ID: 1086246344

View in Genome Browser
Species Human (GRCh38)
Location 11:84757780-84757802
Sequence CAGTATCACTGGAAGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086246344_1086246350 30 Left 1086246344 11:84757780-84757802 CCATGTTGCTTCCAGTGATACTG 0: 1
1: 1
2: 1
3: 21
4: 194
Right 1086246350 11:84757833-84757855 CAAGTCTATCCCGTGCAGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086246344 Original CRISPR CAGTATCACTGGAAGCAACA TGG (reversed) Intronic
900356839 1:2269031-2269053 GAGGATCACTTGAACCAACAAGG - Intronic
905381766 1:37567109-37567131 CAGTAGCTGTGGAAGCAGCACGG - Intronic
907783015 1:57584527-57584549 CCAGGTCACTGGAAGCAACATGG - Intronic
908551273 1:65211030-65211052 CAGTATGACTGGAAACAACTTGG + Intronic
909042698 1:70672981-70673003 TAGCATCACGGGAAGCCACAGGG + Intergenic
909370158 1:74874154-74874176 CAGTGTCACTGCCAGAAACAGGG - Intergenic
912709662 1:111941350-111941372 CAGTCTCTCTGCAAGCAGCAGGG + Intronic
913986862 1:143573348-143573370 CAGTCTGACTGGACCCAACAGGG - Intergenic
914402741 1:147338623-147338645 CCCTATCACTGGAGGCACCATGG - Intergenic
914953664 1:152142656-152142678 CACTGTCACTTGCAGCAACACGG + Intergenic
915268892 1:154738292-154738314 CAGCAACACTGGAAGCTAGAAGG + Intronic
915612430 1:157005157-157005179 CAGTAACACAGGAAGGAAGAAGG - Intronic
916313278 1:163419938-163419960 CAGTATGACTGTGAGCAAAAAGG + Intergenic
916925992 1:169521350-169521372 CAGTATCAGTGGAGGCCAAATGG + Intronic
918792930 1:188853978-188854000 CATTCTCACTGAAAGGAACAAGG - Intergenic
920401212 1:205677933-205677955 CAGTATCCCTGGCTGCAAAATGG - Intronic
920815808 1:209330718-209330740 CAGTATCACTGGATGCCAACAGG - Intergenic
921277412 1:213533467-213533489 CTGTCTCTCTGGAAGGAACATGG + Intergenic
923049399 1:230380347-230380369 CAGTGTCACTGGCAGCCACAGGG + Intronic
1063967009 10:11354066-11354088 CAGTAGCACTGGAATGACCAGGG + Intergenic
1064520055 10:16191284-16191306 CATTATCACTTGTAGCCACAGGG - Intergenic
1065027546 10:21553279-21553301 CAGTAACACTGAAAGCTAAAAGG - Intronic
1065220817 10:23493996-23494018 CATCATCAGTGAAAGCAACATGG - Intergenic
1066441112 10:35439923-35439945 CACTATCAATGAAAACAACATGG - Intronic
1066704028 10:38157828-38157850 AAGTATTCCTGGAAACAACAAGG - Intergenic
1069058035 10:63865148-63865170 AAGTACCATTGGAAGAAACAGGG - Intergenic
1072204917 10:93195235-93195257 CAGTACCCCTGGAAGCCACTTGG + Intergenic
1073419129 10:103409862-103409884 CAGTATCACAGCTAGCTACAGGG + Intronic
1075712091 10:124536235-124536257 CAGCATCCCTGAAAGCCACAAGG - Intronic
1076284427 10:129279258-129279280 CAGAATCACTGGAACCAAGGAGG - Intergenic
1077258000 11:1597751-1597773 CAGTTGGACTGGCAGCAACAGGG + Exonic
1077810571 11:5632442-5632464 CTGCATCACTGTGAGCAACAAGG + Exonic
1077908907 11:6557700-6557722 TAGTAACACTGGTAACAACAAGG - Exonic
1083753128 11:64773498-64773520 CAGTTGCACTGGAAGAAACCAGG + Exonic
1085266580 11:75241125-75241147 CAGTAGCACTGGAAGGGGCAGGG - Exonic
1085557378 11:77436862-77436884 TAGTATAGCTGGAAGCATCATGG + Intronic
1086004592 11:82023203-82023225 CAGTATCAATTGTAGCATCAAGG - Intergenic
1086246344 11:84757780-84757802 CAGTATCACTGGAAGCAACATGG - Intronic
1086839084 11:91662662-91662684 CTGTATCACTGTAAGAAAAAAGG + Intergenic
1087032779 11:93722520-93722542 AAATATTACTGGAAGTAACAGGG + Intronic
1087242106 11:95790921-95790943 CAGTTTCACTGGGAGCCAGAGGG - Intronic
1087583792 11:100092869-100092891 CAGTGTCATTGCAAGCACCAGGG - Intronic
1088945836 11:114511749-114511771 CAGTACCACTCAAAGCCACAGGG - Intergenic
1089999049 11:122937940-122937962 CAGCAACACTGGATGCAAGAAGG - Intronic
1090172821 11:124619598-124619620 TATTATCACTGGAACCAATATGG - Exonic
1094270690 12:28611197-28611219 CACTTGGACTGGAAGCAACAGGG - Intergenic
1095292127 12:40488711-40488733 CACTATCAGCTGAAGCAACAGGG + Exonic
1095444530 12:42270829-42270851 CAGTATCACAGGAAGCAAGCAGG + Intronic
1095644704 12:44529801-44529823 AAGTGTCACTGGAAGGAAGAAGG + Intronic
1096571880 12:52528117-52528139 CAGTATCACCAAAAGCAACGAGG - Intergenic
1096657740 12:53102189-53102211 CAGGGCCACTGGAAGGAACATGG + Exonic
1097605691 12:61750791-61750813 GATTATCACTGCAAGCAAAATGG - Intronic
1098288744 12:68934446-68934468 CAGAATCACTGGAAGTCTCAGGG - Intronic
1099213584 12:79824769-79824791 CAGTGTCACTCAAAGCAACCAGG + Intronic
1099628026 12:85101392-85101414 GAGTCTCACTGGAAGTAAAAAGG - Intronic
1100300809 12:93305823-93305845 TGGTATCAGTGGAGGCAACATGG + Intergenic
1100645783 12:96529413-96529435 CAGTATCCAATGAAGCAACATGG - Intronic
1101026089 12:100608486-100608508 CAGCATCTCTGGACCCAACAGGG - Intronic
1101310414 12:103573810-103573832 CAGAATCACTGCATGGAACAGGG - Intergenic
1103126355 12:118426052-118426074 CAGGATCACTGGAAGCCATTTGG - Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1107916575 13:45157962-45157984 ATGTATCACTGGCAGAAACATGG - Intronic
1110559996 13:76900833-76900855 CAGTATCACTTCTAGCAAGAAGG - Intergenic
1112378892 13:98869841-98869863 CAGTGGCACAGGAAGGAACAAGG - Intronic
1116306292 14:43261819-43261841 CAGTATCTCTGGAAGAGAAAAGG + Intergenic
1119915627 14:78398625-78398647 CAGTATCAATGGAGGCCACATGG - Intronic
1121666852 14:95679057-95679079 CAGTGTAACTGAAAGGAACAAGG - Intergenic
1125009123 15:34851178-34851200 AACTAGCACTGGAAGCAAAAAGG + Intergenic
1127128709 15:55839574-55839596 CAGCAGCACAGGAAACAACACGG + Intronic
1127835009 15:62783673-62783695 TAATATCACTGGAAGCCAAAGGG - Intronic
1129940468 15:79492156-79492178 CAGAATCAATGGAAGCCAGAAGG - Intergenic
1130645479 15:85722403-85722425 CAGTAGTACTGGAAGCCCCATGG + Intronic
1131571607 15:93543046-93543068 CAGCAGCACTGGAAACAAGAGGG - Intergenic
1132257190 15:100385889-100385911 CAGTGTCAGTGGAAGCAATGTGG + Intergenic
1134346132 16:13393462-13393484 AAATATCACTGAAAGCAAGAAGG - Intergenic
1138709766 16:58957917-58957939 TAGTATCTCAGGAAGTAACAGGG - Intergenic
1139650221 16:68358705-68358727 CAGTCTCAAAGGAAGCCACAAGG - Exonic
1142969286 17:3600696-3600718 CAGTATCACCGGAGTCTACAGGG + Intergenic
1143244530 17:5472203-5472225 CAGTATCACTAGAAGAATCCAGG + Exonic
1145857239 17:28172545-28172567 CACCATCACTGGAAGCAATGAGG + Exonic
1147502197 17:40976317-40976339 CAGTGTCAGTGGAAGCTGCATGG - Intergenic
1147984724 17:44299048-44299070 GAGAATCACTTGAAGCCACAAGG - Intergenic
1148349205 17:46927743-46927765 CAGTAACAATGGAAACAATATGG - Intronic
1150026767 17:61684112-61684134 CAGTATTCCTGGAAGAAGCAGGG - Exonic
1151192989 17:72412290-72412312 TGGGAACACTGGAAGCAACAAGG - Intergenic
1152118127 17:78401294-78401316 CTGCATCACAGGAAGCAACCAGG + Intronic
1154041685 18:10861926-10861948 GAGAATCACTGGAACCAACGAGG + Intronic
1155676020 18:28429860-28429882 CAATATCATAGGAAGCCACATGG - Intergenic
1156266151 18:35490176-35490198 CAGGCCCACTGGAAGGAACATGG + Intronic
1157676292 18:49571176-49571198 CAGTTTGACTGGAAGCCACTCGG + Intronic
1159496561 18:69215037-69215059 CAATGTCACTGGAAGCAAAGAGG + Intergenic
1161275293 19:3412941-3412963 CAGTATCACAGTTAGCCACACGG + Intronic
1161836103 19:6647709-6647731 GAGAATCACTTGAGGCAACATGG + Intergenic
1164665983 19:30037283-30037305 CAGGATGCTTGGAAGCAACATGG - Intergenic
1166613376 19:44220572-44220594 CAGTTTCAAAGGAAGCCACATGG - Intronic
1167226363 19:48244278-48244300 GAGTATCAATGAAAGCAATAAGG + Intronic
1167227644 19:48258704-48258726 GAGTATCAATGAAAGCAATAAGG - Intronic
1168179662 19:54652513-54652535 CTGGATCACTGGAAACAACCAGG - Intronic
931325782 2:61221161-61221183 CAGTAACTCTGGAAGCAAAAAGG + Intronic
933357387 2:81229444-81229466 CAGTATCACTGGAAGAAACAAGG + Intergenic
935420187 2:102859515-102859537 CAACATCACTGGCAGTAACATGG - Intergenic
936462617 2:112723859-112723881 CAGTGGCACTGCAAGCAACAGGG + Intronic
937279194 2:120705766-120705788 CAGTAGGCCTGGAAGCATCAGGG - Intergenic
937523357 2:122737971-122737993 CAGCATCACTGGACGCAAGAAGG + Intergenic
944198347 2:197079186-197079208 CAGTATCAGGGCAAGTAACAGGG + Intronic
944473825 2:200084125-200084147 CAGAATCACTGTAATCAAAATGG + Intergenic
948014315 2:234675469-234675491 GAGAATGACTGGAACCAACATGG - Intergenic
948943745 2:241209215-241209237 AAGGAACACTGGAAGGAACAAGG + Intronic
1168939852 20:1699980-1700002 CAGAAGCACTGGAAGCCAGAAGG + Intergenic
1168962809 20:1880558-1880580 CATTTTGACTGGAAGCACCATGG + Intergenic
1169174975 20:3502979-3503001 CAGTATCACTGGAGTGAAAAAGG - Intronic
1170377593 20:15717800-15717822 AAGAGTGACTGGAAGCAACAAGG + Intronic
1170393012 20:15895580-15895602 CAGAATCACTGAAAGAGACATGG + Intronic
1172280547 20:33704733-33704755 CAGCACCACTGGCAGCACCAGGG + Exonic
1173909796 20:46658107-46658129 CAGTGTCAATGGAAGCCACATGG - Intronic
1174098596 20:48109153-48109175 CAGTTTCAAAGGAAGCCACATGG + Intergenic
1174208374 20:48857681-48857703 CAGGATCACTTGAACCAAGAAGG + Intergenic
1174312441 20:49668533-49668555 CAGTTTCAATGGAACCAGCAAGG - Intronic
1176981442 21:15385876-15385898 CATCATCACTAGAAGCAACCAGG + Intergenic
1178254358 21:31038049-31038071 CAGAATCAGTGGCAGCAGCAAGG - Intergenic
949505650 3:4724957-4724979 CAGTGTCTCTGGGAGAAACAAGG - Intronic
949737303 3:7188199-7188221 GAGAATCACTGGCAGCAAGAGGG + Intronic
950122596 3:10491579-10491601 CAGTAGGGCTGGCAGCAACAAGG + Intronic
950695833 3:14700606-14700628 CAGTGTCAATGGATGCAACAAGG - Intronic
951317338 3:21203640-21203662 CAGTCTCAGTGGAAGCAGCATGG + Intergenic
951666366 3:25128168-25128190 CAGAATCACTGCAAGTAACTGGG + Intergenic
953512349 3:43554937-43554959 CAGTGTCAGTGGAAGCCACATGG - Intronic
953658071 3:44870047-44870069 CAATTCCACTGGAACCAACATGG - Intronic
954352546 3:50056968-50056990 CTGTAACACTGGAAGAAGCAAGG + Intronic
955065042 3:55526724-55526746 CAGCATCACAGGAAGCACGAGGG + Intronic
955569424 3:60288357-60288379 AAGGATCACTGGAAGCCACCTGG + Intronic
956563836 3:70613760-70613782 CAGCAACAATGGAAGCAAGAAGG - Intergenic
958172653 3:89957480-89957502 TAATATAACTGGAAGCAAGAGGG + Intergenic
959513339 3:107238832-107238854 CTTTTTCACTGGAAGCAACAAGG + Intergenic
962596320 3:136948272-136948294 CAGTATCACTAAAAGCACAAGGG + Exonic
963196940 3:142543219-142543241 TAATATCCCTGGAAGTAACAGGG + Intronic
963224302 3:142845997-142846019 CAGAAACACTGGAAGCCAGAAGG - Intronic
963745545 3:149120842-149120864 CAGTATCATGGGAAGCCACTGGG + Intergenic
965660427 3:171036377-171036399 CAGTATCAGTGGAGGCCACGTGG - Intergenic
970326258 4:14928174-14928196 CAGTCTGGCTGGAAGCAGCAGGG + Intergenic
971641698 4:29142285-29142307 CAGGAAGACTGGAAGCAATATGG - Intergenic
974175202 4:58313767-58313789 CTGGATCTCTGGAGGCAACATGG - Intergenic
975876448 4:78843319-78843341 CAGTATCACAGGAAGTAATATGG - Intronic
979004037 4:115265890-115265912 CAGTGTCAGTGGAGGCCACAGGG - Intergenic
979880406 4:125949960-125949982 CAGTATCCAAGTAAGCAACATGG + Intergenic
979945901 4:126830724-126830746 CAGTATCTCTGGACCCACCAAGG + Intergenic
980028442 4:127795060-127795082 CTGCAGCAATGGAAGCAACATGG + Intronic
980830468 4:138125048-138125070 CACTAACACTGGAAGCCAGATGG - Intergenic
982596352 4:157389733-157389755 CAGGATGACTGGAAGCAACAAGG + Intergenic
985503967 5:267822-267844 CCCAATCACTGGAAGCATCAAGG - Intergenic
986405529 5:7421085-7421107 CAGTCCCACCGGAAGGAACAGGG + Intronic
987143199 5:14966312-14966334 CAGTGTCAGTGGAGGCCACATGG - Intergenic
991612708 5:68465552-68465574 GAGTATCACTGCAAGCATCAGGG - Intergenic
992092726 5:73332998-73333020 CAGTATCAGTGGAAACCACATGG - Intergenic
994052794 5:95381478-95381500 CAGCATCAATGGAAGTTACAAGG + Intergenic
995943053 5:117608163-117608185 CAGGATCACGTGAAGCAGCAGGG - Intergenic
996451403 5:123629311-123629333 CAGTAGCAATGGAGGCAGCATGG - Intergenic
1000399546 5:160811734-160811756 CAGTATCTCTGGACCCACCAAGG + Intronic
1000570258 5:162903804-162903826 GAATATCAGTGGAAGCACCATGG + Intergenic
1002326051 5:178407114-178407136 CAGTGTCAGTGGAAGCCCCATGG + Intronic
1002334881 5:178470712-178470734 CAGTATTCCTGGAAGCATCAAGG + Intronic
1002939116 6:1700409-1700431 CAGTACCACTGAAAGCAGGAGGG + Intronic
1003478314 6:6505679-6505701 CAATTTCAGTGGAAGCATCAGGG + Intergenic
1004217438 6:13715867-13715889 CAGGGTCACTGGAAGTTACAAGG - Intergenic
1005025972 6:21463451-21463473 CAGTTTCCCTGGAATCTACAGGG + Intergenic
1005985653 6:30872904-30872926 CAGTGTCAGTGGAGGTAACATGG - Intergenic
1007396564 6:41581350-41581372 CGGTCTGACTGGAAGGAACAGGG - Intronic
1007665793 6:43512308-43512330 CAGGATCCCTGGAAGGAAGATGG + Exonic
1010568391 6:77447211-77447233 TAGTATCAATGGAAGCAAAGGGG - Intergenic
1011246284 6:85324478-85324500 CATTATCACTGAGAGCAAAAGGG + Intergenic
1012490659 6:99779850-99779872 CAGCAGCAGTGGAAGCAGCATGG + Intergenic
1013374573 6:109502042-109502064 GTGTATCACTGGAAGCCACAGGG + Intronic
1014986285 6:128014330-128014352 CAGTGTCACTGAAAGCACAAGGG + Intronic
1015488686 6:133800554-133800576 CAGCTTCACTGAAGGCAACAGGG + Intergenic
1015547991 6:134381706-134381728 AAGTGTCACTAGAAGCAACTTGG - Intergenic
1015856859 6:137634074-137634096 TTGTATCACTTGCAGCAACACGG - Intergenic
1016943196 6:149501404-149501426 TGGTATCACTGGAAGAAACTAGG + Intergenic
1017748228 6:157466189-157466211 CAGCATCACAGCAAGCCACAGGG - Intronic
1018359419 6:163052025-163052047 CAGTATCACTGGAAAATATAAGG + Intronic
1020755379 7:12195059-12195081 CAGTATGACTGGAAAGCACAAGG - Intergenic
1021962415 7:25886022-25886044 CAGTTTCACTTGAATCAACCTGG + Intergenic
1022156418 7:27665489-27665511 CAGTGTCACTGGAAACCACAGGG + Intergenic
1023029448 7:36079709-36079731 CAGAACCACTGGGAGCATCAGGG - Intronic
1023237247 7:38102472-38102494 TATAATCACTGGAAGCAACACGG - Intergenic
1023977528 7:45041862-45041884 AAGAATCAGTGGAAGCCACATGG + Intronic
1024196738 7:47066575-47066597 CAGTACTTCCGGAAGCAACAGGG + Intergenic
1026354749 7:69547724-69547746 GAGTATCACTGGAACCCAGAAGG + Intergenic
1027941510 7:84687056-84687078 TGGTATCATTAGAAGCAACATGG - Intergenic
1030065261 7:105654500-105654522 CTGTAGCACTGGAAGCCAGAAGG + Intronic
1032437399 7:131911312-131911334 CAATCTCTCTGCAAGCAACAAGG + Intergenic
1033798760 7:144876995-144877017 CAGTATCACAGGAAGAAAGATGG - Intergenic
1034215570 7:149403116-149403138 CAGTGCGACTGGAAACAACATGG + Intergenic
1038298387 8:26318217-26318239 CAGTAACACTGGAAGGAGGAAGG - Intronic
1038569310 8:28646604-28646626 CAGTTACACTGGAAGTTACAAGG - Intronic
1040042830 8:42933804-42933826 CAGCAGCACTGGAAGCCACAGGG - Intronic
1042146950 8:65739972-65739994 CAGTTTCAGTGAAAGCAAGATGG - Intronic
1042221695 8:66480648-66480670 CAGGATGTTTGGAAGCAACATGG - Intronic
1042749467 8:72142201-72142223 CTGTTTCACTGTATGCAACATGG - Intergenic
1042804838 8:72759930-72759952 CAGTGTCACTGGCAGAAGCAAGG + Intronic
1043777080 8:84283456-84283478 CAGCATCACAGGAAGAAAGAGGG - Intronic
1044537638 8:93375572-93375594 CAGTATCACTGGGGCCAACTAGG - Intergenic
1045718094 8:105072275-105072297 CAGGATGCATGGAAGCAACAAGG + Intronic
1045860012 8:106805762-106805784 CAGAATCAGTGGCAGCATCAGGG - Intergenic
1046683676 8:117200313-117200335 CAGTGTCTCTAGAAACAACATGG + Intergenic
1047157197 8:122332506-122332528 CAGGACCAGTGTAAGCAACATGG - Intergenic
1049331189 8:142054513-142054535 CAGTATCAGTGGAGACCACAGGG - Intergenic
1050211671 9:3265588-3265610 CAGATTAACTGGAAGCAGCATGG + Intronic
1053730183 9:41046507-41046529 GATACTCACTGGAAGCAACAGGG - Intergenic
1060157802 9:121332217-121332239 CAGGAACACAGGAAGGAACAGGG - Intronic
1061228955 9:129301090-129301112 CAGTATCAGTGGAGACCACAAGG - Intergenic
1189587526 X:42476103-42476125 AAGTAACATTGTAAGCAACAAGG + Intergenic
1194431322 X:93810450-93810472 TAGTATAAATGGAAGGAACATGG - Intergenic
1195264247 X:103164510-103164532 CAGGGTCAGTGGAAGCTACATGG - Intergenic
1195969622 X:110459057-110459079 CAGAATCACTTGAACCCACAAGG - Intergenic
1202168571 Y:22017518-22017540 CAGGATCACTGGAGGCCAAAAGG + Intergenic
1202222790 Y:22568850-22568872 CAGGATCACTGGAGGCCAAAAGG - Intergenic
1202320325 Y:23626810-23626832 CAGGATCACTGGAGGCCAAAAGG + Intergenic
1202550442 Y:26043246-26043268 CAGGATCACTGGAGGCCAAAAGG - Intergenic