ID: 1086260182

View in Genome Browser
Species Human (GRCh38)
Location 11:84930552-84930574
Sequence TCTACTAAGTGGAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086260182 Original CRISPR TCTACTAAGTGGAATGAGGA TGG (reversed) Intronic
904141745 1:28358841-28358863 GTTAATAAGTGGAATGATGATGG - Intergenic
904414914 1:30354586-30354608 TCTACTGAGTGGAAAGGGAAGGG - Intergenic
904573877 1:31489469-31489491 TCTACTAAATGGGATGTGCAAGG - Intergenic
904975373 1:34452093-34452115 TCTCCTGAGTGGAGGGAGGATGG - Intergenic
905490723 1:38341595-38341617 TCTATTAAGGGGAATAAAGATGG + Intergenic
906135033 1:43492835-43492857 TTTACTAGGTGGAAAGAGCAGGG + Intergenic
906456712 1:46003578-46003600 TCTACTTAGGAGAATGAGGTGGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
909356657 1:74717348-74717370 TTGACTGAGTGGATTGAGGAAGG - Intronic
909800597 1:79802668-79802690 TATACAAAGAGGAATGAGTAGGG + Intergenic
910914954 1:92278734-92278756 TCTACTAACTGCAACAAGGAGGG - Intronic
911421685 1:97650095-97650117 TCCCCTAAGTGGAGGGAGGAGGG - Intronic
911752566 1:101514178-101514200 TCTACTCAGTGGGCTGAGGCAGG - Intergenic
913016242 1:114738780-114738802 GCTACTAAGTAGACTGAGGTGGG - Intronic
914451695 1:147798451-147798473 TATAGTAAGTGGAATCAAGATGG + Intergenic
918960947 1:191276840-191276862 TCTAGTAAGTAGAATCAGAAGGG + Intergenic
919529584 1:198700557-198700579 TGGACTAGATGGAATGAGGAAGG - Intronic
919657886 1:200214964-200214986 GCTACTAAGGGGGCTGAGGATGG + Intergenic
922412601 1:225390916-225390938 ACTACTAAGTGGAATGATTCTGG + Intronic
1063726269 10:8640939-8640961 TCTACTTAGTTGAATGATAATGG - Intergenic
1064233103 10:13547339-13547361 TGGACTAAGGGGAATGAGAATGG + Intergenic
1064458500 10:15510546-15510568 GCTACTAAGGGGGCTGAGGAAGG + Intergenic
1067406583 10:46029509-46029531 GTTACTTATTGGAATGAGGATGG - Intronic
1067473094 10:46550016-46550038 TCTACTCTGTGGCATGAGGGAGG - Exonic
1069175350 10:65283309-65283331 TCTAATAAGTGGAGGGAGGCAGG - Intergenic
1070002365 10:72389287-72389309 TCTAATAATTGGAATGAGTAAGG - Intronic
1070160350 10:73863134-73863156 TCTACTTTGTGGAAGGAGGTGGG + Intronic
1071158500 10:82719288-82719310 TCTATTATGTGGAATGATTAGGG + Intronic
1071411357 10:85400026-85400048 GCCATTAAGTGGACTGAGGAAGG + Intergenic
1071728870 10:88227919-88227941 TCTAGTACGTGGACTAAGGAGGG + Intergenic
1072004110 10:91226316-91226338 GCTGTTAAGTGCAATGAGGAAGG + Intronic
1075458440 10:122599994-122600016 TCGGCAAAGTGGAACGAGGAGGG - Intronic
1075746267 10:124730081-124730103 GCTACTGTGTGGCATGAGGAAGG - Intronic
1075809614 10:125215487-125215509 GCTGCAATGTGGAATGAGGATGG + Intergenic
1078221060 11:9352074-9352096 TCTACGGATTGAAATGAGGAAGG - Intergenic
1078861814 11:15255139-15255161 TGTACCAAGTGGAATGATCATGG - Intergenic
1086260182 11:84930552-84930574 TCTACTAAGTGGAATGAGGATGG - Intronic
1086428679 11:86714131-86714153 ACTACTAAGTGGATTTAGCAAGG + Intergenic
1087267212 11:96073704-96073726 TCGGCTAACTGGAATGTGGAAGG - Intronic
1087547316 11:99601299-99601321 TTTACTAAGTGGACTTAGAAGGG - Intronic
1088636372 11:111824832-111824854 TTTATTAAGTTGCATGAGGAAGG + Intronic
1089275060 11:117329206-117329228 TCTACTAAGGAGACTGAGGTGGG - Intronic
1095759596 12:45814666-45814688 TTTTATAACTGGAATGAGGAGGG - Intronic
1098269748 12:68758306-68758328 GCTACTCAGGAGAATGAGGAAGG + Intronic
1098413570 12:70207563-70207585 TTTACTAAGTGAAATGAGTCAGG - Intergenic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1104345000 12:127987979-127988001 TATACCAAGTGGAATGAGGCCGG - Intergenic
1104992980 12:132636642-132636664 TCTACTCAGTGGGCTGAGGTGGG + Intronic
1105932052 13:25061820-25061842 TCTACCTGGTGGATTGAGGATGG - Intergenic
1106271582 13:28159558-28159580 GCTACTAAGAGGACTGAGGCAGG - Intronic
1107055048 13:36093998-36094020 TCTACTAAGGAGGATGAGGCAGG - Intronic
1108406405 13:50107418-50107440 TCTAGCTAGTGGAATGAGAATGG + Intronic
1111196079 13:84875599-84875621 TCTATTAAGTGGGAGGAGAACGG + Intergenic
1112316742 13:98369850-98369872 TGTACTGAGAGGGATGAGGAAGG - Intronic
1112675774 13:101699877-101699899 TCTACTAAGTGGAATGTTCCTGG - Intronic
1112897188 13:104314004-104314026 TCTACCAACTGGGGTGAGGAGGG + Intergenic
1112988569 13:105482370-105482392 ACTTCTAAGTAGCATGAGGAAGG + Intronic
1114514456 14:23288887-23288909 GTTACTAAGTGAAATGAGGGAGG - Intronic
1115385037 14:32787880-32787902 TGTAATAAGTGGAAACAGGAGGG - Intronic
1117203940 14:53421165-53421187 TATACTAAGTGGAATGGGAGTGG - Intergenic
1117449301 14:55835702-55835724 TCTACTCAGTAGGCTGAGGAAGG - Intergenic
1118012729 14:61626485-61626507 ACTCTAAAGTGGAATGAGGAAGG - Intronic
1118850546 14:69579888-69579910 TCTACTGAGAGGAAGGAGAATGG - Intergenic
1120060323 14:79975209-79975231 TCTAATAAGTCAAAGGAGGAAGG - Intergenic
1120811976 14:88812969-88812991 TCACTTAAGTGGAATGAGCAAGG + Intergenic
1122073455 14:99220461-99220483 TATACTAAGTGAAATGAGCTAGG + Intronic
1123144010 14:106110471-106110493 TCTATTATGTGGCCTGAGGATGG - Intergenic
1125080084 15:35662450-35662472 TCAACTTAGAGGAAGGAGGATGG + Intergenic
1126734167 15:51714774-51714796 TCTTCTAAGTTGAGTGATGATGG + Intronic
1127979067 15:64021104-64021126 TCTACTGAGGGGAAAGATGAAGG - Intronic
1128562620 15:68678560-68678582 GCTACTCAGTGGACTGAGGCAGG + Intronic
1128615133 15:69102961-69102983 GCTACTAAGTGGAATCAGAAAGG - Intergenic
1129100683 15:73259897-73259919 TCTACCAGGTGGAATGAGAAAGG - Intronic
1130373455 15:83306895-83306917 CCTATTAAGGGGATTGAGGATGG + Intergenic
1130812917 15:87400837-87400859 ACTAATAAGTGAATTGAGGAAGG + Intergenic
1131036962 15:89229064-89229086 TCTGCTAGGGGGAATTAGGAAGG + Intergenic
1133642890 16:7734903-7734925 TCTACTAAGAGGCATGGTGATGG + Intergenic
1137773646 16:51038546-51038568 TCATCTCAGTGCAATGAGGAAGG + Intergenic
1139368198 16:66446801-66446823 CCTACTAACAGGAATGAGTAAGG + Intronic
1140656645 16:77147992-77148014 TCTACTGTCTGGAATGTGGATGG - Intergenic
1140825084 16:78698727-78698749 TCTACTAAGGAGACTGAGGCAGG + Intronic
1142427839 16:90010155-90010177 TCTACTCAGGGGGATGAGGCAGG - Intronic
1143735952 17:8912128-8912150 TCTCCTCAGTAGGATGAGGAAGG - Intronic
1148844000 17:50518058-50518080 TCCACCACGTGGACTGAGGAGGG - Intronic
1149399708 17:56283216-56283238 TATACTAAGTGAATTGAGGGAGG - Intronic
1150145996 17:62770017-62770039 ACTACTAAGTGCACTAAGGAGGG - Intronic
1150552503 17:66223730-66223752 TCTGCCAAGTGCACTGAGGAAGG - Exonic
1150579710 17:66461092-66461114 GCTACTCAGGGGAATGAGGCAGG + Intronic
1152491032 17:80633931-80633953 TCCACTAAGAGGAATGAGGCTGG - Intronic
1153153888 18:2127363-2127385 TCTGCTAAAAGGAAGGAGGAAGG - Intergenic
1153264694 18:3258588-3258610 GCTACAAAGTGAAAAGAGGAAGG + Intergenic
1153812260 18:8762579-8762601 TTTCCTACGTGGAGTGAGGAAGG + Intronic
1155577407 18:27263283-27263305 TCTACTAAATGGTAGAAGGAAGG + Intergenic
1157125723 18:44953978-44954000 TGCACTAAGTGGAAGGAGGCAGG + Intronic
1158323314 18:56287374-56287396 TCCACCAACTGGGATGAGGAAGG + Intergenic
1158565165 18:58548793-58548815 TCTACTTGGTGCAATGAGCATGG + Intronic
1158925118 18:62248826-62248848 TCTACTCAGAGTGATGAGGAGGG + Intronic
1159541186 18:69778910-69778932 CCTAATGAGTGGAATGGGGATGG + Intronic
1161161882 19:2766333-2766355 TCTACACGGTGGAATGTGGATGG - Intronic
1163461172 19:17438531-17438553 TCTTCTAAGAGCAATGAGTAGGG + Intronic
1167208980 19:48121392-48121414 GCTCCTCAGTGGACTGAGGAGGG + Intronic
1167270324 19:48502382-48502404 GCTACTAAGGGGAAGGGGGAAGG - Intronic
1167569594 19:50278590-50278612 GCTACTCAGGGGACTGAGGAAGG + Intronic
1167649822 19:50723205-50723227 TCTGGAAAGTGGAAAGAGGAGGG + Intergenic
925264464 2:2556964-2556986 TCTGCTAAGTGGAATAAGCCAGG - Intergenic
928716775 2:34070682-34070704 TATACTTGGTGGTATGAGGATGG + Intergenic
929471822 2:42201699-42201721 TCTGCTAAGTGGAATAAGCCAGG + Intronic
933147127 2:78867816-78867838 TCTACGAAGTGAAATGGTGAAGG + Intergenic
933362148 2:81301380-81301402 TCTAGTCAGTGGAATAAGGCAGG + Intergenic
934098665 2:88630362-88630384 TATACTAGTTGGTATGAGGAAGG + Intergenic
935642170 2:105301108-105301130 GCTACTAAGGGGAATGAGGCAGG + Intronic
936790959 2:116151148-116151170 TATATTAAGTGGAATGATCAAGG - Intergenic
938401295 2:130993893-130993915 TCTACTCAGGGGGATGAGGCAGG - Intronic
942224002 2:173798722-173798744 GGTACTCAGTGGAATGAGGGAGG + Intergenic
942367523 2:175243426-175243448 TGTACTAAATGGACTGAGGTTGG - Intergenic
945612720 2:212025170-212025192 TTTACAGAGTAGAATGAGGAGGG + Intronic
946123001 2:217532823-217532845 TTCAATAAGTGGAAAGAGGAGGG - Intronic
946774654 2:223124967-223124989 ACCACTAAGTGGAATAATGAAGG - Intronic
947144833 2:227055203-227055225 GCTACTAAGTGCAGTGAGGTTGG - Intronic
947496185 2:230639099-230639121 TCTACTCAGTGGGCTGAGGCAGG - Intergenic
1169000826 20:2166748-2166770 TCGTCTGAGTGGAATGATGAAGG - Intronic
1172941081 20:38655185-38655207 TCTTCTGAGAGGAAGGAGGATGG + Intergenic
1173671616 20:44803060-44803082 TCTGCTAAGTGGAATGAAAATGG - Intronic
1176897108 21:14393074-14393096 ACCACTGAGTGGAATGAAGAAGG - Intergenic
1177001027 21:15613470-15613492 TCAAATCAGTGGACTGAGGAAGG + Intergenic
1178791740 21:35706463-35706485 TCTTTTTAGTGGAATCAGGATGG - Intronic
1180098266 21:45571629-45571651 TTTTCTAACTGGAGTGAGGAGGG - Intergenic
1182262571 22:29085328-29085350 TGTAGTAAGGGGAATGAAGAGGG - Intronic
1184166447 22:42731689-42731711 TCTACTCAGGAGAATGAGGCAGG - Intergenic
1184996647 22:48211908-48211930 TCACCTAAGAGCAATGAGGAAGG + Intergenic
949285636 3:2400514-2400536 TCCACCAAGTGGCAGGAGGAAGG - Intronic
951139408 3:19144274-19144296 TCTACTCAGTGGAGTAAGTAGGG + Intergenic
952529252 3:34246290-34246312 TCTGCAGTGTGGAATGAGGACGG + Intergenic
956630872 3:71315506-71315528 ACTACTAAGTGGAAGGAATAAGG + Intronic
958608135 3:96386937-96386959 TTTTGTAAGTGGCATGAGGAAGG + Intergenic
959502064 3:107118108-107118130 TCTGATAAGTGAAATAAGGAAGG + Intergenic
961021691 3:123512960-123512982 TCTACTAAAAGGAATCAGGCAGG + Intronic
961437119 3:126926992-126927014 TATACAAAGTGCAATGAAGAGGG + Intronic
962430470 3:135314072-135314094 TCTACAAAGTGGCATCAGGGAGG - Intergenic
963637089 3:147811554-147811576 TTTACTAGGTGGATTGAAGAAGG + Intergenic
966385061 3:179387681-179387703 GCTACTCACTTGAATGAGGAAGG - Intronic
967967001 3:194969322-194969344 ACTACCAAGAGAAATGAGGAGGG + Intergenic
968322936 3:197787442-197787464 TCTACTGAGTAGAAGGGGGAAGG + Exonic
970148220 4:13059393-13059415 TATACTAAGTGAAATGAGCCAGG - Intergenic
974702284 4:65467164-65467186 TCTACTCAGCAGAATGAGCAAGG + Intronic
975029132 4:69591986-69592008 TCAATTAATTGGAATGTGGATGG + Intronic
975422085 4:74177974-74177996 TATACTAAGTAGAATGAGCTAGG + Intronic
975646189 4:76548320-76548342 TCTTCTAAGTGTGATGAGGAGGG + Intronic
977881955 4:102215200-102215222 TCTCCTAACTGGAATGGGGTTGG - Intergenic
978349907 4:107810648-107810670 TCTACTAACAGAAATGAGAAAGG - Intergenic
979426155 4:120570488-120570510 TCTACTAATGTGAAGGAGGAGGG - Intergenic
981064594 4:140469599-140469621 TTTAAAAAGTGGAATGGGGATGG - Intronic
981964896 4:150588493-150588515 TTTTCTAAATGGAATGTGGATGG - Intronic
982386144 4:154804557-154804579 AATACTTAGTGGAAAGAGGAAGG + Intronic
982977710 4:162087656-162087678 TCTACAAAGTCGAATGACGATGG - Intronic
984485561 4:180364487-180364509 TCTACTAAGCTGGAAGAGGAAGG - Intergenic
990283894 5:54280219-54280241 TCTATGAAGTGGAAAGAGGGAGG - Intronic
991436878 5:66605382-66605404 TCTGCTAAGAGCCATGAGGACGG - Intronic
991508111 5:67346037-67346059 TATACAAAGGGGAAAGAGGAAGG + Intergenic
996332209 5:122342480-122342502 GCTATTAAGTGGCATGTGGATGG - Intronic
998706975 5:144773356-144773378 TATACTACATGGAATGTGGACGG - Intergenic
999214838 5:149923880-149923902 TCAAATGAGAGGAATGAGGAGGG - Intronic
1001226300 5:169947324-169947346 TTTTCCAAGGGGAATGAGGAGGG + Intronic
1001781551 5:174373303-174373325 TATACTAAGTGAAATGAGCCAGG + Intergenic
1004462911 6:15854999-15855021 AATAGTAACTGGAATGAGGAGGG - Intergenic
1005566089 6:27096289-27096311 TCTACTAAGAGGAATAAGATAGG + Intergenic
1007244337 6:40449520-40449542 TCTACTGATTGGAATGTAGATGG + Intronic
1007625950 6:43246589-43246611 TCTACCTAGGGGAGTGAGGAGGG - Exonic
1009404312 6:63293109-63293131 GCTACTCAGGGGAATGAGGTGGG - Intronic
1010451973 6:76013663-76013685 TCTGCTAGATGGAATGAGGGAGG - Intronic
1012178174 6:96115932-96115954 TTTACTCATTGTAATGAGGAGGG - Intronic
1012385664 6:98679083-98679105 TATACTAAGGGGAATGAACATGG - Intergenic
1013530199 6:111012280-111012302 GCTACTGAGGGGAATGAGGTAGG - Intronic
1014935335 6:127379384-127379406 TCTACTCAGAAGAATGAGGCAGG - Intergenic
1016385212 6:143524286-143524308 TCTATTTTGTGGCATGAGGATGG - Intergenic
1017325540 6:153137445-153137467 TCTCCAGAGTGGAATGTGGAAGG + Intergenic
1018155726 6:160983607-160983629 TCTACTAAGGGCAGTGAGGAGGG + Intergenic
1019973738 7:4563364-4563386 TCTGGAAAGTGGAAAGAGGAAGG + Intergenic
1020657020 7:10940290-10940312 ACTATGAAGTGGAATGATGATGG - Intergenic
1020901456 7:14008512-14008534 GCTACTTTTTGGAATGAGGAAGG + Intergenic
1021251486 7:18332287-18332309 TCTTTGAGGTGGAATGAGGAAGG - Intronic
1021567098 7:22026705-22026727 TCCACTCAGTGGATTGAGCAGGG - Intergenic
1023414792 7:39921821-39921843 TCTACTCAGAGGAGTGTGGAGGG - Intergenic
1023856289 7:44186124-44186146 GCTCAGAAGTGGAATGAGGATGG - Intronic
1028624137 7:92858865-92858887 TCAATTAAGTGGAAAGAGGTGGG - Intergenic
1028703559 7:93812309-93812331 TCAACTAAGAGGAATGAGGAAGG - Intronic
1032447871 7:132000136-132000158 TCAACCTAGTGGAGTGAGGAGGG + Intergenic
1032652833 7:133897209-133897231 TCTTCTTGCTGGAATGAGGAAGG - Intronic
1033752873 7:144373458-144373480 ACTGCTAAGTGAAATGATGAAGG + Intronic
1033802065 7:144913021-144913043 TCTACTAGGTAGACTGAGGCTGG + Intergenic
1035156671 7:156920113-156920135 TCTGAAAAGTGGAAAGAGGAAGG + Intergenic
1035474327 7:159131103-159131125 TCTAGCCAGTGGAACGAGGAGGG + Intronic
1035514636 8:222199-222221 GCTACTAGGGAGAATGAGGAAGG + Intergenic
1037501450 8:19489582-19489604 GCTACAAAGTGGTATGAGAAAGG + Intronic
1038635149 8:29280342-29280364 CCTACTAAGTAGGCTGAGGAGGG + Intergenic
1039275836 8:35933544-35933566 ACTACAAAGAGGACTGAGGAAGG - Intergenic
1042567316 8:70125059-70125081 ACTACTAAGGGGAATCAGTATGG - Intronic
1043623939 8:82231095-82231117 GCTACTAAGTAGGCTGAGGAGGG + Intergenic
1044218364 8:89639670-89639692 TCTGCCAAGTGTCATGAGGATGG + Intergenic
1045145776 8:99342508-99342530 TATACTAAGTGAAATAAGCAAGG - Intronic
1046697518 8:117358529-117358551 TCTAGAATGTGGATTGAGGAAGG + Intergenic
1046936835 8:119892892-119892914 GCTACTAAGGGGACTGAGGCAGG - Intronic
1048422487 8:134291188-134291210 TCTAATTAGTGGAAAGAGCATGG + Intergenic
1049118684 8:140713998-140714020 GCTACTCAGTGGACTGAGGCAGG - Intronic
1052167556 9:25351797-25351819 GCTACTAAGAGGAGGGAGGAAGG - Intergenic
1055631302 9:78226631-78226653 GCTACTCAGGGGATTGAGGAGGG + Intergenic
1057710414 9:97437045-97437067 TCTACTAAGTGTTATGATAAGGG - Intronic
1057771850 9:97975164-97975186 TCTACAAAGTGGAAAAGGGAAGG - Intergenic
1058329050 9:103736105-103736127 TGTACTAAGTAGAATGATCATGG + Intergenic
1058788210 9:108413021-108413043 TCCACGAAGTGGAATGTAGAAGG + Intergenic
1059578804 9:115521249-115521271 TCCAGTAATTGGGATGAGGATGG + Intergenic
1060081759 9:120654169-120654191 TCTTCTAAGTGAAATCTGGAAGG - Intronic
1187232222 X:17434160-17434182 GCTGCCAAGTGGAATGTGGATGG - Intronic
1188275481 X:28195513-28195535 TCTCTTAAATGGAATGTGGATGG - Intergenic
1188685440 X:33063915-33063937 TTTTCTAAGTGGACTTAGGAAGG - Intronic
1189099889 X:38177888-38177910 TGTACTAAGATGAATGGGGAAGG - Intronic
1189730053 X:44010713-44010735 TCCACTGGCTGGAATGAGGATGG - Intergenic
1192722319 X:73712055-73712077 TCAACTAAAGGGAAGGAGGATGG + Intergenic
1196786516 X:119425860-119425882 TACACTAAGTGGAGTTAGGAAGG - Intronic
1197275910 X:124478772-124478794 TCTACTAAGTGGAAGGAAGAAGG + Intronic
1197859450 X:130954392-130954414 ACTACTAAGTTGAATGAGAAAGG + Intergenic
1198880025 X:141270686-141270708 TATGCTAAGTGGAATAAGCAAGG - Intergenic
1200123513 X:153802462-153802484 TCTTCTGAGTGAACTGAGGAAGG - Exonic