ID: 1086248306

View in Genome Browser
Species Human (GRCh38)
Location 11:84782421-84782443
Sequence GTGTGGTAGGGGTAGTTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086248306 Original CRISPR GTGTGGTAGGGGTAGTTAGT GGG (reversed) Intronic
901365089 1:8740115-8740137 GTGTGGTAAGTGTTCTTAGTGGG - Intronic
902406656 1:16187805-16187827 GTGGGGCAGGGGTAGGGAGTAGG - Intergenic
905264785 1:36744135-36744157 GAGTGGTGGGGGTTGTTAGAGGG + Intergenic
908096882 1:60748604-60748626 GTGTGGTAGAGGTAAGTAGGGGG - Intergenic
915846980 1:159276863-159276885 GTGTGGAAGGGGTACTCTGTGGG + Intergenic
915974353 1:160375205-160375227 GTGGGGGAGGGGCAGTTAGGAGG + Intergenic
916449071 1:164902564-164902586 GTGTGGTATGGATAGAGAGTGGG - Intergenic
917508574 1:175650819-175650841 GTGGGGGAGGGGTAGTAAGGAGG - Intronic
917606001 1:176630099-176630121 GTGTCCTAGAGTTAGTTAGTCGG - Intronic
918583248 1:186157582-186157604 TTGGGGTGGGGGGAGTTAGTGGG - Intronic
919146873 1:193646582-193646604 GTGTGGGATGGGTAGTTGGGGGG - Intergenic
923092711 1:230752256-230752278 GTGTGGAAGGGGCAGCTAGGCGG - Intronic
1065022915 10:21515998-21516020 GTGTAGTAGGAGTTGTTTGTAGG + Exonic
1065275980 10:24086033-24086055 GTGTGGTGGGGGTGTGTAGTGGG - Intronic
1069720265 10:70545174-70545196 GGGTGGTGGGGGTAGGTGGTGGG + Intronic
1071203534 10:83248453-83248475 GTGGGGCAAGGGTAGTGAGTAGG - Intergenic
1073530134 10:104223168-104223190 GTCTGGTTGGGCTAGTAAGTGGG - Intronic
1075916412 10:126171383-126171405 CCGTGGCAGGGGTGGTTAGTTGG + Intronic
1076753418 10:132555126-132555148 GTGTGGCTGGCGTGGTTAGTGGG + Intronic
1076859590 10:133134363-133134385 GTGTGGTTGGAGTTGTGAGTAGG - Intergenic
1078741043 11:14066688-14066710 GTGGGGTGGGGGTTGTGAGTAGG - Intronic
1079068550 11:17321220-17321242 GAGTGGTGGGGATAGTTAATGGG - Intronic
1080420098 11:32102143-32102165 GTGTGGTGGGGGGTGGTAGTAGG + Intronic
1082106950 11:48230812-48230834 GTGGGGTAGGGGTAGGGAGGAGG - Intergenic
1086248306 11:84782421-84782443 GTGTGGTAGGGGTAGTTAGTGGG - Intronic
1087964635 11:104397630-104397652 GTGTGGTAGAGGCAGTGAGAGGG + Intergenic
1089933444 11:122338441-122338463 GTGTGGGGGGGGTAGCGAGTGGG - Intergenic
1097669321 12:62517099-62517121 GTGAGGAAGTGGTATTTAGTTGG - Intronic
1108131667 13:47308668-47308690 GTGAGGTGGGGATAGTTAATAGG - Intergenic
1108730206 13:53227420-53227442 TTGTGGTGGGGCTGGTTAGTTGG + Intergenic
1110333566 13:74300481-74300503 GTGTGGTAGGGGTGGGTGGATGG + Intergenic
1110824535 13:79957395-79957417 GTGTGTTAGGGGTGTTGAGTAGG + Intergenic
1112297679 13:98202623-98202645 GTGGGGCAGGAGTAGTTGGTAGG + Intronic
1114056589 14:18973873-18973895 GTTTGGGAGAGGGAGTTAGTGGG + Intronic
1114105960 14:19427854-19427876 GTTTGGGAGAGGGAGTTAGTGGG - Intronic
1114184764 14:20392009-20392031 ATGTGGTAAGTGTAGCTAGTGGG - Intronic
1121453742 14:94025721-94025743 GTGTGGGAGGGAGAGTTTGTAGG - Intergenic
1123498835 15:20860301-20860323 GTTTGGGAGAGGGAGTTAGTGGG - Intronic
1123556070 15:21433929-21433951 GTTTGGGAGAGGGAGTTAGTGGG - Intronic
1123592311 15:21871263-21871285 GTTTGGGAGAGGGAGTTAGTGGG - Intergenic
1123678246 15:22734705-22734727 GGGAGGTAGGGTAAGTTAGTAGG + Intergenic
1124330438 15:28808972-28808994 GGGAGGTAGGGTAAGTTAGTAGG + Intergenic
1125030237 15:35068771-35068793 CTCTGGTAGGGGTGGTTGGTTGG - Intergenic
1126328204 15:47504692-47504714 GTGTGGTGGGTGCAGTTAGAAGG - Intronic
1127379522 15:58419034-58419056 GTGGGGTAGGGGTAGCTTGAGGG + Intronic
1128228010 15:66015920-66015942 GTGGGGTAGTGGGAGTTGGTGGG + Intronic
1128680034 15:69643768-69643790 GTGTTGTAGCAGTATTTAGTTGG + Intergenic
1130089449 15:80807821-80807843 TTGTAGTAGGGGTAGTTTATAGG + Intronic
1131098541 15:89670929-89670951 TTGTGGGAAGGGTAGATAGTTGG + Intronic
1131320651 15:91386925-91386947 GTTTGGGAAGGGTAGATAGTAGG - Intergenic
1202964412 15_KI270727v1_random:161140-161162 GTTTGGGAGAGGGAGTTAGTGGG - Intergenic
1135677204 16:24426082-24426104 GAGGGGTGGGGGTAGTTAATGGG - Intergenic
1135691155 16:24539238-24539260 GTGGGGAAGGGGGAGTTAGCCGG + Intronic
1137826760 16:51504335-51504357 GTGAGGTAGGAGTAATTACTCGG + Intergenic
1138765232 16:59594474-59594496 GTGGGGTAGGGGGAGTAGGTGGG - Intergenic
1139734332 16:68974261-68974283 GTGTGGTGAGGGTAGTTTGAGGG + Intronic
1140983611 16:80136460-80136482 GTGGGGTAGGGGTAGTGGGGAGG - Intergenic
1148031119 17:44621792-44621814 GTGTGGCAGGGCTGGTTAGATGG - Intergenic
1154456879 18:14537075-14537097 GTTTGGGAGAGGGAGTTAGTGGG - Intronic
1155394441 18:25372112-25372134 GTGTGTTAGAGGTAGGGAGTGGG - Intergenic
1155517199 18:26635993-26636015 GTGTGGGAGGGGTTGTTATGGGG + Intronic
1156742921 18:40354796-40354818 GTGTGGTAGGGATGGTTAATGGG - Intergenic
1157351184 18:46887312-46887334 GAGGGGTAGAGCTAGTTAGTGGG - Intronic
1159128049 18:64247736-64247758 GTGTGGTAAGGGAAGGTAGATGG - Intergenic
1162008577 19:7796417-7796439 GTGTAGTAGGTATAGGTAGTAGG + Intergenic
1162326465 19:10002532-10002554 GAGTGGGAGGGGTTGTTTGTGGG - Intronic
1165535532 19:36441306-36441328 GGATAGTAGGGATAGTTAGTGGG - Intergenic
930376832 2:50578338-50578360 GTTTGATAGGGGTACTTAGGAGG + Intronic
931847720 2:66222065-66222087 GTGTGAGAGGGTCAGTTAGTAGG - Intergenic
934656169 2:96117702-96117724 GTGTGGCAGGGAGAGTGAGTTGG - Intergenic
935222332 2:101026461-101026483 GGGTTGTTGGGTTAGTTAGTAGG - Intronic
935561684 2:104566254-104566276 GGGAGGTAGGGATAGTTAGTGGG + Intergenic
936012198 2:108932072-108932094 GTGTGGTATTGGGAATTAGTTGG - Intronic
936971218 2:118178056-118178078 GGGTGCTGTGGGTAGTTAGTGGG - Intergenic
938285712 2:130114195-130114217 GTTTGGGAGAGGGAGTTAGTGGG - Intronic
938336357 2:130502762-130502784 GTTTGGGAGAGGGAGTTAGTGGG - Intronic
938353467 2:130617900-130617922 GTTTGGGAGAGGGAGTTAGTGGG + Intronic
938429890 2:131224705-131224727 GTTTGGGAGAGGGAGTTAGTGGG + Intronic
938474707 2:131597887-131597909 GTTTGGGAGAGGGAGTTAGTGGG + Intergenic
938972067 2:136441893-136441915 GTGTTATAGGGGTACTAAGTAGG - Intergenic
940611024 2:155992202-155992224 GTGTGGTGGGAATAGTTAATGGG - Intergenic
942524146 2:176835211-176835233 GGGAGGTAGGGACAGTTAGTGGG + Intergenic
943866937 2:192937699-192937721 CAGTGGTAGTGGTAGTGAGTTGG - Intergenic
945557987 2:211302670-211302692 GTGAGGTAGGGGCAGGAAGTAGG - Intergenic
947696609 2:232195563-232195585 GTGGGGTAGGGGTGGTGGGTGGG + Intronic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
1171220532 20:23393092-23393114 GTGTGGCTGGGGTATTTATTTGG - Intronic
1172041039 20:32046110-32046132 GTGTTGGAGAGGTAGTAAGTGGG - Intergenic
1176817281 21:13616251-13616273 GTTTGGGAGAGGGAGTTAGTGGG + Intronic
1177767077 21:25471267-25471289 TACTGGTAGGGGAAGTTAGTGGG + Intergenic
1179327773 21:40365869-40365891 CTGTGCTAGGGCTAGTTATTTGG - Intronic
1180475075 22:15696486-15696508 GTTTGGGAGAGGGAGTTAGTGGG + Intronic
951246908 3:20351786-20351808 GGGTGGTGGAGATAGTTAGTGGG - Intergenic
952906272 3:38141016-38141038 GTGTGCCAGGGGTACTTAGATGG + Intronic
954349468 3:50030903-50030925 GTATGGGAAGGGTAGTTAGGGGG + Intronic
954561897 3:51563808-51563830 GTGTGGGAGGATTAGTTATTAGG + Intronic
958733986 3:97988913-97988935 GTAGGGTAGAGGTAGTGAGTGGG + Intronic
959474705 3:106795305-106795327 GTGAGATAAGGGTAGTTAATGGG + Intergenic
961384205 3:126515483-126515505 GAGTGGAAGGGGTAGGTGGTAGG - Intronic
961486598 3:127221518-127221540 GGGTGTTGGGGGTAGTTGGTGGG + Intergenic
962108189 3:132415520-132415542 CTGTAGCAGGGGTAGTTAGAAGG + Intergenic
963201038 3:142586048-142586070 GTGCGGTAGGGATGGTTAATGGG - Intergenic
965079636 3:164020318-164020340 CTGTGGTGGGGGTAGTGAGAAGG + Intergenic
966155385 3:176910703-176910725 GTGGGGTATGGGTAGAAAGTAGG - Intergenic
966984714 3:185168673-185168695 GTGAAGTAGGGGTAGTTACCAGG - Intergenic
968865571 4:3209119-3209141 GTGTGGGGTGAGTAGTTAGTGGG + Intronic
969375513 4:6760967-6760989 GTCTGGGAGGGGTAGGAAGTGGG - Intergenic
979508922 4:121529398-121529420 GTGTGTCAGGGGTAGTGGGTAGG - Intergenic
983717112 4:170796361-170796383 GTATGTTAGGGGTCATTAGTAGG - Intergenic
984100207 4:175475494-175475516 GTGGGGTAGGGGGAGTGGGTAGG - Intergenic
987269840 5:16295473-16295495 GTATGGTAGGGGTAGAGAGAAGG + Intergenic
988082156 5:26428274-26428296 GTGTGGTGGGGGTAGTGGGGAGG - Intergenic
989517673 5:42362399-42362421 TTGTGGTAGGAATAGATAGTTGG - Intergenic
993582861 5:89684548-89684570 GTGAGGTGGGGATAGTTAATGGG + Intergenic
994974515 5:106784629-106784651 GTCTGGGAAGGGTAGTTGGTTGG + Intergenic
998264389 5:140656882-140656904 GGGAGGTAGGGGTGGTTAATAGG - Intronic
998628579 5:143873672-143873694 GGGTGGTTGGGGAAGGTAGTTGG - Intergenic
999480638 5:151944972-151944994 ATGTGGTAGGATTAGTTGGTTGG - Intergenic
999638429 5:153646703-153646725 GTGTGAGTGGGGTAGTTAGATGG + Intronic
1000383034 5:160646044-160646066 TTGTGGTCTGGGAAGTTAGTAGG + Intronic
1002939334 6:1702479-1702501 ATGTGGGAGGAGTAGTTAGGAGG + Intronic
1003369738 6:5512799-5512821 GTGTGCTAGGTGTCATTAGTAGG + Intronic
1004022653 6:11788978-11789000 CTGTGGTGGGGGTAGTGAGAAGG - Intronic
1006485533 6:34337986-34338008 GTGTGGTAGGGCCAGTTGGTGGG - Intronic
1009738289 6:67707911-67707933 GAGAGGTAGGGATAGTTAATGGG - Intergenic
1010754909 6:79655944-79655966 GAGTGGGAGGGGAAGGTAGTTGG + Intronic
1011224421 6:85091232-85091254 GTATGCTACTGGTAGTTAGTGGG + Intergenic
1012602190 6:101112335-101112357 CTGGAGTAGGGGTAGTTATTGGG + Intergenic
1014101294 6:117514707-117514729 GTGTGGTAAGGGTAATTAAAGGG + Intronic
1018556659 6:165057804-165057826 GTGGGGAAGGGGTAGTTAAGGGG + Intergenic
1021887599 7:25155151-25155173 GTGTGGTAGGGGTGTTCAATTGG + Exonic
1022204943 7:28154521-28154543 ATGTGGTTTGGTTAGTTAGTTGG - Intronic
1022346574 7:29521338-29521360 GAGAGGTAGGGATAGTTAATGGG + Intergenic
1028188923 7:87822887-87822909 GTGGGGTAGGGGTAGTGGGGAGG + Intronic
1028202099 7:87973937-87973959 GTGGGGTAGGGGTAGGGGGTGGG + Intronic
1028553605 7:92099173-92099195 GTGTGGGAGAGGTATTTAGAAGG - Intronic
1029801192 7:102949206-102949228 CTGGGGTAGGGGTTGGTAGTGGG + Intronic
1030500296 7:110351407-110351429 GTGGGGTAGGGGTAGGGGGTAGG + Intergenic
1038892912 8:31747036-31747058 GGGAGGTAGGGGTGGTTAATAGG + Intronic
1039382975 8:37103004-37103026 CTGTGGTGGGGGGAGTGAGTTGG - Intergenic
1039418914 8:37419646-37419668 GCGTGGTGGGGGTGGTTAGTGGG - Intergenic
1040082212 8:43298124-43298146 GTTTGGGAGAGGGAGTTAGTGGG + Intergenic
1040403913 8:47080999-47081021 GTGGGGTAGGGGTAGGGGGTAGG + Intergenic
1040579747 8:48688176-48688198 GTGTAGTGGGGGTAGTAGGTGGG + Intergenic
1047573942 8:126132510-126132532 AGGTGGTAGGGTTTGTTAGTAGG + Intergenic
1048486545 8:134853061-134853083 GTGTGGTTGGAGCAGTGAGTGGG - Intergenic
1049831766 8:144705311-144705333 CTGTGGAAGGGGCAGCTAGTGGG - Intergenic
1059296585 9:113276094-113276116 GTGAGGTAGTAGGAGTTAGTAGG - Intronic
1203530082 Un_GL000213v1:133246-133268 GTTTGGGAGAGGGAGTTAGTGGG - Intergenic
1189821959 X:44877959-44877981 GTTTGGTAGGGGAAATTATTAGG + Intronic
1190566501 X:51735376-51735398 GAGGGGTGGGGGAAGTTAGTGGG - Intergenic
1192185058 X:68941088-68941110 GTGTAGCAGGGGTGGTGAGTGGG + Intergenic
1192472297 X:71409742-71409764 GTGTGGCAGGGGTCGATAGTGGG - Intronic
1195585100 X:106556003-106556025 GGGAGGTAGGGGTGGTTAATGGG + Intergenic
1196116880 X:112007922-112007944 GGGTGGTAGGGGGAGTTAAGGGG + Intronic
1196467615 X:115989341-115989363 GGGTGGTATGGGTACTGAGTAGG - Intergenic
1196598768 X:117576798-117576820 GGGTGGTAGGGGTGGTTAATGGG - Intergenic
1196871440 X:120116303-120116325 GTGTGGTATGGGTCGTGGGTGGG + Intergenic
1199434378 X:147796649-147796671 GTCTGGTAGCTGTTGTTAGTCGG + Intergenic
1201606016 Y:15786329-15786351 GTGGGGTGGGGGTAGGGAGTAGG - Intergenic
1202038757 Y:20661436-20661458 GTGGGGCAGGGCTAGTTAATAGG - Intergenic