ID: 1086259616

View in Genome Browser
Species Human (GRCh38)
Location 11:84923432-84923454
Sequence AAGAAGAAGAAGAAGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6252
Summary {0: 2, 1: 21, 2: 235, 3: 1173, 4: 4821}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086259609_1086259616 14 Left 1086259609 11:84923395-84923417 CCTTCTAGCATTTTAAATCACTG 0: 1
1: 0
2: 1
3: 20
4: 193
Right 1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG 0: 2
1: 21
2: 235
3: 1173
4: 4821
1086259608_1086259616 28 Left 1086259608 11:84923381-84923403 CCTCAGTTGCTTTTCCTTCTAGC 0: 1
1: 0
2: 0
3: 13
4: 302
Right 1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG 0: 2
1: 21
2: 235
3: 1173
4: 4821

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086259616 Original CRISPR AAGAAGAAGAAGAAGGAGGG GGG Intronic
Too many off-targets to display for this crispr