATTATGG - Intergenic
1145283019 17:21481842-21481864 TCCAAATTTAAAGTAAATTAAGG + Intergenic
1147033226 17:37658725-37658747 TTTAATTTTAAAATAGAGACGGG + Intergenic
1147502879 17:40982694-40982716 TTTAATTTGAAAATAACTTATGG - Intronic
1148319824 17:46741052-46741074 TGTAATTTTAAACTAGATTTGGG - Intronic
1148586078 17:48781623-48781645 TGCAATTTAAAAATAGACAAAGG - Intronic
1149513936 17:57265779-57265801 TTTAATTTTTAAAAAGATAAGGG - Intronic
1150536221 17:66044956-66044978 CTCAATTTAAAAATAGACAAAGG + Intronic
1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG + Intronic
1150730042 17:67684659-67684681 TTTTATTTAACAATAGATTAAGG + Intronic
1150940965 17:69694271-69694293 TTCATTTTTATGATAAATTAAGG - Intergenic
1153714162 18:7829049-7829071 TTCAATTTCAAAATACAATTAGG - Intronic
1153909261 18:9692265-9692287 TTCAAGATTAAAAGAGATTCAGG + Intergenic
1154400046 18:14027988-14028010 TTTTATTCTAAAATAGATCAAGG + Intergenic
1154442243 18:14400802-14400824 CTCAAATTTAAAAAAGAGTAAGG + Intergenic
1155721008 18:29012164-29012186 ATCAATATTTAAATAGATTCTGG - Intergenic
1155772291 18:29717042-29717064 TTTGATTTTAAAATAAATCAGGG - Intergenic
1155793360 18:30001991-30002013 TGTATTTTTAATATAGATTAAGG + Intergenic
1156088266 18:33435240-33435262 TTTAATTTTTAAATTGAATATGG - Intronic
1156424192 18:36991049-36991071 TTGCTTTTTAAAATAAATTAAGG - Intronic
1156798550 18:41079261-41079283 ATCAAATTAAAAATAGAATATGG + Intergenic
1156852831 18:41747889-41747911 TTCCTTTTTAAAGTACATTAAGG - Intergenic
1156969091 18:43133509-43133531 TTGAATTTTAAAACAATTTAGGG - Intergenic
1157118880 18:44889038-44889060 TTCAACTTTCAAGTAAATTAAGG - Intronic
1157363151 18:47037293-47037315 TTCAATTTTGAATTTGATAATGG + Intronic
1157633037 18:49119563-49119585 TTCAACTGTCAAATATATTATGG - Intronic
1157650215 18:49320771-49320793 TTCCCTTTTAAAATAGAATCAGG - Intronic
1158086765 18:53660618-53660640 TTAAAATTAAAAATAAATTAAGG + Intergenic
1158201346 18:54944869-54944891 ATCAATCTTAACATAAATTAAGG + Intronic
1158282590 18:55843598-55843620 TTTTATTTAAAAATATATTATGG - Intergenic
1159133162 18:64304607-64304629 TACATTTTTAATACAGATTATGG - Intergenic
1159266775 18:66090470-66090492 TTAAATTTTAAAACAAAATAAGG - Intergenic
1159283796 18:66322526-66322548 TAAACTTTTAAAATAGACTACGG + Intergenic
1159305983 18:66642743-66642765 TTCATTTTTAAAATAAGTCAAGG - Intergenic
1159525351 18:69581842-69581864 TTCAATTTAGAAAAAGAATAAGG - Intronic
1159682192 18:71368509-71368531 TTCAATTTTTTTATAGATTTAGG - Intergenic
1159771242 18:72547447-72547469 TTAATTTTAAAAATAGATTTAGG - Intronic
1159997906 18:74984365-74984387 TTAAATTTTAGAATAGTTTTTGG - Intronic
1160305984 18:77737420-77737442 TTCAATTCTAAAATACAGTTAGG + Intergenic
1165647721 19:37457273-37457295 ACCAATTTTAAAATAAATTGAGG + Intronic
1166578522 19:43868388-43868410 TTAAAATTTAAAATAAATGAAGG + Intergenic
1167500846 19:49846772-49846794 TGCAATTACAAAATAGTTTATGG - Intergenic
1167624187 19:50576335-50576357 CTCTAAGTTAAAATAGATTAAGG + Intergenic
1202679081 1_KI270711v1_random:35194-35216 TACAATTTTAACATGGATAAAGG + Intergenic
925984340 2:9203773-9203795 TTCATTTGTAAAATAGTTTCTGG + Intergenic
926024352 2:9527553-9527575 TTAGACTTTAAAAAAGATTAGGG - Intronic
926265292 2:11311573-11311595 TTCAATTACTGAATAGATTAAGG + Intronic
926411811 2:12611942-12611964 TTCACTTTTATAATACATCAAGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
926842440 2:17097099-17097121 TTCAATTTTCTAATAGACTCAGG + Intergenic
926939883 2:18124338-18124360 TTCAAGTTTAACTTAGTTTAGGG + Intronic
927001675 2:18801578-18801600 TTCAATTTCAAAATCTATAAAGG + Intergenic
927455917 2:23249054-23249076 TTCAATATGAAATTAGATTGAGG + Intergenic
928148079 2:28799744-28799766 TTCACTTTTAAAAATGTTTAGGG - Exonic
928586830 2:32768121-32768143 TTTAATTCTGTAATAGATTATGG + Intronic
928655887 2:33451228-33451250 TCAAATTTTAAAATGGATAAAGG - Intronic
928717588 2:34079984-34080006 TTGCATTTTAAAATAAAATAAGG - Intergenic
929061251 2:37926462-37926484 TGACATTTTAATATAGATTATGG - Intronic
929194995 2:39176214-39176236 ATCAATTTTAAAATTAAGTAGGG + Intronic
929356970 2:41037385-41037407 ATCGATTTTAAAATATATTGAGG + Intergenic
929367344 2:41175876-41175898 TTCAGTTTTAAAAAAAATGATGG + Intergenic
929367402 2:41176546-41176568 TTCAATTTTAAAAAACAATTTGG + Intergenic
929698251 2:44138854-44138876 TTCAATATTAACAGATATTAAGG + Intergenic
930428672 2:51245675-51245697 TTCACTTTTAATAAAGATTATGG - Intergenic
930679039 2:54235689-54235711 TTCAATTTTAAAATAAATAAGGG + Intronic
930766423 2:55090093-55090115 TTGAATTGTAAAATAGATCTGGG + Intronic
931015507 2:57975497-57975519 TTCAATTTTATTTTAGATTTGGG + Intronic
931024626 2:58095342-58095364 TTAAGTTTTAAAATTGATTTGGG + Intronic
931313892 2:61107979-61108001 TTATATTTTAATATAAATTAAGG - Intronic
931511827 2:63005594-63005616 TTTAGTTTCAAAATAAATTATGG - Intronic
931934450 2:67180703-67180725 TTCATTTTTAAATTTGATTTTGG + Intergenic
932222991 2:70014951-70014973 TTCATTTTTAAAATGGGTAAAGG + Intergenic
932280969 2:70491553-70491575 TTGAATTTTCAAAAAGATAAAGG - Intronic
932806275 2:74786092-74786114 TTCAATTTTATTTTAGATTCAGG + Intergenic
932998054 2:76882025-76882047 TTCAATTTTACACCAGATTGTGG - Intronic
933281639 2:80338316-80338338 TTCACTTTTAAAGCAGATAATGG + Intronic
933819995 2:86102446-86102468 TTCAATTTTAAAATGGACAAAGG - Intronic
935829244 2:106983161-106983183 TTTAATTTTAGAATAGTTTTAGG + Intergenic
936140244 2:109933361-109933383 TACATTTTAAAAATATATTATGG + Intergenic
936176934 2:110231306-110231328 TACATTTTAAAAATATATTATGG + Intergenic
936204451 2:110438125-110438147 TACATTTTAAAAATATATTATGG - Intronic
936511516 2:113151300-113151322 TTCAATTTTAAAATAGGCAAAGG - Intergenic
936902222 2:117494515-117494537 TTTTATTTTAAAATAGTTTTAGG - Intergenic
937187411 2:120057334-120057356 TTAGATTTTAAAATAGACGATGG - Intronic
937519780 2:122698469-122698491 TTCATTTTTTAAATAGATATAGG - Intergenic
937716797 2:125040887-125040909 TTAAATCTTAAAAAAGATCATGG + Intergenic
938647847 2:133349917-133349939 TTAAATTTTAAAATAATTTTAGG + Intronic
938923726 2:136019626-136019648 TTCAGTCTTAACATACATTAGGG - Intergenic
939070679 2:137537688-137537710 TTCAAATTGAAAATGGATTTTGG + Intronic
939295048 2:140251566-140251588 TTCAATTTTAAATTGCTTTAAGG - Intronic
939344575 2:140947155-140947177 TTTATTTTTATAATAGATTCGGG - Intronic
939347483 2:140985324-140985346 TCTAATTTTTAAATACATTAGGG + Intronic
939581553 2:143955435-143955457 TTCATTTTTAAAATGTCTTATGG - Intronic
939664659 2:144936252-144936274 TTAAATTTTAAAATTAATGATGG + Intergenic
939787135 2:146529609-146529631 TCCAATTTTAAATTTTATTAAGG + Intergenic
940051210 2:149467100-149467122 TCCAATGTTAAGATAGTTTAGGG + Intronic
940144422 2:150530872-150530894 TCTTATTTTAAAATTGATTAAGG - Intronic
940565295 2:155352543-155352565 TTCCCTTTTAAAATCTATTATGG - Intergenic
940845524 2:158637729-158637751 TTCACTTTTATAATTGTTTATGG + Intronic
940878221 2:158920110-158920132 TTCAATTATAAAATTGTTAAAGG - Intergenic
941134289 2:161694725-161694747 TTCAATTTAAAATTGGGTTAAGG - Intronic
941480030 2:165996171-165996193 TTCAATGTTAAAATAGAAAATGG + Intronic
941480983 2:166012331-166012353 TTAATTTTTTAAATAGCTTATGG - Intronic
941555425 2:166973932-166973954 ATGAATTTTAAAATTCATTAAGG + Intronic
942222590 2:173785204-173785226 TTTAATTTCAAAATAATTTATGG + Intergenic
942575696 2:177361391-177361413 TTTACATTTAAAATAGATTTTGG + Intronic
942710540 2:178830291-178830313 TTGAATTTAAAAATAGATGCTGG - Exonic
942933180 2:181521380-181521402 TTCATATTTAAAATATTTTAAGG + Intronic
943184118 2:184583976-184583998 TTCATTTTTAGAGTAGATTTAGG - Intergenic
943269706 2:185783408-185783430 TTCATTTTTAAAAAAGATGATGG - Intronic
943619992 2:190138669-190138691 TTCAATTTTAAAAGATGTGATGG - Intronic
943794383 2:191973627-191973649 ATCTACTTTAAAATAGATTTAGG + Intronic
943942260 2:194013500-194013522 TCCAATTTTAAAATGGGATAAGG + Intergenic
944058882 2:195550875-195550897 CTTAATTTTAAAATACATTATGG + Intergenic
944228112 2:197368288-197368310 TTAAACTTTAAAATAGAGCAGGG + Intergenic
944317533 2:198299400-198299422 AACAATTTTAAAATAGATTTAGG + Intronic
944388064 2:199186522-199186544 TTAATTTTTAAAAGAGATTGGGG - Intergenic
944497809 2:200326302-200326324 TTCAATCTCAGAATATATTATGG - Intronic
944516712 2:200519826-200519848 TTTATTTTTTAAATAAATTAAGG - Intronic
944520423 2:200560896-200560918 TTAATTTTTAAAATAGATATGGG + Intronic
944890618 2:204113673-204113695 TTTATTTTTAAAATATATTGAGG - Intergenic
945131015 2:206572182-206572204 TTCAGGTCTAAAATAAATTAGGG - Intronic
945402060 2:209395085-209395107 TTTAATTTGCAAATAGATAATGG - Intergenic
945652571 2:212582888-212582910 TTAAATATTAAAATATTTTAAGG - Intergenic
946137547 2:217660223-217660245 TTTAATTTTAAAAAAGAATCCGG + Intronic
946212533 2:218158595-218158617 TTAAATTTTTAAATAGAGTCGGG - Intergenic
946250761 2:218410537-218410559 TTTATTTTTAAAATTGAATAAGG - Intergenic
947337258 2:229100338-229100360 TTTAATTTTAAATTAGCATAGGG - Intronic
947405054 2:229766841-229766863 TTTAGTTTTAATATAGTTTAGGG - Intronic
947724894 2:232391333-232391355 TTCAGTTTCAAATGAGATTAAGG - Intergenic
947790031 2:232860305-232860327 TTAAATTTTAGGATAGATAATGG + Intronic
948495749 2:238347932-238347954 TTAAATTTCAAATTAAATTAGGG - Intronic
948507940 2:238443119-238443141 TTCATTTATAAAATAAATTTAGG + Intronic
1169023167 20:2345460-2345482 TCAAATTTTAAAATAGATATAGG - Intergenic
1169032637 20:2422605-2422627 CTTAATTTTAAAATACTTTACGG + Intronic
1169871199 20:10250239-10250261 TTCTATTTTAACATAGTTTGTGG - Intronic
1170227210 20:14004371-14004393 TTCAAGTTTAAAACAGCATAAGG - Intronic
1170227973 20:14013016-14013038 TTCATTTTTGTAATAGATTTGGG + Intronic
1170335739 20:15268349-15268371 TTTTATTTAAAAATAGATTGAGG + Intronic
1170988323 20:21279007-21279029 TGCACTTTTAAAAAACATTAAGG + Intergenic
1170994840 20:21343282-21343304 TTAAATATTAAAATATGTTAGGG + Intronic
1171071851 20:22077413-22077435 TCCAATTTTAAAATGGACAAAGG - Intergenic
1171566823 20:26201926-26201948 CTCAATTTTAATATCGATTCTGG - Intergenic
1171996817 20:31737932-31737954 TTGAATTTTGAAAAAGATTGGGG - Intergenic
1172176991 20:32978403-32978425 TTCCATATTAAATTATATTATGG - Intergenic
1172533429 20:35652042-35652064 TTCAATTTTAAAAGAAAATGAGG + Exonic
1172574711 20:35999289-35999311 TTTAATGTTAATATTGATTATGG + Intronic
1172780251 20:37432516-37432538 TTCCATTTTAAAATATTTTGTGG + Intergenic
1172790402 20:37501322-37501344 GACAATTTTAAAAAAGAATAAGG + Intronic
1173031715 20:39367253-39367275 TTCCATTTCAAAGTAGAATATGG + Intergenic
1173128271 20:40360842-40360864 TTCATTTTTTAAATGGATGATGG - Intergenic
1173237127 20:41256826-41256848 GCCATTTTTAAAATAGATTTAGG + Intronic
1173479278 20:43386336-43386358 TTCAATTTTATTTTAGATTCAGG + Intergenic
1173692669 20:44976017-44976039 TACAATTTTCAAAAAGATCAAGG + Intronic
1174888302 20:54360030-54360052 TTGCATTTTAAAAAACATTAAGG + Intergenic
1176985243 21:15428362-15428384 TTCAATTTTCAAATGGACAAAGG - Intergenic
1177014933 21:15775143-15775165 TTCATTTATAAAATATATTTGGG + Intronic
1177129434 21:17238784-17238806 TTCAAAGATAAAATAGATCATGG - Intergenic
1177594504 21:23219136-23219158 TTCAATTATAAATAAGATTTGGG - Intergenic
1177597602 21:23266137-23266159 TTTAATTTGAAAATATTTTATGG - Intergenic
1177647309 21:23916230-23916252 TTAAGTTTTAAAATATAGTAGGG + Intergenic
1177751316 21:25287655-25287677 TTAAATATAAAATTAGATTATGG + Intergenic
1178559427 21:33624948-33624970 TACAATTTTAAAAAAGCTTTTGG + Intronic
1180355834 22:11838789-11838811 GTTTATTTTAAAATATATTAAGG + Intergenic
1180382423 22:12153538-12153560 GTTTATTTTAAAATATATTAAGG - Intergenic
1180482194 22:15764350-15764372 TTCACTTATAAAACTGATTATGG + Intergenic
1180622412 22:17171131-17171153 TTAAAATTTAAAATTCATTACGG + Intergenic
1181727947 22:24824543-24824565 TTTAATTTTTAAATCTATTAGGG - Intronic
1181995218 22:26873407-26873429 TTCAATTTTTTGATAGATTTTGG + Intergenic
1184270337 22:43377596-43377618 TTCCATTTTAAGAAAGATGAGGG + Intergenic
949289452 3:2447035-2447057 TTCAATTTAAGAAAAAATTATGG + Intronic
950292676 3:11798904-11798926 TTATATTTTAAGATATATTAAGG - Intronic
950849566 3:16049971-16049993 TTGATTTTTAAAATATATTATGG - Intergenic
950985170 3:17356018-17356040 TTTAATATTAAAAATGATTATGG - Intronic
951120432 3:18920588-18920610 TACAATTCTAAAATATAGTAAGG + Intergenic
951158027 3:19378675-19378697 TTCAGTGTTAAAATAGATTGTGG - Intronic
951335285 3:21413714-21413736 TTGAAATTAAAAATAGACTATGG - Intergenic
952049422 3:29365163-29365185 TTCAATTTTCACATAGATTTTGG + Intronic
952125525 3:30295596-30295618 TGCAATTTGAAAATACAATATGG - Intergenic
952177208 3:30877844-30877866 TTAAATATTAAAATCTATTATGG - Intronic
952542699 3:34383585-34383607 AACAATTTTAAAAGAGATCAAGG - Intergenic
952779267 3:37079115-37079137 TCCAATTTTAAAATGGACAAAGG + Intronic
953245968 3:41192985-41193007 TTTAATTATAAAATCGATTTGGG - Intergenic
953446431 3:42972477-42972499 TTCAATTTGGAAATATATTGAGG + Intronic
954533757 3:51342737-51342759 TTAAATTTTAACATGGACTAGGG + Intronic
954923160 3:54209112-54209134 TACAATTTAAAAAGAGATTTGGG + Intronic
955098418 3:55823058-55823080 TTCTATTTTAAAAGACATGAAGG + Intronic
955571781 3:60314910-60314932 TTAAATTTTAAAATAGAGACAGG - Intronic
955619308 3:60845132-60845154 ATCAATGTTTAAATATATTAAGG + Intronic
955913894 3:63886691-63886713 TTTATTTTTAAAAAAGACTATGG + Intronic
956026055 3:64984220-64984242 TTGAACATTAAAATAGAATAGGG - Intergenic
956559289 3:70556110-70556132 TACAATTTAAAAATAAATTCTGG - Intergenic
956735674 3:72236156-72236178 TTCAACTTTAAAATATCTTTTGG + Intergenic
956922925 3:73949990-73950012 GTCTATTTTAAAATTAATTAAGG - Intergenic
957111253 3:75961533-75961555 CTCAATTTTAATATCGATTCTGG + Intronic
957113859 3:75999385-75999407 TTTAATTTTAAAACAGTTTTAGG + Intronic
957176220 3:76813638-76813660 TTTTATTTTAACATAGAGTAAGG - Intronic
957356774 3:79099097-79099119 TTCAGTTATGAAAAAGATTAGGG - Intronic
957410301 3:79831194-79831216 TTTAATTTTAAAATAGGCTGGGG + Intergenic
957610182 3:82455661-82455683 TTCCCTTTTAGAAAAGATTAAGG + Intergenic
957745994 3:84344021-84344043 TTCCATTTCAAAAAACATTAAGG + Intergenic
957774992 3:84746550-84746572 TTCAATTTTACTATAGAATTTGG - Intergenic
957962625 3:87278340-87278362 TTAATTTTTAAAAATGATTATGG - Intergenic
958252691 3:91288720-91288742 TTCAATTTTAAAACGGATAAAGG + Intergenic
958262257 3:91395432-91395454 TGTAATTTTACAATAAATTATGG - Intergenic
958534229 3:95376411-95376433 TACAAATTTAAAATATATTTAGG + Intergenic
958535113 3:95391195-95391217 TGCCATTTTTAAATAGAATATGG - Intergenic
958560985 3:95745601-95745623 TACAATTTTAAATGAGATTTGGG + Intergenic
958675851 3:97267590-97267612 TTCAAATTTAAAATATAAAATGG - Intronic
958843409 3:99236368-99236390 TTCAATGTTAAAATACAATGTGG - Intergenic
959230383 3:103642093-103642115 TTAAATTGTAAAATAAATTATGG + Intergenic
959283284 3:104374705-104374727 TTTAATATTAAAATATAATATGG - Intergenic
959305549 3:104660680-104660702 TTTAATTTTAAAATGTAGTAGGG - Intergenic
959342298 3:105147363-105147385 TTCATTTTTCAAATTCATTATGG + Intergenic
959346123 3:105196843-105196865 TTCATTTTTTAAAAAGATTGTGG + Intergenic
959350739 3:105259807-105259829 TTCAATTTTTATATAAATTACGG - Intergenic
959369615 3:105506746-105506768 TTCCATTTTAAAAGAGACAATGG - Intronic
959404357 3:105942115-105942137 ATAAATTTTAAAATATATAAAGG + Intergenic
959518277 3:107295624-107295646 TTCAATTTTAAAATAGATATGGG + Intergenic
959757853 3:109920591-109920613 TTCAATATTAATATAGATGAAGG + Intergenic
959806924 3:110565961-110565983 TTCAGTTTTAAATTAAAATATGG - Intergenic
959891777 3:111564370-111564392 TTCATTTTCAAAATAGAATGAGG - Intronic
959924023 3:111902034-111902056 TTTACTTTTAAAAAATATTAAGG - Intronic
960547041 3:118927260-118927282 ATTAATTATAAAATAAATTAAGG + Intronic
960582941 3:119295687-119295709 CTCCATTTTTAAATAGTTTAGGG + Intronic
960652968 3:119971943-119971965 TTTAATTTTTAAAGAAATTAGGG - Intronic
960767720 3:121155090-121155112 TATCATTTTAAAACAGATTATGG + Intronic
961253497 3:125525923-125525945 TGCAGTTTTAACAGAGATTAAGG - Intergenic
962620872 3:137177225-137177247 TTCCTTTTAAAAATACATTAAGG + Intergenic
962659622 3:137588140-137588162 TTAAATTTGAATATAGACTATGG + Intergenic
962777858 3:138680508-138680530 TCCAATTTTAAAGTAAATTGTGG + Intronic
963210692 3:142686390-142686412 TTAACTTTTAAAATATATTGTGG + Intronic
963453205 3:145511258-145511280 TTCAATCTTAGAATACATTTTGG + Intergenic
963541411 3:146594559-146594581 TTCAATTTTTATATATATTTAGG + Intronic
963789858 3:149572836-149572858 TTTAATTTTAAAAAAGCTTGAGG + Intronic
964082059 3:152771491-152771513 GTCAATTTTAGAAAAAATTAAGG - Intergenic
965069249 3:163896328-163896350 TTCAATCTGAAAATAAATTTGGG + Intergenic
965646674 3:170889856-170889878 TTTCATTTTAGAATAGATTTTGG - Exonic
965932712 3:174066488-174066510 CACAGTTTTTAAATAGATTATGG + Intronic
966025941 3:175282075-175282097 TTCAATCATAAAATATTTTAAGG - Intronic
966043076 3:175515979-175516001 TTTTATTTTAAAATAAATAAAGG + Intronic
966090984 3:176135757-176135779 TTGAATTTCCAAATAGGTTAGGG + Intergenic
966347791 3:178998103-178998125 TTTATTTTAAAAATAGAATATGG + Intergenic
966509263 3:180743437-180743459 TTGAATTTTAAATTAGAGTTTGG - Intronic
966509997 3:180751714-180751736 GTCAATTATAAAATAGCTTGAGG + Intronic
966654195 3:182335263-182335285 TCAAACTTAAAAATAGATTAGGG - Intergenic
967568743 3:191002521-191002543 GTCAATTTAAAAATAGATTAAGG - Intergenic
967591988 3:191288220-191288242 TGGAATTTTAAAAGAGATTGCGG - Intronic
968078499 3:195830357-195830379 TTCAATTTTAAAATGTGTAAAGG + Intergenic
968565201 4:1308734-1308756 TCCAATTTTAAAATGGGTGAAGG - Intronic
968774237 4:2530072-2530094 GTCAATTTTAACAAAGATTGTGG - Intronic
970152391 4:13103285-13103307 TTCCAATTAAAAATAGATAAAGG - Intergenic
970200106 4:13595720-13595742 TCACTTTTTAAAATAGATTAGGG - Intronic
970935366 4:21564150-21564172 TTCTCTTGTAAAATAGATTGTGG + Intronic
971097619 4:23425718-23425740 TTCTATTTTAAAATTTATTTTGG - Intergenic
971663886 4:29457216-29457238 TTCCATTTAAAAGTAGATTTTGG + Intergenic
971782911 4:31060657-31060679 TTCAATTTCAACATATATGAAGG + Intronic
971893328 4:32555317-32555339 TTCAATTTTACATTACAATATGG - Intergenic
971895768 4:32592005-32592027 TTCAATTTTAAAACATATAGAGG - Intergenic
972181461 4:36471984-36472006 TTCAAGTTTAAATTAGAATCAGG + Intergenic
972420823 4:38884532-38884554 TTTGCTTTTTAAATAGATTATGG + Intronic
972551411 4:40138256-40138278 TCCAATTTAAAAATAGACAAAGG - Intronic
972749725 4:41976361-41976383 TACAATTTTAAAATAACTTCAGG - Intergenic
972757707 4:42066143-42066165 TTAATTTTAAAAATAGATGAAGG - Intronic
973132637 4:46667043-46667065 GTCAATTTTAAAATACATTTGGG - Intergenic
973247870 4:48029560-48029582 CTGATTTTTAAAATAGATTCAGG - Intronic
973728356 4:53798791-53798813 TTCAATCTTTAATTAAATTAAGG - Intronic
973844551 4:54897939-54897961 TTAAATTTTAAAATATCTTGTGG + Intergenic
973927612 4:55755350-55755372 TTCAATATAAACATAAATTAAGG + Intergenic
974576866 4:63736811-63736833 TTAAATTTTAAAAGGAATTATGG - Intergenic
974645348 4:64683326-64683348 TTCATGTTTAAAATATTTTAAGG + Intergenic
975376076 4:73647211-73647233 TTCAATTAAAAAATAGAATTTGG + Intergenic
975547435 4:75574087-75574109 TGTAATTTTAAAATATATTCTGG + Intergenic
975842135 4:78486351-78486373 TTGTATCCTAAAATAGATTATGG - Intronic
975883068 4:78934015-78934037 TTCCATTATAAAATTGGTTATGG + Intronic
976029133 4:80729902-80729924 TTAAATTTAAAAATAGATGCTGG - Intronic
976079206 4:81336072-81336094 CAAAATTTTAAAATATATTAAGG - Intergenic
976162979 4:82223229-82223251 TTTTATTTTAAAATACTTTAGGG - Intergenic
976252581 4:83068049-83068071 TTCAATTTTTAAAGAGTTTCTGG + Intronic
976256322 4:83104128-83104150 CTTAATTTTAAAATACTTTATGG - Intronic
976714182 4:88105862-88105884 TTCAATTTTAAAATGGGCAAAGG + Intronic
976739462 4:88343649-88343671 TTCATTTTTACTATAGATCATGG - Intergenic
976887382 4:90002446-90002468 TTCAATTTTAAAATATTGTAAGG + Intergenic
977091230 4:92678295-92678317 TTCAATTATAAATTCGATAAGGG + Intronic
977311055 4:95387537-95387559 TTCACTTTTAAAATGTAATAAGG + Intronic
977348029 4:95842101-95842123 TTAAATTTTAGAATATATAAGGG - Intergenic
977436294 4:96999800-96999822 ATCCATTAAAAAATAGATTATGG + Intergenic
977628396 4:99214469-99214491 CTCACTTGTAAAATAAATTAAGG - Intronic
977705071 4:100061659-100061681 TGCACTCTTAAAAAAGATTAGGG - Intergenic
977836868 4:101655460-101655482 TTCGATTATAAAATATATTGTGG - Intronic
978485535 4:109249472-109249494 TTAAATTTCAAAATAGATTTTGG - Intronic
978691716 4:111520833-111520855 TTCAATTTGAAAGCACATTATGG - Intergenic
978717865 4:111867827-111867849 TTTAATTTTAACTTAAATTATGG + Intergenic
978765136 4:112397551-112397573 TACAACTTTAAAAGAGCTTAGGG + Intronic
979101038 4:116614901-116614923 TAAAATTTCAAAATACATTAAGG + Intergenic
979422190 4:120518446-120518468 TTACATTTTAAAAGAAATTAAGG + Intergenic
979474344 4:121137286-121137308 TGCAATTTTAAAATCTATTATGG - Intronic
979700561 4:123662082-123662104 TTTATTTTTAAAATAGATTTAGG + Intergenic
979761929 4:124416809-124416831 TTCAACTTTCAAATATATTTGGG + Intergenic
979782705 4:124673863-124673885 TTCTATTTTTATATAGATTTAGG - Intronic
979909776 4:126348463-126348485 ATGAATTTTAAAATTGAATATGG - Intergenic
980241719 4:130186472-130186494 TTCAATCATAAAATATATTAGGG + Intergenic
980338683 4:131511847-131511869 TTCGATTTTAAAAATGCTTAAGG + Intergenic
980512019 4:133805314-133805336 ATCATTTTTAAAATAAATTCTGG + Intergenic
981139140 4:141248089-141248111 TTCTATTTTAACAAAAATTAAGG - Intergenic
981622503 4:146718534-146718556 TCTAATTTTAAAATAGGCTAGGG - Intronic
981630451 4:146812886-146812908 CTGAATTTTATAATAGAATAGGG - Intronic
981705823 4:147658222-147658244 TTCAATTCAACAATATATTATGG - Intronic
981800154 4:148646443-148646465 ATTACTTTTAAAATAGCTTAAGG - Intergenic
982123499 4:152164035-152164057 TTCAATTTAAAAATAAGTCAAGG - Intergenic
982293383 4:153802495-153802517 ATCCATCTTAAAGTAGATTAAGG - Intergenic
982403186 4:154991192-154991214 TACAATTTTAATATAGGTCATGG + Intergenic
982477369 4:155870089-155870111 TTCCATTGTTAAATAGATGAGGG - Intronic
982599367 4:157426651-157426673 TTAAATTTTTAAATATTTTACGG + Intergenic
983033423 4:162832389-162832411 TTCAATTTAAAAATATATGGTGG + Intergenic
983093121 4:163529492-163529514 TTACATTTTAAAATAAATGAGGG - Intronic
983141683 4:164157167-164157189 TACAATATTAAAAGATATTATGG + Intronic
983229360 4:165113480-165113502 TTCAATTTTAAAAGAAACAAGGG - Intronic
983378667 4:166962439-166962461 TTCTAGTTTAAAACAGATGATGG - Intronic
983870543 4:172820376-172820398 TTCAAATTTTGAATAGGTTAAGG - Intronic
983905810 4:173181603-173181625 TTCTATTTTAAAATAAATGTAGG + Intronic
983978905 4:173970209-173970231 TTCAATTTTTAAAAAGTTTTAGG + Intergenic
984043109 4:174762183-174762205 TCAAATTTTAAAATAAATAATGG + Intronic
984154575 4:176179229-176179251 TTCTATTTTAACAGATATTAGGG + Intronic
984319653 4:178177248-178177270 TACAATTTTATAATAAGTTATGG + Intergenic
984442034 4:179783774-179783796 TTCAATTTTTTAATAGATACAGG + Intergenic
984451072 4:179902949-179902971 TTCAATTTTAAAATATTCTCTGG + Intergenic
984483460 4:180336000-180336022 TTAAATTTTAAGAAATATTAAGG - Intergenic
984774050 4:183465039-183465061 TTAGATTTTTAAATTGATTATGG - Intergenic
984989874 4:185369694-185369716 TTTAATTTTAAAGTAATTTAGGG + Intronic
985028577 4:185764796-185764818 TTCTATTTTAAGATAAATGATGG - Intronic
985188808 4:187348574-187348596 ATAAAGTTAAAAATAGATTAGGG - Intergenic
986562380 5:9074613-9074635 TTAACTTTTAAAATACATAATGG - Intronic
986585321 5:9310688-9310710 TTAAATTTAAAAATAAATTGAGG - Intronic
986872510 5:12066575-12066597 CTCTATTTTAAAATAAAATAGGG - Intergenic
986888157 5:12266103-12266125 TTCAGACTTACAATAGATTATGG + Intergenic
987357039 5:17072784-17072806 TTAAATTTTTAAATAGAGTTGGG + Intronic
987583948 5:19830309-19830331 TTTAATTTTCATATAGATTCTGG - Intronic
987648280 5:20705196-20705218 TTTAATTTAAAAATATAATAGGG + Intergenic
987849379 5:23329955-23329977 TTTAATTTTGAAATAAATTCAGG + Intergenic
987942917 5:24565543-24565565 CTCAATGTTAAAATTTATTATGG + Intronic
987973854 5:24985900-24985922 GACAATTTTCAAATAGAATATGG - Intergenic
988228034 5:28439549-28439571 TTCAATTTTTAAAAATGTTATGG + Intergenic
988288528 5:29254234-29254256 TTTATTTTTAAGATAGATTTTGG + Intergenic
988288919 5:29259220-29259242 ATTAATTGTAAAACAGATTATGG - Intergenic
988444465 5:31270074-31270096 TACATTTTTAAAAAAGATAAAGG + Intronic
988477287 5:31597999-31598021 TTCAATTTAAAAATTGTTTTAGG + Intergenic
988748048 5:34163697-34163719 TTTAATTTGAAAATATAATAGGG - Intergenic
989205834 5:38808269-38808291 TTCAATTTTTAATTAAATCATGG - Intergenic
989488705 5:42024383-42024405 TAAAATTTTAAAAAAGAGTATGG - Intergenic
989713199 5:44426634-44426656 ATAAATCTTAAAATATATTAAGG - Intergenic
989764986 5:45071835-45071857 TTCAATTTTAGAATACCCTATGG - Intergenic
989814028 5:45713394-45713416 TTCAGTTTTCAAATAAAGTATGG + Intergenic
990020524 5:51121009-51121031 CTAAATTTTAATATAAATTAAGG - Intergenic
990069789 5:51767076-51767098 ATCATGTTCAAAATAGATTAAGG - Intergenic
990091526 5:52057049-52057071 TTCAATTTTATTTTAGATTCAGG + Intronic
990790813 5:59476679-59476701 TTTACCTTTAATATAGATTATGG + Intronic
990866250 5:60383657-60383679 TTGAACTATAAAACAGATTAGGG - Intronic
990891636 5:60656848-60656870 TTCAATTCTAGAAGAGATTTGGG + Intronic
990962359 5:61408121-61408143 TGCAATTCTAAAAAAGAATAAGG + Intronic
991252036 5:64573747-64573769 TTGAAATATAAAATACATTATGG - Intronic
991395504 5:66200401-66200423 TTTAATTTTTAAATAGTTTTAGG + Intergenic
992151255 5:73905873-73905895 TTCCATTTGAAGATGGATTAGGG + Intronic
992329653 5:75702950-75702972 CTGAAATTAAAAATAGATTAAGG - Intronic
992512996 5:77458856-77458878 TTCAATTTGAAATTAGAGCAAGG - Intronic
992527066 5:77621915-77621937 TTCAAATCTAAAATGGCTTATGG + Intergenic
992556966 5:77913463-77913485 TTCTATTTTAAACTAAATAATGG + Intergenic
992764065 5:79978610-79978632 ATCCATATTAAAATAAATTAGGG + Intronic
992786088 5:80172034-80172056 GTCAATTAAAAAATAAATTAGGG + Intronic
992814526 5:80423191-80423213 TTAATTTTTAAAATAGATGTAGG + Intronic
992917297 5:81470407-81470429 TTTAGATTTAAAATAGATTAAGG + Intronic
992942471 5:81775805-81775827 TTCTAGTTTTAAATGGATTATGG - Intergenic
993079758 5:83281526-83281548 TTCAATTTTTAAATTAATGATGG - Intronic
993306032 5:86276702-86276724 TGCAATTTTAAAGTAGATAAAGG - Intergenic
993369327 5:87072983-87073005 TATAATTTTAAAATATTTTAAGG - Intergenic
993564542 5:89457176-89457198 TTGGATTTTAAAATAGAAAAGGG + Intergenic
993868472 5:93222130-93222152 CTCAATTTTTAAATATATGAAGG + Intergenic
993950753 5:94171964-94171986 TTCAATGTTCAAATACATTGAGG - Intronic
994303041 5:98169897-98169919 TTTAATTTGAAAATAGTTTTAGG + Intergenic
994414608 5:99453673-99453695 TTAAATTTTTAAACATATTATGG + Intergenic
994793585 5:104264130-104264152 TTGAATTTTAAACTAAATTCTGG - Intergenic
995024226 5:107399911-107399933 TTCTAATTTAAAATATATAATGG + Intronic
995068468 5:107890016-107890038 TTTAATTTTAAAATTTAATAGGG - Intronic
995313693 5:110741373-110741395 TTCAAGTTTTAAATAGTTTGAGG - Intronic
995443630 5:112219115-112219137 TTCAAATTCAAAACATATTAGGG - Intronic
995604580 5:113838284-113838306 TTCAATTTAAAAATAGGTAAAGG - Intergenic
995759795 5:115551208-115551230 TACAATTTTAAAATTAATTTGGG - Intergenic
995892342 5:116968605-116968627 TACAATTTTAAGTCAGATTATGG + Intergenic
996020399 5:118584997-118585019 TGCATTTTTAAAACAGATGATGG + Intergenic
996045679 5:118870573-118870595 CTTAATTTTAAAATACTTTATGG + Intronic
996344000 5:122470314-122470336 TTGAATTTTAAAATATATGATGG - Intergenic
996656608 5:125945182-125945204 TTCATTTTTAAAATAGGAAAGGG + Intergenic
996973516 5:129402237-129402259 AACAAATTTAAAATTGATTAAGG + Intergenic
997329624 5:133050725-133050747 TTCACTTTTAAAATGGCTGAAGG + Intergenic
997440374 5:133904977-133904999 TTGAATTTAAAAACAGAATAAGG + Intergenic
998297006 5:140980664-140980686 TTCAATTTGAAAATGGGATAAGG - Intronic
998582621 5:143395129-143395151 TTCTATGCTAAACTAGATTAGGG - Intronic
998712729 5:144845608-144845630 TTCATTTTTAGAATAGTTTTAGG + Intergenic
998846863 5:146318790-146318812 TTTTATTTTAAAATATATTTAGG + Intronic
999774509 5:154801521-154801543 TTCAATTATATAATAAATGAGGG - Intronic
999884370 5:155904519-155904541 TTTTATTTTAAAATATATAATGG + Intronic
999960047 5:156744855-156744877 TCCAATTTTTCAAAAGATTACGG - Intronic
1000378935 5:160611508-160611530 TTCATTTTGAAAATTCATTAAGG + Intronic
1000427728 5:161112545-161112567 TTCAATTTTAAAAATTACTATGG - Intergenic
1000514677 5:162225478-162225500 TTCACTTTTAAAAGAGATGGAGG - Intergenic
1000917816 5:167103213-167103235 TTATCTTTTAAAATAGATTTTGG + Intergenic
1001214837 5:169846013-169846035 TTCAATTCAAAATTAGATTGGGG - Intronic
1001862764 5:175072746-175072768 TTCAGTTTCAAAAGAGTTTAGGG - Intergenic
1002144152 5:177165452-177165474 TTGAATTTTAAAGTAGACTAAGG - Intronic
1002777192 6:338680-338702 TTCAATGATAAAATAAATTCTGG + Intronic
1003613683 6:7635909-7635931 CTCAATTTTAAGAAAGACTATGG + Intergenic
1003697505 6:8425095-8425117 TTTTATTTTAAAATATGTTATGG + Intronic
1003779947 6:9413512-9413534 TTCAATTTTAAAATGCATATTGG - Intergenic
1004008765 6:11660919-11660941 TTCAATTTTTAAATAGTTACAGG - Intergenic
1004083819 6:12423849-12423871 TTCAATTTTAAAAAGGATTTAGG - Intergenic
1005545632 6:26866800-26866822 TTTAATTTAAAAATATAATAGGG - Intergenic
1005611673 6:27531811-27531833 TTGACTTTTAAAATAAATTTTGG - Intergenic
1005612722 6:27542227-27542249 TTGACTTTTAAAATAAATTTTGG + Intergenic
1005994862 6:30924947-30924969 TTAAATTTTAAAATAATTTTTGG - Intronic
1007639283 6:43324650-43324672 TCCAATTTTAAAATAGGTAAAGG + Intronic
1007879542 6:45148225-45148247 TACAAGTTTAAAATAGAATATGG - Intronic
1008226507 6:48924776-48924798 TTCTATTTTAATATAAATTCAGG - Intergenic
1008437499 6:51493759-51493781 TTTGATTTTAAAATAGAACATGG + Intergenic
1009001597 6:57723682-57723704 TTCAATTCTAAAATCATTTAAGG + Intergenic
1009016337 6:57907569-57907591 TTTAATTTAAAAATATAATAGGG - Intergenic
1009191788 6:60638204-60638226 TTCAAATTTAAAACAGATAAAGG - Intergenic
1009548954 6:65061386-65061408 TTTAATTTTTAAATAGTTTTAGG + Intronic
1010023354 6:71187445-71187467 TTCTGCTTGAAAATAGATTATGG + Intergenic
1010510634 6:76714742-76714764 TTCATTTTTAAAATATAGTCAGG + Intergenic
1010544859 6:77140210-77140232 TTCAATATCAAGATAGAATATGG + Intergenic
1010636159 6:78261151-78261173 TTCAATTTTAAAATGGAAATGGG - Intergenic
1010776665 6:79894373-79894395 TTCAATTTTTAACTCTATTAAGG - Intergenic
1010866835 6:80985717-80985739 TTCAGTTTTCAAATAGCTTTAGG - Intergenic
1010875694 6:81102685-81102707 TTCAATTTCAACATAAATTTTGG - Intergenic
1011470874 6:87706245-87706267 TTCATTTTTCAAATATATTGTGG - Intergenic
1011777381 6:90747295-90747317 TTCAGTTTTCAAAATGATTATGG + Intergenic
1011992250 6:93536503-93536525 TGCAAAATTAAAATAGATTGAGG - Intergenic
1012003352 6:93681913-93681935 TCCAATTTAAAAATATATTGAGG - Intergenic
1012025382 6:93983781-93983803 TTCAATTCAAAAATAAATTTTGG - Intergenic
1012089953 6:94879121-94879143 TTTAAATTTAATATATATTATGG + Intergenic
1012206040 6:96461464-96461486 TTAATGTTTAAAAAAGATTAAGG + Intergenic
1012226865 6:96714631-96714653 TTCAAGTTTCAAACAGATTTTGG - Intergenic
1012312842 6:97749353-97749375 TTAAAATTTGAAATAGATAAGGG + Intergenic
1012326888 6:97930542-97930564 TTCATTGTTAAAATAACTTAGGG - Intergenic
1012505285 6:99939328-99939350 TTTATTTTTAAAATCTATTATGG + Intronic
1012556436 6:100518528-100518550 TTCAAATTTAAAATCAATAATGG + Intronic
1012633835 6:101510093-101510115 TTCAATTTTTAAAGAGATATAGG + Intronic
1012681661 6:102190334-102190356 TTCATTTTTAAAATAAATGAAGG - Intergenic
1012882390 6:104806158-104806180 TTCATTTCAAAAACAGATTAAGG + Intronic
1013071661 6:106734843-106734865 TTCAAACTAAAAATATATTATGG - Intergenic
1013718477 6:112992653-112992675 TACAAATTTAAAATACAATAAGG + Intergenic
1013722267 6:113044600-113044622 TTGATTTTTAAAATAAATAATGG + Intergenic
1014364022 6:120518020-120518042 TAAAATTTTAAAATAATTTAAGG + Intergenic
1014471876 6:121825992-121826014 TTGAATTTTAAAATATAGTATGG - Intergenic
1014498688 6:122159326-122159348 TTAACTTTTATTATAGATTAAGG + Intergenic
1014532207 6:122571755-122571777 TTCCATTTTGATATAGATCAAGG - Intronic
1014599471 6:123391618-123391640 TGGAATTTTAAAATAATTTAAGG - Intronic
1015397644 6:132753025-132753047 TTAAATTTAAAAAAAGCTTACGG - Intronic
1015435339 6:133179926-133179948 TTCTTTTTTAAAATAGCTGAAGG + Intergenic
1015560309 6:134507745-134507767 TTCAGTTTTAATTTATATTATGG - Intergenic
1015656721 6:135526842-135526864 GTCAATTTTAATATAGTTTTGGG + Intergenic
1015690651 6:135918336-135918358 TTCAGTTTTGTAATAGTTTATGG + Intronic
1015961758 6:138657481-138657503 TTCATTTTTCAAATAGTTCAGGG - Intronic
1016064864 6:139670682-139670704 TCCAATTTTAAAATAGGCAAAGG + Intergenic
1016096822 6:140047965-140047987 TTCAATTTAAAAAAAGAAAATGG - Intergenic
1016444953 6:144121721-144121743 TCCAATTTAAAAATAGATAAAGG - Intergenic
1016746707 6:147588688-147588710 TGCAATTTTGAAATAGCTTTTGG + Intronic
1016914389 6:149231499-149231521 TTAAATTTTAAACTTGATTTGGG + Intronic
1017267815 6:152471219-152471241 TTGAATTTTAAAAGACATGAAGG + Intronic
1017297054 6:152810098-152810120 TTCATTGTTAAATTACATTAAGG + Intergenic
1017316012 6:153032231-153032253 TACATTTTTATAATAGAGTATGG + Intronic
1017678732 6:156842052-156842074 TTCAATTTTCAAATTGTTAAAGG - Intronic
1018880341 6:167872448-167872470 TTAAATTTTCAGATAAATTATGG + Intronic
1018897003 6:168026603-168026625 TTTATTTTTAAAATAAGTTAAGG - Intronic
1019167119 6:170104660-170104682 TTCAGTGCTAAAAGAGATTATGG + Intergenic
1019828640 7:3303537-3303559 TACATTTTAAAAATATATTAAGG + Intronic
1020742446 7:12039058-12039080 TCCAATTTAAAATGAGATTAGGG + Intergenic
1020935378 7:14458218-14458240 TTAAATTTTAAAAGAAATTTGGG - Intronic
1020936001 7:14464792-14464814 CTCATTTTTAAAATATATGAAGG + Intronic
1021013895 7:15507991-15508013 TTCCATTTTAAATTTTATTACGG - Intronic
1021165969 7:17341299-17341321 TTCAATTTTAATATAATTGAAGG - Intronic
1021252487 7:18347938-18347960 TTGAGTTTTGAAATAGATAAAGG + Intronic
1021456754 7:20837786-20837808 TTCAATTTTAAAAAACATCCAGG + Intergenic
1022161715 7:27717644-27717666 TTTATTTTTAAGATGGATTAAGG + Intergenic
1022648509 7:32253888-32253910 TTCACTTTTAAAATAGGAAAAGG + Intronic
1022664295 7:32395985-32396007 TTCACTTTTAAATTAATTTAGGG - Intergenic
1022897486 7:34766024-34766046 TTCAACTTTAATTTAGATTCAGG - Intronic
1023041781 7:36178965-36178987 TTAAACTTGAAAAGAGATTATGG + Intronic
1023276113 7:38520548-38520570 TTCAATTGTAAAATATTTAAAGG - Intronic
1024013086 7:45287308-45287330 TACAATTTTAGGATAGATTAAGG + Intergenic
1024161990 7:46685581-46685603 TTAAATTTTAAAATAGTAGAAGG - Intronic
1024309255 7:47954056-47954078 TTAAATTTTTAAATAGCTTGAGG + Intronic
1025928367 7:65976630-65976652 TTTAATTTAAAAAAAGATTTTGG + Intronic
1026241597 7:68580223-68580245 TTTAATTTTACAATATAATAAGG + Intergenic
1026496184 7:70905523-70905545 TCTATTTTTAAACTAGATTAAGG - Intergenic
1027330877 7:77091278-77091300 TTCTATTCTAAAAAAAATTAGGG + Intergenic
1027486088 7:78763403-78763425 TTCACTTTTGAAATAAAATAGGG + Intronic
1027565227 7:79783483-79783505 CTCTATTTAAAAATAGATAAAGG - Intergenic
1027688416 7:81308139-81308161 TAAAATTTTAAATTAGACTATGG + Intergenic
1027859733 7:83562275-83562297 TTCAACTTGAAAATAGAAAAAGG + Intronic
1027885234 7:83895786-83895808 ATCAATTTTAAAAAAGATATGGG - Intergenic
1027977358 7:85175859-85175881 TTTAATTTTAAAATATGTCAAGG + Intronic
1028056410 7:86250673-86250695 CTCAATTTTAAATAAGATCATGG + Intergenic
1028128708 7:87145378-87145400 TTAAATTTTCAAATAAATAAAGG + Intergenic
1028166781 7:87547348-87547370 TTATATTTTAAAATACTTTAGGG - Intronic
1028209520 7:88056099-88056121 TGCAATTTTAAAAATGTTTATGG + Intronic
1028390925 7:90315790-90315812 TTAAAGTTTAAAAAAGATTCTGG + Intergenic
1028686807 7:93599419-93599441 TTAATTTTTAAAATAGATTTAGG + Intronic
1028764602 7:94538931-94538953 ATAAATTTTAAAACAGATTTTGG + Intronic
1028789122 7:94833807-94833829 TTCATGTTTAAAATGTATTAGGG + Intergenic
1028835548 7:95370674-95370696 TTTAATTTTAAAATATTTTTGGG - Intronic
1028851898 7:95547120-95547142 TTCAGTTTTTTAAAAGATTAAGG + Intergenic
1028860120 7:95639821-95639843 TTCCATTTTAAGTTAGAGTAAGG - Intergenic
1029884490 7:103853120-103853142 CTCATATTTAAAATAGATTGCGG + Intronic
1029885886 7:103871093-103871115 TCCAGTTTTAAGATTGATTATGG + Intronic
1030039501 7:105437028-105437050 TACAATTTAAAATTAGATTTGGG - Intergenic
1030264124 7:107599818-107599840 TTATATTTTAAAATTGATTCTGG - Intronic
1030566293 7:111162555-111162577 ATCAATTTTAAAATGGAGAATGG - Intronic
1030722991 7:112891747-112891769 CTTAATTTTAAAATACTTTATGG + Intronic
1031062563 7:117068574-117068596 TTCATTTTTCTAATAGAGTAAGG - Intronic
1031367006 7:120913780-120913802 TTCAATGAGAAAAAAGATTAAGG + Intergenic
1031404821 7:121372191-121372213 TCCACTTTTAAAATATATTTAGG + Intronic
1031622388 7:123950267-123950289 TTTAATTTTATTTTAGATTAAGG + Intronic
1031783639 7:126001238-126001260 TTCAATTTTAATACAAGTTAAGG + Intergenic
1031810018 7:126355784-126355806 TTCAATTTTTTCATAAATTATGG + Intergenic
1032144856 7:129369857-129369879 TTCAATTTTAAAACATTTTGTGG + Intronic
1032370537 7:131346151-131346173 TTCACTTAAAAAATAGATGATGG + Intronic
1032622767 7:133554398-133554420 CTCAATTTAAAAATAAATTGAGG + Intronic
1032776001 7:135113763-135113785 TTCAATTTTAAAAGAGAAAAAGG - Intronic
1033269869 7:139921080-139921102 TTCAATTTAAAAAAATACTAAGG - Intronic
1033349190 7:140548325-140548347 TTCAATTTACAATTAGATTGTGG - Intronic
1033391315 7:140930649-140930671 TTCTAGATTAAAAGAGATTAAGG + Intergenic
1033814595 7:145056578-145056600 TTCAATTTTGAAGTAGAGAAAGG + Intergenic
1033867386 7:145708493-145708515 TTCAATTTGAAAGTAAATCATGG - Intergenic
1034287094 7:149892728-149892750 TCCAAATTTAAAATACAATATGG + Intergenic
1034302675 7:150030267-150030289 TTTAAATTTAAAATAGATGAAGG + Intergenic
1034803386 7:154067031-154067053 TTTAAATTTAAAATAGATGAAGG - Intronic
1034846291 7:154449245-154449267 TTCAATTTAAAAATAGGCAAAGG + Intronic
1035543728 8:462414-462436 TTTAATTTAATAATACATTATGG + Intronic
1035960863 8:4136003-4136025 TTCAATTTCAAAAAATATTATGG + Intronic
1036002050 8:4617324-4617346 TTCAAGTTTAAATTAGAAAACGG + Intronic
1036413399 8:8524101-8524123 TTGAATTTTAAAATGGAGTGGGG + Intergenic
1036529439 8:9570044-9570066 AATAAATTTAAAATAGATTAAGG - Intronic
1037010204 8:13832449-13832471 TTTACTTTTAAGATAGTTTATGG + Intergenic
1037061743 8:14520494-14520516 TTACATTTTAAAATATATTTGGG - Intronic
1037107514 8:15127652-15127674 TTCAATTTTAAAGTAACTTAAGG + Intronic
1037113833 8:15199773-15199795 CTCAATTAAAAAATAAATTATGG + Intronic
1037429827 8:18798552-18798574 TTAAATTGTAAGATATATTACGG + Intronic
1038285102 8:26199351-26199373 TGCAATTTTTAAATAGAGTGTGG + Intergenic
1038344711 8:26721615-26721637 TTCCATTTAATAATAGATGAAGG - Intergenic
1038470938 8:27819628-27819650 GTCAATTTTAATAAATATTATGG + Intronic
1038990575 8:32863093-32863115 TTAAATTTTAAAACTCATTATGG - Intergenic
1039561869 8:38518890-38518912 TGTAAATTTAAAATAAATTATGG - Intronic
1039588194 8:38724558-38724580 TTCAATTTTAACATATAACATGG + Intergenic
1039640168 8:39210885-39210907 TCCAATTTTAAAATAGGCAAAGG - Intronic
1039718497 8:40136545-40136567 TAAAATTTTAAAAAAGGTTATGG + Intergenic
1040085513 8:43336161-43336183 TTCATTTTGAAAATAGTTAATGG - Intergenic
1040120029 8:43673654-43673676 TTATATTTTGAAAGAGATTAAGG - Intergenic
1040476087 8:47779220-47779242 TTCAATGTTAATATTGAATATGG - Intronic
1040788542 8:51196618-51196640 TACAATTTTAAATTTAATTATGG - Intergenic
1041481856 8:58331176-58331198 ATCAATTTTTAAATACATTCAGG + Intergenic
1041551509 8:59107104-59107126 TAAACTTTTAAAATAGATCAAGG + Intronic
1042218930 8:66454342-66454364 TTCAATTTAAGAATACATTTAGG - Intronic
1042218936 8:66454451-66454473 TTCAATTTAAGAATACATTTAGG - Intronic
1042293300 8:67192374-67192396 TTCAATTTGAAAATGGACAAAGG - Intronic
1042323014 8:67497954-67497976 TTAAATTTAAAAATAGAGGATGG - Intronic
1042507543 8:69576971-69576993 TTCACTTTTAAAAGAGATGCAGG - Intronic
1042689109 8:71477385-71477407 TTCAATTTTAAAATGGGCAATGG + Intronic
1042719117 8:71807906-71807928 TTCCATTTAAAAACAAATTATGG + Intergenic
1042743574 8:72077571-72077593 TTAATTTTTAAAAAATATTATGG + Intronic
1042899626 8:73710740-73710762 TTAGATTTTAAAATATATTTTGG - Intronic
1042948542 8:74178292-74178314 TGCAAATTTAAAGTAGCTTAAGG + Intergenic
1043600618 8:81933305-81933327 TTGATTTTTAAAATTAATTATGG + Intergenic
1043707654 8:83372632-83372654 TGCAATTTTTAAATAATTTATGG + Intergenic
1044052709 8:87528085-87528107 AACAATTTTCAAATATATTAGGG - Intronic
1044142037 8:88668568-88668590 TTAAATTTCCAAATACATTAAGG + Intergenic
1044173780 8:89090776-89090798 TTACATTTTAAAATATATTAAGG - Intergenic
1044181238 8:89198019-89198041 CTGAATTTGAAAATACATTAAGG + Intergenic
1044189874 8:89302548-89302570 ACAGATTTTAAAATAGATTATGG - Intergenic
1044376167 8:91473682-91473704 TTTAATTTAAAAATAAATTTTGG + Intergenic
1044488691 8:92785977-92785999 TTTAATTTTACAATAGATGAAGG + Intergenic
1044579587 8:93811642-93811664 ATAAACTTAAAAATAGATTAAGG - Intronic
1044997006 8:97846715-97846737 TTAAATTTTAAAATATTTTTGGG - Intronic
1045121124 8:99035972-99035994 TTCTATTTTAAAATGGACAAAGG - Intronic
1045511981 8:102818823-102818845 TTTTATTTTAAAATATTTTAAGG + Intergenic
1045608135 8:103801974-103801996 TTCATTTGTAAAATATATTTTGG + Intronic
1045624002 8:104020676-104020698 TTCAATTTTAAAACAATTTCTGG - Intronic
1045744455 8:105400983-105401005 TTCAATTTTAAAATTCCTTGGGG - Intronic
1045765242 8:105659845-105659867 TTCTATATAAAAAGAGATTACGG + Intronic
1046209553 8:111051135-111051157 TTCAATTAAAAAATAGATCTAGG + Intergenic
1046347743 8:112957317-112957339 GTTAATGTTAAAATAAATTATGG + Intronic
1046371450 8:113313755-113313777 TACAAGTTTAAAAAAGCTTATGG + Intronic
1047109422 8:121772425-121772447 TTCAATTTGGAAGTAGATTGAGG - Intergenic
1047381025 8:124363102-124363124 TTCAATTTGAAATTTGATTTTGG - Intronic
1047472455 8:125190499-125190521 TTACATTTTAAAGTAGATTTGGG + Intronic
1047855193 8:128901903-128901925 TACAATTTTAAATGAGATTTGGG + Intergenic
1047999032 8:130361680-130361702 TTCAAATTTAAAGAGGATTATGG - Intronic
1048367214 8:133748747-133748769 TTCAATTTTAGAATAAAGTCAGG + Intergenic
1048492304 8:134905310-134905332 TTGAAATATACAATAGATTATGG - Intergenic
1050202041 9:3156066-3156088 AAAAATTTTAAAATAGATTTAGG - Intergenic
1050225399 9:3448994-3449016 TTTAATTTTAAAGTAGTTTGGGG - Intronic
1050772249 9:9216850-9216872 TTCCATTTTAAATTATTTTAAGG - Intronic
1050832439 9:10030366-10030388 TTCAATTTTCACATATTTTAAGG + Intronic
1050945143 9:11508190-11508212 TTCAATTTTAAAATGGGCAAAGG - Intergenic
1051087488 9:13367082-13367104 TACAATTTTAAAAAAGATTTTGG + Intergenic
1051481549 9:17567357-17567379 TTTAATTTTCAATTAGATTCAGG - Intergenic
1051499937 9:17765581-17765603 TTCATTTTTAACATGGCTTAAGG + Intronic
1051728220 9:20110692-20110714 TTAAATTTTAAATTATTTTAAGG + Intergenic
1051972434 9:22906246-22906268 TTAAATTTTAAAATTGACTGTGG + Intergenic
1052081295 9:24209251-24209273 TTAAATTATATAATAAATTAAGG + Intergenic
1052140160 9:24971187-24971209 TTGAATTTTAAAACAGGTAAAGG + Intergenic
1052204403 9:25821537-25821559 ATTAATTTTAAAAAAGAATAAGG - Intergenic
1052221591 9:26030764-26030786 TTTATTTTTAAAATATATAATGG + Intergenic
1052524668 9:29599605-29599627 TTTAAGTTTATAATATATTATGG + Intergenic
1052751322 9:32494515-32494537 TACAATTTTAAAAAAGAATGAGG - Intronic
1052751643 9:32497893-32497915 TTCATTTTAAAAATTGAATAAGG - Intronic
1053261385 9:36668302-36668324 CAAAATTTTAAAAGAGATTAGGG - Intronic
1053322283 9:37109899-37109921 TTCAATTTAAAAATTGATAGTGG + Intergenic
1055245191 9:74232695-74232717 TTCAGTTTTAAATTAGTTTAGGG + Intergenic
1055412039 9:76041112-76041134 TAAGATTTTAAAATAGATTTTGG - Intronic
1055484450 9:76743930-76743952 TGCAATTTAAAAACAGATAAAGG + Intronic
1055992084 9:82117433-82117455 TTCAATATTAAAATATTTAATGG + Intergenic
1057428208 9:94971380-94971402 TTGAATTTCAAAATATATTCTGG - Intronic
1057466650 9:95320198-95320220 TTGAATCATAAAATTGATTATGG + Intergenic
1057740551 9:97707723-97707745 ATCAATTTTAAAATGGACAAAGG - Intergenic
1057877701 9:98770631-98770653 TAAAATTTTACAAGAGATTAAGG - Intronic
1058090856 9:100803914-100803936 GACAATTTTAAAATTGATTGTGG + Intergenic
1058115886 9:101083697-101083719 TTCTTCTTTAAAATAGATAAAGG - Intronic
1058485114 9:105435883-105435905 TTTAATTTTAGAATAGTTTTAGG - Intronic
1058542207 9:106023235-106023257 TTTAAATATAAAATAGAATAGGG - Intergenic
1058927070 9:109677049-109677071 TTCACTTTTAAAGTAAAATAAGG + Intronic
1059100992 9:111471364-111471386 TTCAACTTTAAAATAAATTTTGG - Intronic
1059294188 9:113255142-113255164 TTCAAATTTAAATTAGCTGAAGG + Intronic
1060034832 9:120245980-120246002 TTAAAGTTTAAAAAAAATTATGG - Intergenic
1060613739 9:124992088-124992110 TAAATTTTTAAAATAGATTTGGG + Intronic
1060676670 9:125521498-125521520 AACAATTGTAAAATAGTTTATGG + Intronic
1060680320 9:125557011-125557033 TTGAATTTTAAAATAGAAAAAGG + Intronic
1061665556 9:132159234-132159256 TTCATTTTTAAACTTCATTAAGG - Intergenic
1062355945 9:136162347-136162369 ATGATTTTTAAAATAGATTCTGG + Intergenic
1185920586 X:4087589-4087611 CACACTTTTAAAATAGAATATGG - Intergenic
1186028001 X:5335013-5335035 TTAAATTTTAACATAAATTTTGG - Intergenic
1186091010 X:6049017-6049039 TAAAATTTTAAAAAAGAATAAGG + Intronic
1186447059 X:9639912-9639934 TTAAATTTAAAGATAAATTAAGG - Intronic
1186510535 X:10126759-10126781 TTCGAATTTCAAATAAATTATGG + Intronic
1187194097 X:17065437-17065459 TGCAATTTTAAAATGGACAAAGG - Intronic
1187307864 X:18113357-18113379 TATACTTTTAAAATAGATAATGG + Intergenic
1187428181 X:19197395-19197417 TTTAATTTTTAAAGAGATTGGGG - Intergenic
1187520216 X:20006402-20006424 TGCAATGTTATCATAGATTATGG + Intergenic
1187611652 X:20950074-20950096 TTCAAGTGTAAAAAAGAATATGG + Intergenic
1188069224 X:25698873-25698895 TTCAAGGTTAAAGTAGATTGAGG - Intergenic
1188500612 X:30821590-30821612 ATCAATTTAATAATAAATTAAGG + Intergenic
1188961588 X:36499734-36499756 TTCAATTTCAGAATGTATTATGG + Intergenic
1189084469 X:38006516-38006538 TTCAATGTGTAAATAGATTGTGG + Intronic
1189129792 X:38485752-38485774 TTAATTTTTTAAATAGATTAAGG + Intronic
1189138020 X:38569948-38569970 TTCAATTTTTAAAAAGCTTTTGG + Intronic
1189502105 X:41571331-41571353 TTCAATTTTCAGATAGTATAGGG + Intronic
1189887052 X:45557983-45558005 CTCAATTTTAAAATGGGTAAAGG - Intergenic
1190095452 X:47476486-47476508 TTCAATTTAAAAATAGGCCAAGG + Intronic
1190384976 X:49876659-49876681 TACATTTTTAAAACAGATGATGG + Intergenic
1192156073 X:68747517-68747539 TACAATTTTAATATTGTTTATGG - Intergenic
1192689261 X:73344329-73344351 CCCAATTTTAAAATAGAAAAAGG + Intergenic
1193168857 X:78313451-78313473 TTCAACTTTTATTTAGATTAAGG - Intronic
1193576666 X:83207505-83207527 TTCTATACTGAAATAGATTATGG + Intergenic
1193787206 X:85773706-85773728 TTCAAGTTTAAATTAGTATATGG + Intergenic
1194069828 X:89308873-89308895 TTCATTTTTAAAATTGTTTCAGG + Intergenic
1194197857 X:90917671-90917693 TACAATTATAAAATGCATTATGG + Intergenic
1194859645 X:98980653-98980675 TTTACTTTTAAAGTAAATTAGGG - Intergenic
1194890772 X:99375821-99375843 TTCAATTTTTAAATTTTTTATGG + Intergenic
1194903815 X:99548250-99548272 TTCCATTTTTAAATATATTAAGG - Intergenic
1195222446 X:102758628-102758650 GTCATTTTTAAAAGAGAGTATGG - Intergenic
1195285777 X:103381911-103381933 TTCAATTTTGAAATGTATTTTGG + Intergenic
1195407797 X:104535695-104535717 TTCAATTTTAACATTGTTTGAGG + Intergenic
1195804337 X:108746425-108746447 TTCAATTCAAAGAAAGATTATGG - Intergenic
1196257738 X:113541824-113541846 TTAAATTTTAAATTGGTTTATGG - Intergenic
1196623338 X:117849474-117849496 TTAAATTTCAAAGTAGAATAGGG - Intergenic
1196862200 X:120039032-120039054 TTCAAATATAAACAAGATTAGGG - Intergenic
1196880902 X:120197312-120197334 TTCAAATATAAACAAGATTAGGG + Intergenic
1197272803 X:124444135-124444157 ATCAATTTTATAATGGATGAAGG + Intronic
1197337666 X:125227663-125227685 TTCAATTTGAAAATAAATATAGG + Intergenic
1197426813 X:126306942-126306964 TATAATTTTAAAATATATTATGG + Intergenic
1197568052 X:128112854-128112876 TTCAGTTTTAACATGGATTTTGG + Intergenic
1198043117 X:132874275-132874297 TTCAATTTTAAAACACCTTCCGG + Intronic
1198188214 X:134276385-134276407 TTCAATTTTTTAATAGATATAGG + Intergenic
1198188250 X:134276973-134276995 TTTAATTTTCAAATATCTTAAGG + Intergenic
1198846769 X:140920745-140920767 TTCATTTAAAAAATGGATTACGG + Intergenic
1198889313 X:141375406-141375428 TTCAATTTTATCAAAGATTATGG - Intergenic
1199341829 X:146688451-146688473 TTAAATTTTAAAATAAAACATGG + Intergenic
1199400448 X:147392902-147392924 TTCAATTTCAAAATGAATTATGG - Intergenic
1199864760 X:151833187-151833209 TTCAATTTTTCAATAGATATAGG - Intergenic
1200543882 Y:4495148-4495170 TACAATTATAAAATGCATTATGG - Intergenic
1200723978 Y:6643009-6643031 TTCATTTTTAAAATTGTTTTAGG + Intergenic
1200758884 Y:7017603-7017625 TTCAATTTAAAAATCCCTTATGG + Intronic
1201184401 Y:11385275-11385297 TTTATTTTTAAAATAAATTTTGG + Intergenic
1201679260 Y:16624134-16624156 TTCATTTTTAAGACAGAATATGG + Intergenic
1201965341 Y:19726969-19726991 TTCAATTTTCAACTACATTGTGG + Intronic
1202274839 Y:23106106-23106128 TTCAATTTTAATGTTGATTTTGG - Intergenic
1202291189 Y:23314583-23314605 TTCAATTTTAATGTTGATTTTGG + Intergenic
1202427831 Y:24739840-24739862 TTCAATTTTAATGTTGATTTTGG - Intergenic
1202442960 Y:24930251-24930273 TTCAATTTTAATGTTGATTTTGG + Intergenic
1202579605 Y:26366027-26366049 TTTAATTTTAAAATACCATATGG + Intergenic