ID: 1086253202

View in Genome Browser
Species Human (GRCh38)
Location 11:84842491-84842513
Sequence AGTTCCTAACTACCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086253199_1086253202 29 Left 1086253199 11:84842439-84842461 CCAAAACACATTCACTACTGAGC 0: 1
1: 1
2: 0
3: 7
4: 147
Right 1086253202 11:84842491-84842513 AGTTCCTAACTACCACAAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086253202 Original CRISPR AGTTCCTAACTACCACAAGC AGG Intronic
908477360 1:64503157-64503179 AGTTACTCACTATCAAAAGCCGG - Intronic
909614947 1:77597204-77597226 GGTTCCCAACAACCAAAAGCTGG + Intronic
911702503 1:100970142-100970164 AGTTCCAAAATACCAAAAGAAGG + Intronic
918049481 1:180961863-180961885 ACTTCCTAACTGACACAGGCTGG - Intergenic
919938803 1:202272438-202272460 AGTTCCCAAGTACCAGGAGCAGG + Intronic
921992420 1:221381805-221381827 AGTTCCCAACTAGTACTAGCTGG - Intergenic
1077190366 11:1253530-1253552 TGTTCCAAACCGCCACAAGCTGG + Intronic
1078026523 11:7700831-7700853 AGTTCCCAACATCCACAAACTGG + Intronic
1086253202 11:84842491-84842513 AGTTCCTAACTACCACAAGCAGG + Intronic
1090464950 11:126925458-126925480 AGTTCGTAAATCCCCCAAGCTGG - Intronic
1093998466 12:25668337-25668359 AGTTCAGAACTACCAGTAGCCGG - Intergenic
1095034116 12:37336340-37336362 AGTTCCAAACATCCACAAGCAGG + Intergenic
1095034229 12:37338552-37338574 AGTTCCAAACATCCACAAGCAGG + Intergenic
1101035906 12:100706300-100706322 AATGCCTAACTTCAACAAGCTGG + Intergenic
1112377809 13:98860250-98860272 AGTTGTTGACTATCACAAGCAGG + Intronic
1115394384 14:32891456-32891478 AATTCCTAACCTCCACTAGCAGG - Intergenic
1116490786 14:45500565-45500587 AGTTCCTAACTGAAACAACCTGG - Intergenic
1117288241 14:54307926-54307948 AGTTCCCTACTACTACAAGCAGG - Intergenic
1125375991 15:39030076-39030098 AGATACTAACTACCAGAACCAGG - Intergenic
1126131573 15:45347102-45347124 AGTTCCTGCCCACCACAAGCAGG + Intergenic
1128649991 15:69403868-69403890 ACATCCTAACCACCATAAGCCGG + Exonic
1131944034 15:97599418-97599440 CATTCCTAACTGCAACAAGCTGG - Intergenic
1132400589 15:101502443-101502465 AGCTCCTAAATGCCACTAGCAGG - Intronic
1150285586 17:63951989-63952011 AGATCCAAACTACCACATGTTGG + Intronic
1157916127 18:51665371-51665393 AGATCCTATCTGCCTCAAGCGGG + Intergenic
1162291156 19:9781587-9781609 TTTGCCTAACTTCCACAAGCAGG - Intronic
1165788713 19:38477954-38477976 AGTTCCTAGGTCCCACAACCAGG - Intronic
928702101 2:33909396-33909418 CATTCCTACCTACCACAAGAGGG - Intergenic
928716044 2:34061892-34061914 AGTTCCAAACCACCACAATAAGG + Intergenic
930278828 2:49345264-49345286 AGTTCCAAGCCAGCACAAGCTGG + Intergenic
932095183 2:68840854-68840876 AGTTACTAACTAACTCAAACTGG - Intergenic
939748490 2:146009386-146009408 GGTTACTAACTGCCACTAGCTGG + Intergenic
946086824 2:217182323-217182345 ATTTCCTAATTCCCACAAGTTGG - Intergenic
949031001 2:241797519-241797541 AGGTCCTCACTCCCACACGCTGG - Intronic
1168987806 20:2065250-2065272 GCTTCCTAACTAGTACAAGCTGG + Intergenic
1172218175 20:33251383-33251405 AGCACATAAGTACCACAAGCAGG + Intergenic
1175478424 20:59293739-59293761 ATTTGCAATCTACCACAAGCAGG - Intergenic
953032187 3:39186211-39186233 AGTTCTGAACAAGCACAAGCAGG - Exonic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953720246 3:45348944-45348966 AGTTCGTACCTAGCACATGCTGG + Intergenic
955680198 3:61492041-61492063 TGGTTCTAACTACCACAAGGCGG - Intergenic
955737503 3:62055067-62055089 AGTTCAGAACAACCAGAAGCAGG - Intronic
958783157 3:98566873-98566895 AAACCCTAACTATCACAAGCAGG + Intronic
966113732 3:176435037-176435059 AGTTCCTAACTAACACTAATCGG - Intergenic
967225947 3:187291506-187291528 AGCCCCTCACTACCACATGCAGG + Intronic
970929085 4:21487788-21487810 AGCTCCTAACTACCAAAGGTGGG - Intronic
971601948 4:28603904-28603926 AGATCCTCACTAGCACAAGCAGG - Intergenic
973159944 4:47003718-47003740 AATTGCTAACTACCAGAATCAGG + Intronic
973930885 4:55792139-55792161 ACTTCCTCACTACCACAAGAAGG - Intergenic
973980902 4:56307471-56307493 AGTTCACAACCACCACAACCAGG - Intronic
975543961 4:75542921-75542943 AGTTACTCATTACCACAATCTGG + Intronic
976057477 4:81085029-81085051 AGGCCATGACTACCACAAGCAGG + Intergenic
977073608 4:92424564-92424586 TATTCCTAACTACCACATGTTGG - Intronic
980453478 4:133007617-133007639 AGTTCCTAACTACCACTATTCGG - Intergenic
981923837 4:150116725-150116747 AGTTCATTACTACTACAATCTGG - Intronic
991409143 5:66329736-66329758 AACTCCTAACTGCCACATGCAGG - Intergenic
997878120 5:137567050-137567072 AGTTCCTTCCCACCACATGCTGG + Intronic
998514667 5:142742096-142742118 ATTTCATCACTACCACAAACTGG + Intergenic
1000346819 5:160321393-160321415 AGTTCCTCACTGCCAGCAGCAGG + Intronic
1003746159 6:9004842-9004864 AATTCCTAACATCCACAGGCAGG - Intergenic
1004568246 6:16819823-16819845 AGATTCAAACCACCACAAGCAGG - Intergenic
1011937982 6:92805175-92805197 ATTTTCTACCTACCAAAAGCAGG + Intergenic
1016553934 6:145314195-145314217 AGTTCATCAATACCACAAGTGGG - Intergenic
1016886215 6:148962092-148962114 AGTTTCTAACTATGACAAACAGG - Intronic
1017090669 6:150755918-150755940 AGCTTCTATCTACCACAAGATGG - Intronic
1017228395 6:152045857-152045879 ACTTACTAACTTCCACAAGAAGG - Intronic
1022418199 7:30196197-30196219 ATATCCTAAGTACCACAATCCGG - Intergenic
1023102023 7:36727459-36727481 AGTTCCCATCTACCAAAACCAGG + Intergenic
1030112756 7:106040658-106040680 AGTGCGTGCCTACCACAAGCGGG + Intergenic
1030534862 7:110753562-110753584 ATTTTCTAACAACCACATGCAGG + Intronic
1031203792 7:118726970-118726992 AGTATTTAACTACCAAAAGCAGG + Intergenic
1035573432 8:688699-688721 AGGTAGTAACTACCACAAACTGG + Intronic
1039137696 8:34344754-34344776 AGTTCTTAACAACCACTTGCAGG + Intergenic
1043542068 8:81275261-81275283 ATTTCATAACTGCCACACGCTGG - Intergenic
1048372447 8:133791238-133791260 AGTTCTTAACCACCACCAACAGG - Intergenic
1052151636 9:25124265-25124287 AGTTCCTAACTATCATTTGCAGG + Intergenic
1053487769 9:38472985-38473007 AGTGTCAAACTACCATAAGCAGG - Intergenic
1054941356 9:70746162-70746184 AGTCTCTTACTACCATAAGCAGG - Intronic
1060692755 9:125678707-125678729 TGTTCCTAGTTACCACAGGCAGG - Intronic
1187010565 X:15274111-15274133 TGTTCATAACTCCCCCAAGCAGG + Intergenic
1188899676 X:35714340-35714362 AGTTCCTAATTTCCACATTCAGG + Intergenic
1189360681 X:40348442-40348464 AGTACCAAAATACCACAGGCTGG + Intergenic
1192839104 X:74835857-74835879 AGTTCCTCCATGCCACAAGCTGG + Intronic
1196810634 X:119626369-119626391 AATTCCTAACTCCCACAAGCAGG + Intronic