ID: 1086264381

View in Genome Browser
Species Human (GRCh38)
Location 11:84980387-84980409
Sequence TTCAGAAAGTACCCTCATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086264381_1086264382 -9 Left 1086264381 11:84980387-84980409 CCTGTATGAGGGTACTTTCTGAA 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1086264382 11:84980401-84980423 CTTTCTGAAGCTTAAAACATTGG 0: 1
1: 0
2: 2
3: 18
4: 276
1086264381_1086264383 13 Left 1086264381 11:84980387-84980409 CCTGTATGAGGGTACTTTCTGAA 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1086264383 11:84980423-84980445 GAACATTCCTCCCCCTATACAGG 0: 1
1: 0
2: 0
3: 7
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086264381 Original CRISPR TTCAGAAAGTACCCTCATAC AGG (reversed) Intronic
901909316 1:12442076-12442098 CTCAGAAAGTACCAATATACAGG - Intronic
906258871 1:44371055-44371077 TTCAGCTTGTACCCACATACTGG - Intergenic
908528840 1:65013682-65013704 TTGAGAAGTTACCCTCATCCTGG + Intergenic
910733288 1:90422255-90422277 TTCAGAAAATAGCCTCAAAAGGG + Intergenic
911043145 1:93607762-93607784 TTCAGGAAGTCCCCTGATCCAGG + Intronic
916397411 1:164406249-164406271 TTCATAAAGTCACCTCATGCAGG - Intergenic
1063461827 10:6219725-6219747 TTCAGTAAGAACCCTCATGTGGG - Intronic
1064254249 10:13730588-13730610 TTCACAAATTACCGTCCTACTGG - Intronic
1066340055 10:34523175-34523197 TGCAGATTCTACCCTCATACAGG + Intronic
1069874544 10:71553540-71553562 TTCAGAATGTACACTCACCCAGG + Intronic
1077283324 11:1755128-1755150 TTCAGAAAGGCCCCTCCTTCAGG - Intronic
1086264381 11:84980387-84980409 TTCAGAAAGTACCCTCATACAGG - Intronic
1090012940 11:123061663-123061685 TCCGGAATGTACCCCCATACTGG + Intronic
1090514373 11:127410280-127410302 TTCAAAAAGTACCCCTGTACAGG - Intergenic
1099938726 12:89159560-89159582 TTCAAAAAGCACCCTCATTGTGG + Intergenic
1103006283 12:117422918-117422940 TTTAGAAAGAACTCTCACACAGG + Intronic
1106545575 13:30728010-30728032 TTCAGAATGTAACCTCATCTGGG + Intronic
1110481843 13:75987435-75987457 TTCAGAAAGTAGTCTTCTACTGG + Intergenic
1115588562 14:34840317-34840339 TTCAGAAAGAAGCATTATACCGG + Intronic
1118692695 14:68354969-68354991 CTCGGATAGTACCCTAATACTGG - Intronic
1202890594 14_KI270722v1_random:153666-153688 TTCAGAAAAGACCCTCAAACAGG + Intergenic
1123666715 15:22614104-22614126 TTCAGAAAGGCCCCTCCTTCTGG + Intergenic
1124320557 15:28708677-28708699 TTCAGAAAGGCCCCTCCTTCTGG + Intronic
1124481938 15:30086672-30086694 TTCAGAAAGGCCCCTCCTTCTGG - Intronic
1124488394 15:30138770-30138792 TTCAGAAAGGCCCCTCCTTCTGG - Intronic
1124521652 15:30410529-30410551 TTCAGAAAGGCCCCTCCTTCTGG + Intronic
1124537009 15:30555690-30555712 TTCAGAAAGGCCCCTCCTTCTGG - Intronic
1124543483 15:30607744-30607766 TTCAGAAAGGCCCCTCCTTCTGG - Intronic
1124563439 15:30795195-30795217 TTCAGAAAGGCCCCTCCTTCTGG - Intergenic
1124755133 15:32399550-32399572 TTCAGAAAGGCCCCTCCTTCTGG + Intronic
1124761639 15:32451901-32451923 TTCAGAAAGGCCCCTCCTTCTGG + Intronic
1124776990 15:32597167-32597189 TTCAGAAAGGCCCCTCCTTCTGG - Intronic
1126261852 15:46702848-46702870 TTCAGAATTTATCCTAATACGGG - Intergenic
1126593748 15:50365685-50365707 TTTAAAAAGTTCCCTGATACAGG + Intergenic
1137733151 16:50704394-50704416 GTCTTAAAGTTCCCTCATACTGG + Intronic
1139259665 16:65579452-65579474 TTCAGAGAGCTCCCTCCTACAGG - Intergenic
1143568242 17:7738169-7738191 GTCAGAATCTACCCTCTTACAGG - Intronic
1153325809 18:3818892-3818914 TTCAGAAAGCATTCTCATCCTGG - Intronic
1156944315 18:42809542-42809564 TCTACAAAGTAGCCTCATACAGG - Intronic
1157540297 18:48497052-48497074 TTCAGAGAGGACCCAGATACTGG + Intergenic
1158315821 18:56210377-56210399 TTCAGAAAGGACCTTCCCACAGG - Intergenic
1159135090 18:64328102-64328124 GTCATAAAGTAACCTCAGACAGG - Intergenic
1160268960 18:77366559-77366581 TTCAGAAAGCCACCTCATCCCGG + Intergenic
1164713559 19:30375821-30375843 TGCAGATAGCACCCACATACGGG - Intronic
1202666017 1_KI270708v1_random:120504-120526 TTCAGAAAAGACCCTCAAACAGG + Intergenic
931859299 2:66337383-66337405 TTCAGAAAATACCCTCAAAGAGG - Intergenic
932675712 2:73779236-73779258 TTCTGTCAGTACCCTAATACAGG - Intronic
936629776 2:114189597-114189619 TTCAGCAAGCTCCATCATACAGG + Intergenic
937097754 2:119246864-119246886 TTCAGATTGTTCCCTCAGACTGG - Intronic
937853900 2:126659032-126659054 TTAAGAAACTACCCTCCTAAAGG + Intronic
939002935 2:136757064-136757086 TTTAGAAAGTATCCTTTTACTGG - Intergenic
941505487 2:166338616-166338638 TTCAGATAGTAATATCATACTGG - Intronic
946556076 2:220859156-220859178 TGCAGAAAGTACCCTGCTAGAGG - Intergenic
947939244 2:234035228-234035250 TCCAGAAAGGAGCCTCACACTGG + Intergenic
1169735435 20:8832875-8832897 CTCAGAAAGTACCCTCATGTCGG + Intronic
1174194417 20:48763001-48763023 TTCAGAAAGAAACTTCATATTGG - Intronic
1175127859 20:56765757-56765779 CTCAGGAAGTACACTCAAACTGG + Intergenic
1178199282 21:30385357-30385379 ATCAGAAAGTAAGCTCATAGAGG + Intronic
951123096 3:18951416-18951438 ATCAGAAAGAAACCTCATGCTGG - Intergenic
957089881 3:75718957-75718979 TTCAGAAAAGACCCTCAAACAGG - Intronic
964180322 3:153875390-153875412 TACAGAAGATACCCTGATACAGG - Intergenic
966060821 3:175752645-175752667 TCCAGAAAGGACCCTGATAGTGG - Intronic
966617855 3:181931350-181931372 TTCAGAATGTGCCTTCAAACAGG - Intergenic
973056059 4:45659473-45659495 TTAAGAAAGTACCCTGCTTCTGG + Intergenic
976701592 4:87975310-87975332 TTCAATAAGTACAATCATACAGG + Intergenic
977694412 4:99950308-99950330 TGCAGAATGTTCCCTCATCCGGG + Exonic
979756314 4:124344305-124344327 TTCAAAAATTACCCACAAACTGG - Intergenic
980439465 4:132821211-132821233 TTCAGAAAGTACTTTCATAGAGG + Intergenic
982366714 4:154586685-154586707 TTCAGAAGGTACCCCCAGAGTGG - Exonic
985304703 4:188526233-188526255 TTGAGAAAGTACCCGAAGACCGG - Intergenic
985331575 4:188842851-188842873 TTCACAAAGTGTCCTCATAATGG - Intergenic
987981138 5:25085508-25085530 TTCAAAAAGTACCATATTACAGG + Intergenic
993468350 5:88275675-88275697 TTTAGAAAATACCATCATATTGG - Intergenic
999535055 5:152507017-152507039 TCAAGAAGGTACCCTAATACTGG - Intergenic
1002036287 5:176472594-176472616 TTTAAAAAGTTCCTTCATACAGG + Intronic
1002422996 5:179159370-179159392 TTCTGCAAGTACCTTCACACGGG - Intronic
1008899122 6:56591356-56591378 TTCAGTAAGAACCCTAATCCTGG + Intronic
1011416894 6:87131339-87131361 TTCAGAAAGCATCCTCTTGCTGG + Intergenic
1012578445 6:100832205-100832227 TTCAGAAAGAACGCTTATAAAGG + Intronic
1012919126 6:105203004-105203026 TACAGAAAGTACACACATAAAGG - Intergenic
1014367064 6:120556906-120556928 TCCACAAAGTATCCTCATACAGG - Intergenic
1025195502 7:56929274-56929296 CTCAGAAAGAAACCTCATACTGG + Intergenic
1025676450 7:63647665-63647687 CTCAGAAAGAAACCTCATACTGG - Intergenic
1025804701 7:64819663-64819685 TTCAAAAATTACCCTCAGGCCGG - Intronic
1025982954 7:66422358-66422380 TTCACACAGTAGCCTCATAAGGG - Intergenic
1026479305 7:70764595-70764617 TTCAGAAAGTGTGCTCGTACAGG + Intronic
1029673773 7:102051909-102051931 CTCAAAAAGAAACCTCATACTGG + Intronic
1032857460 7:135847037-135847059 TTCAAACAGTAACCTCATCCCGG + Intergenic
1035976539 8:4318879-4318901 TTCAGAAAGTACGTTCATTTAGG - Intronic
1045876913 8:106992473-106992495 TTGAGAAATTACCCTGGTACAGG + Intergenic
1046235574 8:111420201-111420223 TTCAGAGAGGACATTCATACTGG - Intergenic
1051198059 9:14585756-14585778 TTCTGAAAGTACCCACAGCCAGG - Intergenic
1052170453 9:25389380-25389402 TTCACAAAGTATCCTCAAATGGG - Intergenic
1052810373 9:33053093-33053115 TTCAGAACGTACCCTTGCACAGG - Intronic
1053298541 9:36932591-36932613 TCCAGAAAGATCCCTCATGCTGG - Intronic
1054957766 9:70933037-70933059 TTCAAAAAGGACCCTGATTCTGG + Intronic
1058454021 9:105122602-105122624 TCCAGACAGTACCCTCATCAAGG + Intergenic
1059932986 9:119279859-119279881 TTCAGAAAGTACACTGATTTGGG - Intronic
1203487691 Un_GL000224v1:72771-72793 TTCAGAAAAGACCCTCAAACAGG + Intergenic
1203500312 Un_KI270741v1:14666-14688 TTCAGAAAAGACCCTCAAACAGG + Intergenic
1189574012 X:42330490-42330512 TACTGAAAGTACCCACACACAGG - Intergenic
1190398614 X:50009746-50009768 TTCAGAAAGCACTCTCACCCAGG - Intronic
1190398738 X:50010693-50010715 TTCAGAAAGCACTCTCACCCAGG - Intronic
1190433535 X:50401369-50401391 TTCAGAAGATACCCACCTACAGG + Intronic
1192831765 X:74757616-74757638 TTAAGGAAGAAACCTCATACAGG - Intronic
1192850075 X:74945801-74945823 TTTACAAAGTACCTTCACACTGG + Intergenic
1195995706 X:110729671-110729693 TTTAGCAAGTTCCCTCATTCAGG - Intronic
1196145412 X:112311371-112311393 TTCTAAAAGTGCCCTCAGACGGG + Intergenic
1197559069 X:127994237-127994259 TCCAGAAAATAGCCTCAAACAGG + Intergenic
1197836326 X:130697662-130697684 TTCTCACAGTACCTTCATACCGG + Intronic