ID: 1086262484

View in Genome Browser
Species Human (GRCh38)
Location 11:84957187-84957209
Sequence GGACTCAAACCTAGACTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086262482_1086262484 -4 Left 1086262482 11:84957168-84957190 CCCAAGATCACATGGGACAGGAC 0: 1
1: 0
2: 2
3: 12
4: 127
Right 1086262484 11:84957187-84957209 GGACTCAAACCTAGACTTGCTGG 0: 1
1: 1
2: 1
3: 28
4: 131
1086262480_1086262484 0 Left 1086262480 11:84957164-84957186 CCTGCCCAAGATCACATGGGACA 0: 1
1: 0
2: 0
3: 19
4: 187
Right 1086262484 11:84957187-84957209 GGACTCAAACCTAGACTTGCTGG 0: 1
1: 1
2: 1
3: 28
4: 131
1086262483_1086262484 -5 Left 1086262483 11:84957169-84957191 CCAAGATCACATGGGACAGGACT 0: 1
1: 0
2: 1
3: 16
4: 141
Right 1086262484 11:84957187-84957209 GGACTCAAACCTAGACTTGCTGG 0: 1
1: 1
2: 1
3: 28
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086262484 Original CRISPR GGACTCAAACCTAGACTTGC TGG Intronic