ID: 1086265939

View in Genome Browser
Species Human (GRCh38)
Location 11:84998235-84998257
Sequence CTGGTCCTGCCCTTGACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2968
Summary {0: 3, 1: 120, 2: 389, 3: 760, 4: 1696}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086265939_1086265943 -9 Left 1086265939 11:84998235-84998257 CCAGGTGTCAAGGGCAGGACCAG 0: 3
1: 120
2: 389
3: 760
4: 1696
Right 1086265943 11:84998249-84998271 CAGGACCAGGTGGAGGTAATCGG 0: 54
1: 101
2: 172
3: 242
4: 437
1086265939_1086265945 -2 Left 1086265939 11:84998235-84998257 CCAGGTGTCAAGGGCAGGACCAG 0: 3
1: 120
2: 389
3: 760
4: 1696
Right 1086265945 11:84998256-84998278 AGGTGGAGGTAATCGGATTATGG 0: 1
1: 23
2: 266
3: 904
4: 2531
1086265939_1086265946 1 Left 1086265939 11:84998235-84998257 CCAGGTGTCAAGGGCAGGACCAG 0: 3
1: 120
2: 389
3: 760
4: 1696
Right 1086265946 11:84998259-84998281 TGGAGGTAATCGGATTATGGTGG 0: 1
1: 24
2: 240
3: 1513
4: 8839

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086265939 Original CRISPR CTGGTCCTGCCCTTGACACC TGG (reversed) Intronic
Too many off-targets to display for this crispr