ID: 1086251034

View in Genome Browser
Species Human (GRCh38)
Location 11:84814559-84814581
Sequence CAGAGTATGAAGGCTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086251034 Original CRISPR CAGAGTATGAAGGCTGTGGA GGG (reversed) Intronic
900871332 1:5305794-5305816 CAGAATAAAAAGGCTGAGGAAGG - Intergenic
903065994 1:20699836-20699858 CAGATTGTGACAGCTGTGGAGGG + Intronic
904210084 1:28881330-28881352 GAGAGAATAAAGGCTGTGAAAGG + Intergenic
904213292 1:28899756-28899778 CAGAAAATGAAGGCTCAGGAAGG - Intronic
904286490 1:29456008-29456030 CAGTGCATGAGGGCTGTGGGAGG + Intergenic
904825012 1:33268673-33268695 GAGAGGATGCAGCCTGTGGAAGG + Intronic
905027757 1:34862891-34862913 CAGGTTATGGTGGCTGTGGAGGG - Intergenic
905699510 1:40000644-40000666 AAGAGTATGAATGCTGAGGCCGG + Intergenic
905856526 1:41318275-41318297 CAGATAATGATGGCTGTAGAGGG - Intergenic
906199664 1:43951361-43951383 CTGAGTCTGAGGGCTGTGAAAGG + Intronic
906445578 1:45894723-45894745 CAGAGTATGAAGACTAATGAAGG - Intronic
907220969 1:52906662-52906684 CAGAGACTCAAGGCTGGGGAGGG + Intronic
909535135 1:76727733-76727755 ATGAGTGTGGAGGCTGTGGAGGG - Intergenic
912731438 1:112109949-112109971 CAGTCTATGAAGGCTGTGAGAGG - Intergenic
913499000 1:119453390-119453412 CAGACTATGAATGGTGAGGAAGG + Intergenic
913971417 1:143420824-143420846 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
914065794 1:144246437-144246459 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
914113357 1:144719917-144719939 CAGAGTATTGAGGAGGTGGAGGG - Intergenic
914783157 1:150804102-150804124 CTGAGAATGATGGCTGTGGAGGG - Exonic
915646354 1:157275461-157275483 TAGATTATGAGGACTGTGGACGG + Intergenic
915930894 1:160060380-160060402 CAGAGTATAAGGGCTGGGGGAGG + Intronic
916060055 1:161092115-161092137 CCTAGGATGAAGGCTGGGGAAGG + Intergenic
916696134 1:167238502-167238524 CACAGTAGGAAGACTGTTGAGGG - Intronic
921308147 1:213817313-213817335 CAGAGAAGGAAGGCGGGGGAAGG + Intergenic
921919855 1:220655640-220655662 CAGAGTATGAAGGCAGTGGCGGG - Intronic
922061674 1:222098534-222098556 CAGAAAAACAAGGCTGTGGATGG + Intergenic
922790072 1:228306401-228306423 CAGAGTCTGCAGGCGGAGGAGGG + Exonic
923366472 1:233266589-233266611 CAGAGAAAGAAGGCTTAGGAAGG + Intronic
924606506 1:245540051-245540073 CAGAGTGTGAAGGCAGGGAAAGG - Intronic
1065916578 10:30358455-30358477 CAGTGTGTGTAGGGTGTGGAGGG + Intronic
1067961853 10:50862833-50862855 AAGAGCAGGGAGGCTGTGGATGG + Intronic
1067967872 10:50934251-50934273 AAGTGAATGAATGCTGTGGATGG + Intergenic
1069940704 10:71953360-71953382 TAGATTATGAGGACTGTGGATGG + Intergenic
1070328936 10:75404619-75404641 CTGAGTCTGGAGGCTGGGGAGGG - Intergenic
1070840505 10:79484127-79484149 CAGAATATGAAGGCTGGGGGTGG + Intergenic
1072105084 10:92266061-92266083 CAGAGTCCCAAGGCTGTGTAGGG - Intronic
1072234209 10:93439070-93439092 CATAGCCTGAAGGCTGTGGCAGG + Intronic
1072245022 10:93535624-93535646 CAGAGTTTGAACGCTGTGCTGGG - Intergenic
1075341149 10:121647776-121647798 CAGAGGATTTAGGATGTGGAGGG + Intergenic
1076162431 10:128255826-128255848 CAAATTATGAAGGTGGTGGAGGG + Intergenic
1076693263 10:132234561-132234583 CACAGGATGCAGGGTGTGGAGGG - Intronic
1076988627 11:257399-257421 AAGAGGTTGAAGGCTGTGGACGG - Intergenic
1080662788 11:34311057-34311079 CAGAAACTGAAGGCAGTGGAAGG - Intronic
1081504384 11:43700091-43700113 CACTGGATGAAGGCTGTTGATGG + Intronic
1081557113 11:44174941-44174963 CAGAGGATGAAGCCTGGAGAGGG + Intronic
1084211944 11:67628441-67628463 CTGGGTTTGAAGGCTGGGGAGGG + Intronic
1086218092 11:84407368-84407390 CACAGTAGGAAGGCCGTGAAAGG - Intronic
1086251034 11:84814559-84814581 CAGAGTATGAAGGCTGTGGAGGG - Intronic
1087326313 11:96727637-96727659 CAGAGTTTGAACGCTGTGCTTGG + Intergenic
1087660868 11:100986486-100986508 CAGAGTAGGAAGCCAGTTGAAGG + Intronic
1091134697 11:133178332-133178354 CAGAGTAGGGAGCCTGTGGCTGG - Intronic
1092054641 12:5498914-5498936 CAGAGTTTGAAGCCTGGGCAGGG - Intronic
1093127489 12:15348307-15348329 CAAGGTATGCAGGCAGTGGAAGG + Intronic
1095467569 12:42504062-42504084 CAGAATATCAACTCTGTGGATGG + Intronic
1096400165 12:51299420-51299442 CAGAGTCTTGAGGCTGGGGAGGG - Intronic
1098447242 12:70578950-70578972 CAGAGAATGGAGGTTGGGGAGGG - Intronic
1098738715 12:74142593-74142615 AAGAGTGTGAAGGATGTGGAAGG - Intergenic
1098976763 12:76910550-76910572 CAGAGAGTGAAGGCATTGGAAGG - Intergenic
1103349729 12:120275763-120275785 GAGAGTCTGAGGGCTGAGGAGGG + Intergenic
1104732086 12:131112883-131112905 CATAGTATGCAGGGTGTGGCAGG - Intronic
1104975957 12:132552086-132552108 CAGAACATGGAGGCTGTGGATGG - Intronic
1105340017 13:19513884-19513906 AAGAGCATGAAGGTGGTGGAGGG - Intronic
1105352069 13:19624953-19624975 CAGAGTCTCAAGGCAGTGCAAGG + Intergenic
1105620752 13:22063726-22063748 CCGCGTGTGGAGGCTGTGGAAGG + Intergenic
1105955884 13:25282283-25282305 AAGAGTATGAGGGTTGAGGAGGG - Intronic
1106288858 13:28342293-28342315 CAGACTTTGAAGGCTGTAGCTGG - Intronic
1109345835 13:61113666-61113688 CACAGGAGGAAGGCTGAGGAGGG + Intergenic
1109490551 13:63093223-63093245 CAGATTATAAAGTCTGTGAAAGG - Intergenic
1110688280 13:78401173-78401195 CACAGTGTGACAGCTGTGGACGG + Intergenic
1110700610 13:78543382-78543404 CAGAGTATTATGGTGGTGGAAGG - Intergenic
1112295266 13:98180588-98180610 CTGAAACTGAAGGCTGTGGAGGG - Intronic
1112314368 13:98348403-98348425 TAGAGTCTGAAGGCTGGGAAAGG + Intronic
1113499277 13:110760477-110760499 GATTGTATGAAGGCTGTGGTGGG + Intergenic
1115742924 14:36406946-36406968 CAGAGGTTGCAGGCAGTGGAAGG + Intergenic
1115783587 14:36799163-36799185 CAGAGCATGATGGCTTTTGATGG - Intronic
1116743921 14:48793095-48793117 CAGAGTTTGAATGCTGTGCTGGG - Intergenic
1119914492 14:78384643-78384665 CAGAATAGGAAGGCTGAGCAGGG - Intronic
1120597067 14:86453513-86453535 CAGCAAATGAAGGCGGTGGATGG + Intergenic
1122527452 14:102397785-102397807 CAGCGTATGAAGGCTGGGTGTGG + Intronic
1122711075 14:103658563-103658585 CAGAGAAAGAAGGCTGGGCATGG - Intronic
1122757933 14:103997439-103997461 GAGATGGTGAAGGCTGTGGAAGG + Intronic
1122939940 14:104976787-104976809 CAGAGCAGAAAGGCTGTGCAGGG + Intronic
1123206258 14:106716135-106716157 GAGAATATGAAGGATATGGATGG - Intergenic
1123211340 14:106763544-106763566 GAGAATATGAAGGATATGGATGG - Intergenic
1125059903 15:35406931-35406953 CACAGGAGGAAGGCTATGGAGGG + Intronic
1126237650 15:46404760-46404782 CAGAGTGTGCAGGCTCTGAATGG - Intergenic
1127366360 15:58294260-58294282 CAGAGTCTTAGGGCAGTGGAAGG + Intronic
1127873383 15:63091396-63091418 GGGAGTAGGAAGGCTGGGGACGG - Intergenic
1128317117 15:66667929-66667951 TAGAGAATTAAGGTTGTGGATGG + Intronic
1129226874 15:74175280-74175302 CAGAGCACGGAGGCTGCGGAAGG - Exonic
1129325464 15:74798202-74798224 AAGAGCATGAAGACTGAGGAGGG - Intronic
1129337845 15:74864401-74864423 AAGGTTATGGAGGCTGTGGAGGG + Intronic
1129366666 15:75059981-75060003 AAGAGAGAGAAGGCTGTGGAAGG + Intronic
1130283758 15:82539256-82539278 AAGAAAATGAAGGCTGTGAAGGG - Intronic
1130421148 15:83748355-83748377 CAGAGTAGGCAGGCTGGGCATGG + Intronic
1131084713 15:89566631-89566653 CACACTAGGAAGGCTGAGGAAGG - Intergenic
1131501551 15:92972471-92972493 CAGTGTAGGAAGGTTGGGGAGGG - Intronic
1131671113 15:94620344-94620366 AAGATGAAGAAGGCTGTGGAGGG - Intergenic
1132372104 15:101306398-101306420 CAGAGCATGGAGCTTGTGGAGGG - Intronic
1132543209 16:521066-521088 CAGAGGATGAGGGTTGTGGCAGG + Exonic
1132852148 16:2029588-2029610 CAAAGGATCAAGGCTGTGGAGGG + Exonic
1134202888 16:12213598-12213620 GAGAGTGTCCAGGCTGTGGAAGG + Intronic
1134486802 16:14665173-14665195 CAGAGTCTGAAGGGTCTGGGTGG - Intronic
1135846925 16:25927369-25927391 CAGTGTCTGAAGGCCATGGAAGG - Intronic
1140124701 16:72109424-72109446 CAGTGTGTGACCGCTGTGGACGG + Exonic
1140253486 16:73315496-73315518 CAGAGGAGGATGGCTTTGGATGG - Intergenic
1141524782 16:84604267-84604289 CAGGGGGTGAGGGCTGTGGAGGG - Intronic
1142752563 17:1997813-1997835 CCGAGTAGGAGGGCTGTGAAGGG - Intronic
1143956545 17:10674549-10674571 CTGAGTAGCAAGGCTGTAGAGGG + Exonic
1144003572 17:11078232-11078254 CAGTGTATGGAGGGAGTGGATGG + Intergenic
1144844251 17:18207919-18207941 CAGAGTCTTGAGGCTGTGGTAGG + Intronic
1148439029 17:47702338-47702360 CAGGATATGAAGGCTGAAGAGGG + Intronic
1148689703 17:49520185-49520207 CAGGGCAGGAAGACTGTGGAGGG - Intergenic
1149363060 17:55914072-55914094 CAGTGCAGGAAGGCTGTGGGTGG + Intergenic
1149620514 17:58041303-58041325 CAGATTATGAGGGATGTGGATGG - Intergenic
1149665416 17:58361732-58361754 AACAGCATGAAGGCTGTGGCTGG - Intronic
1150587474 17:66531875-66531897 CAGACTATGAGGTCTGGGGAAGG - Intronic
1151881941 17:76901139-76901161 GAGAGTGTGATGGCTGTAGAGGG + Intronic
1152255319 17:79235620-79235642 AAGAGTTTGGGGGCTGTGGAGGG - Intronic
1152340810 17:79723385-79723407 CAGGGTATGAAGGGGGTGGAGGG + Intergenic
1153750282 18:8222510-8222532 CAGAGTATGGGGGCTGGGGACGG + Intronic
1155069055 18:22297188-22297210 CTGAGTAAGTAGGCTGTGGTCGG - Intergenic
1155306669 18:24485191-24485213 CATAGTGCAAAGGCTGTGGAAGG - Intergenic
1156241789 18:35261946-35261968 CAGGGTATGATGCCTGGGGAAGG + Intronic
1156597815 18:38567472-38567494 TAGAGTATGTAGTCTGTTGATGG - Intergenic
1158082940 18:53615728-53615750 CAGGGTAAGCAGGCTGTGGTTGG - Intergenic
1158588194 18:58758783-58758805 GAGAGCATGGAGGCTGGGGACGG - Intergenic
1159449603 18:68583534-68583556 CAGGGTATGAAGGCTTTTGGTGG - Intergenic
1160097423 18:75887854-75887876 CAGAGCAGGAAGCCAGTGGAAGG - Intergenic
1160346501 18:78136680-78136702 TAGAGCAAGAAGGCAGTGGAAGG + Intergenic
1161785667 19:6324005-6324027 CAGAGTCGGAAGGGGGTGGAGGG - Intronic
1163197424 19:15732838-15732860 CAGAGTCAGAGAGCTGTGGATGG + Intergenic
1165289932 19:34874821-34874843 CAGAGTCTGCAGGCCCTGGAAGG + Intergenic
1166882199 19:45936403-45936425 CAGGGTGGGAGGGCTGTGGAAGG + Exonic
1166896781 19:46028075-46028097 CAGAATTTGAGGGCTGAGGAAGG - Intergenic
1167637004 19:50661119-50661141 CAGAGAATGAATGATGTGCATGG + Intronic
1168433594 19:56301021-56301043 CAGAGCCTGAAGCCTGGGGATGG + Intronic
1168598311 19:57696641-57696663 CAGAGCATGAAGGCAGAGGGAGG + Intronic
924994179 2:341649-341671 CAGAGGAAGAAAGCTGTGGTTGG + Intergenic
925296583 2:2781149-2781171 CAGAGTGTGAAGGTGGGGGAGGG - Intergenic
928307270 2:30180486-30180508 CAGAGTATGGTGGCTGTCCAAGG + Intergenic
928632645 2:33209558-33209580 CAGTGAATTAATGCTGTGGAGGG - Intronic
929377576 2:41308153-41308175 TAGTGTTTTAAGGCTGTGGATGG - Intergenic
929917506 2:46148382-46148404 CAAAATGAGAAGGCTGTGGAAGG + Intronic
929936158 2:46296295-46296317 TAGTTTTTGAAGGCTGTGGAAGG - Intronic
930140348 2:47945163-47945185 CAGAGTAGGAAGGGTGTGGAAGG - Intergenic
930245969 2:48983773-48983795 CAGAGAATGTGGGCTGTGGCAGG + Intronic
931070483 2:58642677-58642699 CTGAGGATGAAGCCTTTGGAGGG + Intergenic
932205095 2:69873289-69873311 CAGGGCATGAGGGCTGTGGATGG + Intronic
934176108 2:89581757-89581779 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
934286418 2:91656119-91656141 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
934537562 2:95148268-95148290 CAGAGGATGGAGGCTGAGAAAGG - Exonic
934793009 2:97078907-97078929 CAGAGGATGGAGGGTGAGGAGGG - Intergenic
934813178 2:97301578-97301600 CAGAGGATGGAGGGTGAGGAGGG + Intergenic
934824517 2:97406902-97406924 CAGAGGATGGAGGGTGAGGAGGG - Intergenic
935170313 2:100606491-100606513 CAGAGAAAGGAGGCTGGGGAGGG - Intergenic
935854751 2:107261795-107261817 CAGAGTTTGATGGCTCTAGAAGG + Intergenic
936401581 2:112168642-112168664 GACAGTATTAAGGGTGTGGACGG + Intronic
937868598 2:126771798-126771820 CAGAGTAGGGACGCTGAGGAAGG + Intergenic
937958627 2:127438074-127438096 GAGACCATGGAGGCTGTGGAAGG + Intronic
937995452 2:127690845-127690867 TAGAGTCTCAAGGCTGTGCAGGG + Intergenic
938080615 2:128368080-128368102 GAGAGAATGAAGGCTGTCTAGGG + Intergenic
938741063 2:134232596-134232618 CAGAGCATGAAATCTGGGGAAGG - Intronic
938881154 2:135590778-135590800 TAGAGTATGAAGGCAGATGATGG + Intronic
938950178 2:136248071-136248093 TAAAGTATGAAGGCTGGCGATGG + Intergenic
941845106 2:170124541-170124563 GAGAGTGTGAAGGCTTAGGATGG - Intergenic
943893212 2:193318601-193318623 CAGAGGATGGTGGCTGGGGAAGG - Intergenic
944831973 2:203542020-203542042 AAGAAAATGAAGGCTGTGGCTGG + Intergenic
944832017 2:203542335-203542357 CAGAAAATGAAGGCTGAGCATGG + Intergenic
945146781 2:206746812-206746834 CAGAGTATGAAGAATTGGGAAGG + Intronic
945239487 2:207662948-207662970 CAAAGTTTGAATTCTGTGGAAGG - Intergenic
945533966 2:210989014-210989036 CAGAGTTGGAAGAGTGTGGAGGG + Intergenic
946466892 2:219919941-219919963 TAGGGTAGGAAGGCTGTGTAAGG + Intergenic
947111653 2:226725137-226725159 CAGAGAAAAAAGGCTGTGGTTGG - Intergenic
1169804368 20:9544206-9544228 CAGAGTAGATAGGCTGTGGCAGG - Intronic
1169814905 20:9646307-9646329 CAGGGAGTGAAGGCTGTGAATGG - Intronic
1170202026 20:13754613-13754635 CAGATAATGAAGCTTGTGGATGG - Intronic
1170229335 20:14027926-14027948 CAGAGTGTGAGGGCTGTGCTGGG + Intronic
1172519084 20:35555848-35555870 AGGAGTTTGCAGGCTGTGGAAGG + Intronic
1173291315 20:41717501-41717523 CAGAGCCTGTAGGCTGGGGAAGG + Intergenic
1173474827 20:43351661-43351683 AAGAGGCTGAAGGATGTGGAAGG + Intergenic
1174445716 20:50589775-50589797 GAGAGTAAGGAGGCTGTGAATGG + Intronic
1175924323 20:62464634-62464656 CAGAGCAAGAAGGCTGGTGAGGG - Exonic
1176734190 21:10527879-10527901 AAGAGCATGAAGGTGGTGGAGGG + Intronic
1178260906 21:31098854-31098876 CCGAGTAGGAAGGATGCGGAAGG - Intergenic
1178369654 21:32017009-32017031 ATGAGTGAGAAGGCTGTGGATGG - Intronic
1178737042 21:35161740-35161762 CAGAGTATGAGGGCCCTGTAGGG - Intronic
1179901453 21:44396507-44396529 AAGGGTGTGGAGGCTGTGGAGGG + Intronic
1182863663 22:33583288-33583310 CACAGGATGAAGGCAGTGCATGG + Intronic
1183186658 22:36295318-36295340 CAGAGTAGAAAGTCTGTTGAAGG - Intronic
1184372130 22:44089378-44089400 CAGTGTCTGGAGGGTGTGGAGGG - Intronic
1184423997 22:44398428-44398450 CAGCTTATGGAGGCTGTGAAGGG + Intergenic
1184704508 22:46201422-46201444 CAGAGGATAAGCGCTGTGGAAGG + Intronic
1184740493 22:46426115-46426137 CAGAGCAGCAAGGCTGGGGAGGG + Intronic
1185249904 22:49795745-49795767 CAGAGCGTGATGGCTGTGGGAGG + Intronic
949247220 3:1939483-1939505 CAGGGTATGATGGCTGGGGCTGG - Intergenic
950591660 3:13940268-13940290 CAGACTATAAAGGCTTTAGACGG - Intronic
953421091 3:42753872-42753894 CAAAGGAAGGAGGCTGTGGAAGG + Intronic
953801994 3:46031494-46031516 CACAGGAGGAAGGCTGAGGAGGG + Intergenic
954954731 3:54508978-54509000 CAGAGTATGCAGGCTGCTGGAGG + Intronic
954972412 3:54662464-54662486 CTGACTTTGAAGGCTGTGAAGGG + Intronic
957437205 3:80193860-80193882 CAGAGCATGAAGGCTGAGAGGGG + Intergenic
958584517 3:96069239-96069261 CACAGAAGGAAGGCTGAGGATGG - Intergenic
958683499 3:97361595-97361617 CAGAGTATCAAGGTAGTGCAGGG + Intronic
959534666 3:107470989-107471011 CAGAGCTTGAAGGCTGTGCTAGG - Intergenic
959707965 3:109356928-109356950 GAAAGTTTGAAGGCTGTGAAGGG - Intergenic
962932749 3:140052848-140052870 CAGAGAAGGAAGGCTCAGGAAGG - Intronic
963521143 3:146361200-146361222 CAGTGTTTCAAGGCTGTGCAGGG - Intergenic
965932990 3:174070102-174070124 CATAGGATGATGGCTTTGGAAGG + Intronic
966050109 3:175605584-175605606 GAGTGAATGAAGGCTGGGGAAGG - Intronic
966493782 3:180556918-180556940 CAGAGTTTGAATGCTGTGCTGGG - Intergenic
966875573 3:184319918-184319940 CAGAGAATGGTGTCTGTGGAGGG + Intronic
966889468 3:184396274-184396296 ACGAGTAACAAGGCTGTGGACGG + Intronic
966947909 3:184790271-184790293 GAGAAAAAGAAGGCTGTGGAAGG + Intergenic
967320542 3:188190646-188190668 CAGAGTATGACAGCAGTAGAAGG + Intronic
969651214 4:8469378-8469400 CAGAGGAAGAAGGCTGAGGCTGG + Intronic
969755716 4:9149021-9149043 AAGAGAATGAAGGCCGTGCATGG - Intergenic
969989938 4:11252099-11252121 CAGAGTAAAAGGGCTGAGGAGGG - Intergenic
970606291 4:17685248-17685270 TAGATTAAGAAGGCTGAGGAGGG + Intronic
972912886 4:43840403-43840425 CAGAGCAAGAAGGCTCTGAAGGG - Intergenic
976338527 4:83919007-83919029 AAGAGTATGAGGCATGTGGAAGG + Intergenic
976860924 4:89665345-89665367 CAAAGTATGAAGTCTGTAGCTGG + Intergenic
977435688 4:96991329-96991351 CAATGTTTGAAGGCTGTGGCAGG + Intergenic
977593784 4:98855389-98855411 CAGAGAATGAAGGCAGTGGCTGG + Intergenic
982185608 4:152795046-152795068 CAGAGTAGCAAGGCTAAGGATGG - Intronic
984745233 4:183209068-183209090 TAGAGTCTGAAGGCTGTGGAAGG + Intronic
985017964 4:185657249-185657271 CAGAGAAAGAAAGCTGTTGATGG - Intronic
985956216 5:3268139-3268161 CAGATCATGAAGGCAGAGGAAGG - Intergenic
989393310 5:40924835-40924857 CAGTGTCTTAAGGCTGTGCAGGG + Intronic
989791418 5:45407034-45407056 CAGAGTATGAAAGGTGCAGATGG + Intronic
990706201 5:58532343-58532365 CAGAGTCCCAAGGCTGTGTAGGG - Intergenic
991411578 5:66351442-66351464 CAGAGTTAGAAGGCTCTAGAAGG + Intergenic
992406041 5:76458895-76458917 CAGAGCATGCAGCCTGTGCAGGG + Intronic
994148088 5:96417017-96417039 AAGAGTGTGAAGGCTGTTGGTGG + Intronic
995046390 5:107653412-107653434 AAGAGAAGAAAGGCTGTGGAGGG - Intronic
995743904 5:115383687-115383709 CAGAGTAAGCAGTCTGTGGATGG + Intergenic
995957331 5:117793821-117793843 CAGAGTATGAAGGGTGAGGGAGG - Intergenic
996230517 5:121058283-121058305 CAGAGAATCCAGACTGTGGAGGG - Intergenic
997327812 5:133036534-133036556 CAGAGAAAGAAGGCTGAGGCAGG + Intergenic
998849339 5:146338804-146338826 CCGGGTATAAAGGCTGTGGAGGG + Intronic
999621450 5:153478973-153478995 CAGGGCATGAGGGCAGTGGAGGG - Intergenic
1002103023 5:176866642-176866664 GAGAGGATGAAGGGAGTGGAGGG + Intronic
1003325929 6:5090732-5090754 CTGAGCAGGAAGGCTGTGGGCGG - Intergenic
1003406415 6:5830184-5830206 TAGACTCTGAAGGCTGTTGATGG - Intergenic
1005463011 6:26086953-26086975 TCAATTATGAAGGCTGTGGAAGG + Intergenic
1007961034 6:45959765-45959787 CAAAGTCTGATGGTTGTGGAAGG - Intronic
1007975662 6:46098796-46098818 AAGAGTCTGAGGGCAGTGGAGGG + Intergenic
1008053846 6:46926595-46926617 TGGAATGTGAAGGCTGTGGACGG - Intronic
1010470573 6:76222683-76222705 CAGAGTATGGCTGCTGTGAAAGG + Intergenic
1010678411 6:78770568-78770590 CAGAGTCTGGAGTCTTTGGAGGG - Intergenic
1011106625 6:83788888-83788910 CAGAGAATGAAGGGTGGGGAAGG - Intergenic
1011933645 6:92745914-92745936 CAGAGTATGAAGGACATGCATGG - Intergenic
1011990408 6:93508609-93508631 CAGAATATGGAGGGTGTGGGAGG - Intergenic
1012143921 6:95657712-95657734 CAGAGTGAGAATGCTGTGAAAGG + Intergenic
1013289275 6:108706831-108706853 CACAGTGTGATGGATGTGGATGG - Intergenic
1014182326 6:118398744-118398766 CAGGGGATGAAGGGTGTGCAGGG - Intergenic
1014565821 6:122946567-122946589 CAGAGGATGAAAGGGGTGGATGG + Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1017397067 6:154013805-154013827 CAGGTTATCAAGGCTTTGGAAGG + Intronic
1020391353 7:7661820-7661842 CAGAGTTTGAATGCTGTGCTGGG + Intronic
1020636735 7:10705001-10705023 CAGAGTATGTAGGGAGAGGAAGG - Intergenic
1020809787 7:12837592-12837614 CAGATTAAAAAGGCTGTGTATGG + Intergenic
1024456810 7:49617870-49617892 CAGAGAAAGAAGGCTGTTAATGG + Intergenic
1024467315 7:49725298-49725320 CAGAGTACTAAGGTAGTGGAGGG - Intergenic
1028284998 7:88985472-88985494 CAGAGTGTAAAGGGTGTGAAGGG + Intronic
1029746947 7:102521290-102521312 CAGAGTCTGATGGGTGAGGACGG - Intergenic
1029764900 7:102620379-102620401 CAGAGTCTGATGGGTGAGGACGG - Intronic
1029884176 7:103849584-103849606 CAGAGTATGAAGTTTGAAGAAGG - Intronic
1030931720 7:115532661-115532683 CAGAGTGTGAAAGCTGAGTAAGG + Intergenic
1031012664 7:116539860-116539882 CAGAGTGTGGAGGCTGGGGGTGG + Intronic
1031358655 7:120820454-120820476 CAGAGAATGAAGGCTATGTACGG - Intronic
1031512726 7:122669707-122669729 CAGAGTATGTGTGATGTGGAAGG - Intronic
1032534948 7:132655407-132655429 CAGAGAAAGAAGGGGGTGGAGGG - Intronic
1033116797 7:138632621-138632643 CAGAGGAAGTAGGATGTGGAGGG + Intronic
1033636477 7:143216436-143216458 CACAGTATGAACGCTGTGTTCGG + Intergenic
1033970658 7:147034872-147034894 CACAGGATGAAGGGTGTGGAGGG + Intronic
1035010069 7:155707531-155707553 CAGACTATGAAAGCTTTGTATGG - Intronic
1035727068 8:1831271-1831293 GACAGTGTGACGGCTGTGGAGGG + Intronic
1035794115 8:2337538-2337560 CAGAGTTTGAATGCTGTGCTGGG - Intergenic
1035798690 8:2384170-2384192 CAGAGTTTGAATGCTGTGCTGGG + Intergenic
1036008651 8:4695279-4695301 CAGACTATAAAGGCTGTACAGGG - Intronic
1036378958 8:8224326-8224348 AAGAGAATGAGGGCTGGGGATGG - Intergenic
1036477322 8:9104943-9104965 CAGAGTATGAAAGCTTTAGCAGG + Intronic
1038204788 8:25456117-25456139 GAGACTATGAAGCCTGGGGAAGG - Intronic
1038610288 8:29054555-29054577 CAGTGGATGAAGGCTGGGGAGGG + Intronic
1039168586 8:34714860-34714882 CAGAGTCTCAAGGCTGTGCAGGG + Intergenic
1039437894 8:37573189-37573211 CAGATTATCAAGGCTGGGAATGG + Intergenic
1042070752 8:64930933-64930955 CAGAATATGAATGCTGTGCTAGG + Intergenic
1042976522 8:74476553-74476575 CAGGATATGAAAGCTGTGGTTGG + Intronic
1043830079 8:84978077-84978099 CAGAGTTAGAAGAATGTGGAAGG + Intergenic
1044532563 8:93324334-93324356 CAGAGGATGCAGGCAGTAGAGGG - Intergenic
1045734403 8:105278095-105278117 CAGAACAGGAAGGCTGAGGACGG + Intronic
1046809330 8:118515708-118515730 CAGAATATGAAGGATGGGAAAGG - Intronic
1046886867 8:119376992-119377014 CAGAGCTTGAAGGCTGTGCTGGG - Intergenic
1047827524 8:128593758-128593780 GAGACTATGAAGGTTGTGGGGGG + Intergenic
1047958162 8:129991555-129991577 CAGAGTCCTAAGGCTGTGCAGGG - Intronic
1047983982 8:130213840-130213862 CATGGTATGAGGGCTGGGGAGGG + Intronic
1048427912 8:134339687-134339709 CAAAGTAGGAGGGTTGTGGAAGG - Intergenic
1048573539 8:135673697-135673719 CAGAGAATGAAGACTTTGAAGGG + Intergenic
1048729651 8:137424595-137424617 CAGAGTACGAAGGCTGTTCAGGG + Intergenic
1049037230 8:140086230-140086252 CAGAGTATGGAGGATGAAGAAGG + Intronic
1049812787 8:144582971-144582993 CAGAGTCTGGGGCCTGTGGAGGG - Intronic
1050375940 9:4973073-4973095 CAGAGTTTGGAGGCAGTAGAAGG - Intergenic
1050596975 9:7213766-7213788 CAGAGCATGGAGGCCTTGGAAGG - Intergenic
1051919817 9:22251606-22251628 CAGTGTCCGAAGGCTGTGCAGGG + Intergenic
1052091164 9:24329614-24329636 CAGAGTAGGATGCCTATGGAAGG - Intergenic
1056735443 9:89205797-89205819 CAGAGTGTCATGGCTGGGGATGG - Intergenic
1058825799 9:108774951-108774973 TAGAGTAGGAAGGCTCTAGAGGG - Intergenic
1059498137 9:114727214-114727236 CAGTGTGTGAAGGCTGAGGCTGG - Intergenic
1061282600 9:129606099-129606121 CATAGCATGAAGCCTGTGCAGGG + Intergenic
1062016499 9:134293740-134293762 CAGAGACAGAAGCCTGTGGAGGG - Intergenic
1062702435 9:137914346-137914368 CAGGGTATGAAGTCTGGGGTGGG - Intronic
1185927538 X:4163927-4163949 CAGAGGCTGAAGGGTGAGGAGGG + Intergenic
1186149252 X:6656585-6656607 CATAGCATAAAGGATGTGGAGGG + Intergenic
1188012871 X:25075958-25075980 CAAAGTATGAAGGTTCTGGCCGG - Intergenic
1188445488 X:30249609-30249631 CAGAGGCTGAAAGCTGTGGCTGG - Intronic
1189213343 X:39303023-39303045 CAGTGTCTCAAGGCTGTGCAGGG - Intergenic
1189431433 X:40950689-40950711 CAGTGTCTCAAGGCTGTGCAGGG + Intergenic
1189630409 X:42946708-42946730 CAGAGCATAAAGGCTTTGAATGG - Intergenic
1189650366 X:43182712-43182734 CAAAGAAAGAAGGGTGTGGAGGG - Intergenic
1190616537 X:52239647-52239669 GAGAGTATGAAGTCCCTGGAGGG - Intergenic
1190792732 X:53715100-53715122 CAAAATATTAAGGCTCTGGAGGG - Intergenic
1190806633 X:53844147-53844169 GAGAGTAGTAGGGCTGTGGATGG - Intergenic
1191206642 X:57841906-57841928 CAGTGGGTGAAGCCTGTGGAGGG + Intergenic
1191868523 X:65725601-65725623 CAGAGGATGAAGGTAGTGGGTGG - Intronic
1193068643 X:77283455-77283477 CAGAGTTTGAAAGCTGTGCTGGG - Intergenic
1194284996 X:91999203-91999225 CATACTATTAAGGCTGGGGATGG - Intronic
1194430956 X:93804345-93804367 CAAAGTTTGCAGGATGTGGAGGG - Intergenic
1195683235 X:107564226-107564248 CAGTGTATGAAGGAGGTGGGAGG - Intronic
1198582753 X:138084509-138084531 CAGAGTATGAAGTATGATGATGG + Intergenic
1200602563 Y:5223745-5223767 CATACTATTAAGGCTGGGGATGG - Intronic
1202592220 Y:26497394-26497416 AAGAGCATGAAGGTGGTGGAGGG + Intergenic