ID: 1086252015

View in Genome Browser
Species Human (GRCh38)
Location 11:84827219-84827241
Sequence TAGTGAGAGACTTTAACATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 200}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086252015_1086252016 -9 Left 1086252015 11:84827219-84827241 CCTTATGTTAAAGTCTCTCACTA 0: 1
1: 0
2: 0
3: 18
4: 200
Right 1086252016 11:84827233-84827255 CTCTCACTACACCGTGTTCGAGG 0: 1
1: 0
2: 0
3: 1
4: 37
1086252015_1086252018 -7 Left 1086252015 11:84827219-84827241 CCTTATGTTAAAGTCTCTCACTA 0: 1
1: 0
2: 0
3: 18
4: 200
Right 1086252018 11:84827235-84827257 CTCACTACACCGTGTTCGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1086252015_1086252022 13 Left 1086252015 11:84827219-84827241 CCTTATGTTAAAGTCTCTCACTA 0: 1
1: 0
2: 0
3: 18
4: 200
Right 1086252022 11:84827255-84827277 GGGGCATCATGGTAATAAAATGG 0: 1
1: 0
2: 0
3: 7
4: 102
1086252015_1086252017 -8 Left 1086252015 11:84827219-84827241 CCTTATGTTAAAGTCTCTCACTA 0: 1
1: 0
2: 0
3: 18
4: 200
Right 1086252017 11:84827234-84827256 TCTCACTACACCGTGTTCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1086252015_1086252021 2 Left 1086252015 11:84827219-84827241 CCTTATGTTAAAGTCTCTCACTA 0: 1
1: 0
2: 0
3: 18
4: 200
Right 1086252021 11:84827244-84827266 CCGTGTTCGAGGGGGCATCATGG 0: 1
1: 0
2: 0
3: 0
4: 43
1086252015_1086252023 14 Left 1086252015 11:84827219-84827241 CCTTATGTTAAAGTCTCTCACTA 0: 1
1: 0
2: 0
3: 18
4: 200
Right 1086252023 11:84827256-84827278 GGGCATCATGGTAATAAAATGGG 0: 1
1: 0
2: 2
3: 8
4: 113
1086252015_1086252019 -6 Left 1086252015 11:84827219-84827241 CCTTATGTTAAAGTCTCTCACTA 0: 1
1: 0
2: 0
3: 18
4: 200
Right 1086252019 11:84827236-84827258 TCACTACACCGTGTTCGAGGGGG 0: 1
1: 0
2: 0
3: 0
4: 32
1086252015_1086252024 23 Left 1086252015 11:84827219-84827241 CCTTATGTTAAAGTCTCTCACTA 0: 1
1: 0
2: 0
3: 18
4: 200
Right 1086252024 11:84827265-84827287 GGTAATAAAATGGGCTAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086252015 Original CRISPR TAGTGAGAGACTTTAACATA AGG (reversed) Intronic
903114967 1:21171401-21171423 TAGTGGGAGACCATAAAATAAGG - Intronic
903118599 1:21198451-21198473 TAGTGGGAGACCATAAAATAAGG - Intergenic
906398579 1:45488363-45488385 AAGTGAGGGAGTTTAACAGATGG - Intronic
906957893 1:50391241-50391263 TATTGAGAGTCGTTAACATGAGG + Intergenic
907991869 1:59590741-59590763 TATTGAGAGTTTTTAGCATAAGG - Intronic
908187247 1:61664169-61664191 TGGTGAGAGACATAAACAAAGGG + Intergenic
908288537 1:62637668-62637690 TAGGGTGAGACTTTAATAAAGGG + Intronic
908684861 1:66705032-66705054 GGCTGAGAGACATTAACATAAGG + Intronic
911908102 1:103594942-103594964 GGGTGAGACACTTTAACAGAGGG + Intergenic
911913636 1:103667423-103667445 GGGTGAGACACTTTAACAGAGGG + Intronic
911914816 1:103684524-103684546 GGGTGAGACACTTTAACAGAGGG - Intronic
912045263 1:105445881-105445903 TATTGAGAGTTTTTAACATGAGG + Intergenic
912154462 1:106900380-106900402 TAAGGAAACACTTTAACATAAGG + Intergenic
915927962 1:160038599-160038621 TATTCAGAGACTTTAGCATTGGG - Exonic
916239001 1:162620691-162620713 TAGTCAGAGACTATAACAAAAGG - Intergenic
917106180 1:171494406-171494428 TAGTAAAAGAATTCAACATATGG + Intronic
917290269 1:173465112-173465134 TATTGAGAGTTTTTAACATGAGG - Intergenic
917605170 1:176620687-176620709 TGGTGAGACAGATTAACATAGGG - Intronic
918479451 1:184962068-184962090 CAGAGAGAGACATCAACATAAGG + Intronic
920365957 1:205448524-205448546 TGGTGAGAGAATTTAACCTGGGG - Intronic
921515006 1:216079799-216079821 TATTGAGAGTCATTAAAATAAGG + Intronic
923279955 1:232434089-232434111 TATTGAAAGAGTTTAACACAGGG + Intronic
1065749367 10:28871501-28871523 AAGTGAGAGACTTCAAAAGAAGG - Intronic
1068072123 10:52207906-52207928 CACTGAGAGACTTGAACATTGGG - Intronic
1071094260 10:81955211-81955233 GAGTGAGAGATTTTATCATAAGG + Intronic
1074058878 10:109946780-109946802 TAGTGAGAGAGGTTATTATAAGG - Intronic
1078999063 11:16735194-16735216 TAGTGAGAGAGTTAAACTCAAGG + Intronic
1080164533 11:29221135-29221157 TATTGAGAGTTTTTAACATGAGG + Intergenic
1081081249 11:38741937-38741959 TATTGAGAGTTTTTACCATACGG + Intergenic
1082608087 11:55266629-55266651 TAGTGTGTGAGTTTAAAATAGGG + Intronic
1086252015 11:84827219-84827241 TAGTGAGAGACTTTAACATAAGG - Intronic
1086644351 11:89201052-89201074 TAATGAGATATTTTAACATTTGG - Intronic
1087378841 11:97378899-97378921 TATTGAGAGTTTTTAACATAAGG - Intergenic
1090232698 11:125120115-125120137 AACTGAGAGATTTTAAAATATGG + Intergenic
1090523284 11:127501933-127501955 TAGTGAGAGACTTTTAGAAGTGG + Intergenic
1091946364 12:4547936-4547958 TATTCAGAGAGGTTAACATATGG - Intronic
1093032461 12:14300953-14300975 TATTGAGAGTTTTTAACATGAGG - Intergenic
1093280864 12:17195002-17195024 TAGGCAGAGACTTTGAGATAGGG + Intergenic
1093723644 12:22477603-22477625 TAATGAAAGACTTTCACAAAAGG - Intronic
1095791414 12:46171269-46171291 TTGTGAGAAAGTTTAACAGAGGG - Intergenic
1097422211 12:59393993-59394015 TATTGAGAGTTTTTAACATGAGG - Intergenic
1097856679 12:64471101-64471123 AAGAGAGAGAATTTAACATATGG - Intronic
1098563681 12:71906337-71906359 ATGTGAGAGACTTTACCACAAGG - Intronic
1098680381 12:73346574-73346596 TATTGAGAGTTTTTAGCATAAGG + Intergenic
1099567405 12:84270148-84270170 AAGTCAGAGACTGAAACATAGGG + Intergenic
1101462978 12:104915958-104915980 TATTGAGAGTTTTTAGCATAAGG + Intronic
1102727112 12:115075364-115075386 AAGTTTGAGACTTTAACAAAAGG - Intergenic
1102944609 12:116975005-116975027 TAGTGATGGACTATAACCTATGG + Intronic
1105285935 13:19003970-19003992 TACTGAGAGTTTTTAACATGAGG + Intergenic
1106121997 13:26867754-26867776 AAGAGAGAGACTATGACATATGG + Intergenic
1106268590 13:28132540-28132562 TAATAACAGACTTTAACACAAGG - Intergenic
1106273403 13:28177372-28177394 TGGTGATAGACTTTAAAATATGG + Intronic
1106349380 13:28913301-28913323 TATTGAGAGTTTTTAACATGAGG + Intronic
1106672619 13:31922752-31922774 GAGTGAGAGACTTTATAATTAGG - Intergenic
1107129154 13:36877020-36877042 TAGTGTGAGTGTTTTACATATGG - Intronic
1107555965 13:41516943-41516965 TTGTGTGAGACGTTAACATTAGG - Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1109762369 13:66846022-66846044 TATTTAGAGAGTTTAAAATATGG + Intronic
1112948461 13:104960383-104960405 TAATGGGAGACTTTAACATCTGG - Intergenic
1116072186 14:40061409-40061431 TAGTTGGAGAATTTAACAAATGG + Intergenic
1117224677 14:53642788-53642810 TAGCGGGATACTTTAACACAGGG - Intergenic
1119711187 14:76823517-76823539 TGGTTATAGACGTTAACATAAGG + Intronic
1120588091 14:86340945-86340967 TATTGAGAGTTTTTAACATGAGG - Intergenic
1120781741 14:88491567-88491589 TATTGAGAGCCTTTAAAACATGG + Intronic
1125281519 15:38046902-38046924 TCTTGACAAACTTTAACATATGG + Intergenic
1135225500 16:20653206-20653228 TATTGAGAGTTTTTAACATGAGG - Intronic
1135253863 16:20924698-20924720 TAATGACAGGCTTTAAGATAAGG - Exonic
1144139978 17:12338858-12338880 AAGTAAAAGACTTTGACATATGG + Intergenic
1149160824 17:53690753-53690775 TGGTGAGAGCATTTACCATAGGG + Intergenic
1150865480 17:68844848-68844870 TATTGAGAGTTTTTAACATGAGG - Intergenic
1151861759 17:76769114-76769136 GAGTGATAGGTTTTAACATAAGG + Intronic
1153729579 18:7996358-7996380 CATTGAGAGACTTTATCATGAGG - Intronic
1163037774 19:14581019-14581041 AAGTGAGAGCCTCTAACAAATGG - Intergenic
1163127111 19:15250274-15250296 TAGGAAGAGACTTGAAGATAGGG - Intronic
925660742 2:6199578-6199600 TACTGATAGACTTTAACTAAAGG + Intergenic
926374511 2:12213145-12213167 TATTCACAGACTTTAAGATAGGG + Intergenic
926514889 2:13830983-13831005 TACTGAGAGTTTTTAACATGAGG - Intergenic
927169662 2:20358207-20358229 AACAGAGAGAATTTAACATAGGG - Intergenic
935440623 2:103091189-103091211 TATTGAGACTTTTTAACATAAGG + Intergenic
937107670 2:119333414-119333436 TAGAAAGACACTTTAACATCAGG + Intronic
940982475 2:160019116-160019138 AAATGAGAGACTAGAACATAGGG + Intronic
942861389 2:180617073-180617095 TAGAGAGAGGCTTTATCATCTGG - Intergenic
943154486 2:184156365-184156387 TTGTAAGAGACTTTAATGTATGG - Intergenic
944364080 2:198895887-198895909 TATTGAGAGTTTTTAACATGAGG - Intergenic
944392509 2:199231439-199231461 TATTGAGAGTTTTTAACATGAGG + Intergenic
944439052 2:199723572-199723594 TATTGAGAGTTTTTAACATGAGG + Intergenic
945579680 2:211577764-211577786 TATTGAGAGTTTTTAACATGAGG - Intronic
1168924532 20:1568279-1568301 TAGTGAGAGACTGTGCCCTAGGG - Intronic
1169304837 20:4480533-4480555 TAGTGGGAGAGTTGAACACAAGG - Intergenic
1169591911 20:7152992-7153014 CAGGGAGAGACATAAACATAGGG + Intergenic
1169942946 20:10957295-10957317 TAATTAAAGACTTTAACAGAAGG - Intergenic
1171331588 20:24343963-24343985 TATTGAGAGTTTTTAACATGAGG - Intergenic
1175630825 20:60535058-60535080 TTCAGAGAGAATTTAACATAGGG + Intergenic
1176324991 21:5387025-5387047 TATTGAGAGTTTTTAACATGAGG + Intergenic
1176482545 21:7317441-7317463 TATTGAGAGTTTTTAACATGAGG + Intergenic
1177191971 21:17862001-17862023 TGGTGACAGACATTAACACATGG + Intergenic
949421081 3:3866680-3866702 TATTGAGAGTTTTTAGCATAAGG - Intronic
951544585 3:23811153-23811175 AAGTGAGAAACTTTAAAATTAGG + Intronic
951556648 3:23927632-23927654 TAGTTAGAGACATTAACTGATGG + Intronic
954166507 3:48763275-48763297 CAGTGAGAGACATTGACAAAAGG + Intronic
954718270 3:52538044-52538066 TAGGGAGAGGCTTTAACATGTGG + Intronic
956394702 3:68812721-68812743 TAATGGGAGACTTTAACACCCGG + Intronic
958111454 3:89151935-89151957 TAGTGAGAGGCCTTTACAGAAGG + Intronic
958480070 3:94634584-94634606 TATTGAGAGTCTTTAGCATGAGG - Intergenic
960616779 3:119603021-119603043 TAGTGAGTGATTGTAGCATAAGG + Intronic
962037346 3:131666380-131666402 TTTTGAGAGACATTAAAATATGG + Intronic
962212944 3:133494227-133494249 TAGTGAGAGACTATTATATTGGG - Intergenic
967030399 3:185600994-185601016 CAGTGAGAGACTTGAACTTAGGG + Intronic
969854227 4:9986145-9986167 AATGGAGAGAATTTAACATAGGG + Intronic
971992156 4:33912845-33912867 TATTAGAAGACTTTAACATATGG - Intergenic
972045180 4:34656293-34656315 GAATGAAAGGCTTTAACATAGGG - Intergenic
972742008 4:41895942-41895964 AAGAGATAGACTTTAAAATATGG + Intergenic
974550994 4:63374449-63374471 TGGGTAGAGACTTTAGCATATGG + Intergenic
974867955 4:67603433-67603455 TAGGGAGAGACTTTTGCTTAAGG - Intronic
975150510 4:71015735-71015757 TATTGAGAGTTTTTAGCATAAGG - Intronic
977605506 4:98980782-98980804 TATTGAGAGACTTAAATAAATGG - Intergenic
977863380 4:101994168-101994190 TTTTCAGAGACTTTAACAAAAGG + Intronic
979937085 4:126711338-126711360 TACTGAGAGAGATTAAAATAAGG + Intergenic
980289926 4:130833779-130833801 TAGAGAGAGATTTGAACATTTGG + Intergenic
980658396 4:135821226-135821248 GAGTGATAGACTATACCATATGG - Intergenic
981154712 4:141420616-141420638 TAGTGAGAGACTTTTTATTACGG + Intergenic
983562138 4:169111874-169111896 TAGCTAGAGATTTTAACACAAGG + Intronic
983791913 4:171810142-171810164 TAGTGAAAGACTTTACTTTAGGG - Intergenic
983900545 4:173128776-173128798 CACTGAGAGAATTTAACATGGGG - Intergenic
984016329 4:174431363-174431385 TACACAGAGACTTTAAAATATGG - Intergenic
984458244 4:179998919-179998941 TAGTGTGCCACTTTAAGATAAGG + Intergenic
985022624 4:185708262-185708284 TAGTGACAGATATTAACTTAAGG - Intronic
986760845 5:10878435-10878457 TAAGGGGAGTCTTTAACATAAGG - Intergenic
987596790 5:20011643-20011665 TATTGAGAGTTTTTAACATGAGG + Intronic
987660374 5:20865409-20865431 TAGAGAGAGACTCTAAGATACGG + Intergenic
987909794 5:24126492-24126514 TATTGAGAGTTTTTAACATGAGG + Intronic
988527463 5:31999568-31999590 GAGTGAGAGACTTTACCCTCTGG + Intronic
988763277 5:34340267-34340289 TAAAGAGAGACTCTAAGATACGG - Intergenic
989328614 5:40228885-40228907 AAGTTACAGACCTTAACATAGGG - Intergenic
989699580 5:44246001-44246023 TTATGTGAGATTTTAACATAGGG - Intergenic
991402323 5:66264876-66264898 TATGGAGAGACATCAACATAAGG - Intergenic
993069980 5:83148337-83148359 TAATTTGATACTTTAACATAGGG + Intronic
993270944 5:85795191-85795213 TATTGAGATTTTTTAACATAGGG - Intergenic
993626351 5:90229372-90229394 TAGTGAGTCACTTTAAAATGTGG - Intergenic
993948698 5:94146972-94146994 TACTGAGAGACTTTTAATTAAGG - Intergenic
994018279 5:94994123-94994145 TGGTCATAGACTTTGACATAGGG - Intronic
994255942 5:97596099-97596121 TATTGAGAGTTTTTAACATAAGG - Intergenic
994560891 5:101370587-101370609 AATTGAGAGAATCTAACATAGGG - Intergenic
994810819 5:104517315-104517337 TAGTTACAGACTATAACATAAGG - Intergenic
995013127 5:107280010-107280032 TACTCAGAGATTCTAACATAGGG + Intergenic
995211250 5:109541947-109541969 TATTGAGAGTTTTTAGCATAAGG - Intergenic
995959774 5:117825911-117825933 TATTGAGAGTTTTTAACATGAGG + Intergenic
996285905 5:121792151-121792173 TGGTGAGAGTTTTTAACAGATGG - Intergenic
1004658436 6:17687676-17687698 TTATTTGAGACTTTAACATAGGG + Intronic
1005253164 6:23971226-23971248 TATTGAGAGTTTTTAACATGAGG - Intergenic
1005927343 6:30454291-30454313 TAATGAGAGATGTTAACATCAGG - Intergenic
1005930871 6:30482671-30482693 TAATGAGAGATGTTAACATCAGG - Intergenic
1006466627 6:34198896-34198918 TAGGGAAAGCCTTAAACATAAGG - Intergenic
1009661744 6:66621388-66621410 TACTGAGAGGTTTTAACATGAGG - Intergenic
1009662731 6:66634774-66634796 TATTGAGAGTTTTTAGCATAAGG - Intergenic
1009927791 6:70140951-70140973 TAGGGAGAGCCTTTTACAAAAGG + Exonic
1011997918 6:93616502-93616524 TAGAGAGAGACTTTCATACAGGG + Intergenic
1012535958 6:100297296-100297318 TACTCAGATACTTTAACATGAGG + Intergenic
1013711257 6:112902384-112902406 GAGAGAGAGGCTTTAACAGATGG + Intergenic
1013919750 6:115389821-115389843 TATTGAGAGTTTTTAACATGAGG + Intergenic
1013984130 6:116169649-116169671 TATTGAGAAATTTTAACAAATGG + Intronic
1014043246 6:116853530-116853552 TATTGAGAGTTTTTAACATAAGG - Intergenic
1014950857 6:127553794-127553816 TTTTGAGAGACTTTATCACATGG - Intronic
1015048101 6:128803256-128803278 TGGTGGGAGACTTTCACATCTGG - Intergenic
1017059810 6:150471593-150471615 TAGTGAGAGAATAGAACACATGG - Intergenic
1017254525 6:152317864-152317886 TTGTCAGTGACTTTATCATATGG + Intronic
1017274326 6:152548423-152548445 GAGTGAGAGAATTGAACAGAGGG - Intronic
1017290929 6:152735477-152735499 TAGTGACAGAATTCATCATATGG - Intergenic
1018325656 6:162664985-162665007 TATTGAGAGTTTTTAACATGAGG - Intronic
1018560770 6:165099022-165099044 TATTGTAAGACTTTAACATGAGG - Intergenic
1022688543 7:32621307-32621329 CAGTGATAGACATTTACATATGG - Intergenic
1023246082 7:38205593-38205615 TATTAAAAGACTTTATCATAAGG - Intronic
1026618987 7:71933770-71933792 TGCGGAGAGACTTTAACATAAGG + Intronic
1027455738 7:78389407-78389429 TGGTGAGAAACTTGAAGATAGGG + Intronic
1029314674 7:99700527-99700549 TAAGGAAAGACTTTAACAGAAGG - Intronic
1033437239 7:141344033-141344055 TTGTGACAGATTTTAAAATACGG + Intronic
1035740525 8:1924890-1924912 TACTGAGAAACTTTAAAACATGG - Intronic
1036138878 8:6188038-6188060 TAATGAGAGATTTTCACATATGG - Intergenic
1036591919 8:10176174-10176196 TAATGTGACATTTTAACATATGG - Intronic
1038790006 8:30659799-30659821 GAGTGAGAGACTTATACATATGG + Intergenic
1038961589 8:32526130-32526152 TTGTGAGAGACTCTAAAGTAGGG - Intronic
1039772484 8:40701401-40701423 TAGTGAGATACTTTACAAAAGGG + Intronic
1041371809 8:57169471-57169493 TATTGTGAGACTTTAAAATTTGG + Intergenic
1042318859 8:67453514-67453536 TTGGGAGAGAGTTTAACATCTGG + Intronic
1042489865 8:69384997-69385019 TATTGAGAGCTTTTAACATGAGG - Intergenic
1042651645 8:71049008-71049030 CAGAGGGAGACTTTAACATATGG + Intergenic
1043304642 8:78779425-78779447 TATTGAGAGTTTTTAACATGGGG + Intronic
1043554394 8:81414112-81414134 TATTGAGAGTATTTAACATAGGG - Intergenic
1045044774 8:98264082-98264104 TATTGAGAGTTTTTAGCATAAGG - Intronic
1045355856 8:101388396-101388418 AAGTGAGAGAGGTAAACATAGGG + Intergenic
1046481732 8:114828531-114828553 TTGTGAGAGACAGTAAGATACGG + Intergenic
1048608685 8:135997835-135997857 TAGTCTGAGACCTTATCATAGGG + Intergenic
1049286245 8:141776823-141776845 TTGTGAGAGACGCTAAGATAGGG - Intergenic
1050876392 9:10642534-10642556 TAGTAATAGCCTTTAAAATATGG + Intergenic
1051208733 9:14718800-14718822 GATTGAGAGACTTAAACAGAAGG + Intergenic
1052168344 9:25362011-25362033 TATTGAGTGATTATAACATAGGG - Intergenic
1055846250 9:80566812-80566834 TAGTGAGAGAGATTAACTAAAGG - Intergenic
1056494876 9:87146781-87146803 TAGACAGAGATTTTAAAATATGG - Intergenic
1058171560 9:101687240-101687262 TGGCCAAAGACTTTAACATAGGG + Intronic
1058408831 9:104707407-104707429 TATTGAGAGTTTTTAACATGAGG - Intergenic
1060640554 9:125234921-125234943 TAGTGAGAGCCTTTGAGGTAAGG + Exonic
1061090574 9:128423728-128423750 TAGTCTGAGCTTTTAACATAGGG - Intronic
1186236159 X:7513047-7513069 TACTGAGAGCCGTTAACTTAAGG - Intergenic
1189572187 X:42309957-42309979 TATTGAGAGTTTTTAACATGAGG - Intergenic
1190355907 X:49604254-49604276 GAGTGATAGACTTTCAGATAGGG + Intronic
1191187350 X:57627496-57627518 TATTGAGAGATTTTATCATGAGG - Intergenic
1191835698 X:65459660-65459682 TATTGAGAGATTTTAGCATGAGG - Intronic
1193303180 X:79917430-79917452 TGTTGAGAGTTTTTAACATAAGG + Intergenic
1193361752 X:80587090-80587112 TAGTGAGAGACTGTGCCATGAGG - Intergenic
1194194269 X:90871948-90871970 TACTGAGAGCTTTTAACATGTGG - Intergenic
1194416578 X:93619498-93619520 TTATGAGAGACTTAAACATTAGG - Intergenic
1195718291 X:107840194-107840216 TAGAGAGTTACTTTAAAATATGG + Intronic
1195813104 X:108855771-108855793 TATTGAGAGTTTTTAACATGAGG - Intergenic
1196511055 X:116513095-116513117 TACTGAGAGACTTTTAATTATGG + Intergenic
1197380614 X:125734010-125734032 TAGTTGGAGACTTTAACATCTGG - Intergenic
1198328864 X:135602661-135602683 TATTGAGAGCTTTTAATATAAGG + Intergenic
1198361512 X:135900181-135900203 TATTGAGAGCTTTTAATATAAGG + Intronic
1198662743 X:138988241-138988263 TAGAGAGAGATGTTAGCATATGG - Intronic
1200540881 Y:4454339-4454361 TACTGAGAGTTTTTAACATGTGG - Intergenic