ID: 1086266275

View in Genome Browser
Species Human (GRCh38)
Location 11:85002292-85002314
Sequence TGGGATTGCCTTAAAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086266269_1086266275 16 Left 1086266269 11:85002253-85002275 CCCTGATTTGGCTAGTTGCTAGT 0: 1
1: 0
2: 1
3: 2
4: 95
Right 1086266275 11:85002292-85002314 TGGGATTGCCTTAAAAAGAAAGG 0: 1
1: 0
2: 2
3: 19
4: 243
1086266270_1086266275 15 Left 1086266270 11:85002254-85002276 CCTGATTTGGCTAGTTGCTAGTC 0: 1
1: 1
2: 0
3: 4
4: 97
Right 1086266275 11:85002292-85002314 TGGGATTGCCTTAAAAAGAAAGG 0: 1
1: 0
2: 2
3: 19
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086266275 Original CRISPR TGGGATTGCCTTAAAAAGAA AGG Intronic
903696805 1:25213751-25213773 TGGGAGAGCCTTAAAAAAAAAGG - Intergenic
904890335 1:33774736-33774758 TGTGATTGGCTTAAGAAAAAGGG + Intronic
907616514 1:55932185-55932207 TGCCATTGCCTTAAAATAAAGGG - Intergenic
907865406 1:58395150-58395172 TTGGATTGCATTAAGAAGAATGG + Intronic
909928545 1:81467808-81467830 TGGGATTGATTTTAATAGAAAGG + Intronic
910430184 1:87152260-87152282 TGGATTTGCCTTACAAATAAGGG - Intronic
910689241 1:89948994-89949016 TGGGATACCCATGAAAAGAAAGG - Intergenic
912421465 1:109544926-109544948 TGAGATTTCCTTAAAATGAGAGG + Exonic
913488343 1:119354850-119354872 TGGGATTCCCTAAGTAAGAACGG + Intergenic
914920724 1:151845691-151845713 TGGGAATGCCTTACACAGAGTGG - Intergenic
916486318 1:165262863-165262885 TTGGATTGGTCTAAAAAGAAAGG - Intronic
917147966 1:171912804-171912826 TGGGATTCTGTTAATAAGAAAGG + Intronic
917884343 1:179368472-179368494 TGGGAGAGCCTTAAGAAGACAGG - Intronic
918357607 1:183720420-183720442 TGGGAATGAAATAAAAAGAATGG - Intronic
918745990 1:188200515-188200537 CCGGATTGCCTTAAACAGCATGG + Intergenic
918966885 1:191362415-191362437 TGGGATGGCCTTATGAGGAAGGG + Intergenic
920775670 1:208934629-208934651 TGGACTTGCCTTCAAGAGAACGG + Intergenic
920787847 1:209059700-209059722 TGGGATGGCATCAAAGAGAAGGG - Intergenic
920961725 1:210669914-210669936 TGGGGTTGGCATAAAAGGAATGG + Intronic
922132937 1:222796832-222796854 TGGCATTGGCTTTAAAAGACGGG - Intergenic
923237478 1:232048205-232048227 TTGGTTTGACCTAAAAAGAAAGG + Intergenic
1063025713 10:2177130-2177152 CAGGACTGCCTTAAAAAGACAGG - Intergenic
1064367953 10:14725268-14725290 TAGGGTTGCCTTATAGAGAATGG + Intronic
1064849737 10:19697349-19697371 TGGGATTTCCTTATGAAGAAAGG - Intronic
1065250894 10:23812364-23812386 TGTGAATGCCTTAAAAACAAAGG + Intronic
1066012706 10:31209282-31209304 TGGGGTTTCCCCAAAAAGAATGG - Intergenic
1066763819 10:38784627-38784649 TGGGATGGACTTGAATAGAATGG - Intergenic
1066766957 10:38811512-38811534 TGGAATTGACTCAAATAGAATGG - Intergenic
1068456284 10:57257939-57257961 TAGGATTGCCTGCAAAAGATGGG - Intergenic
1068739521 10:60452525-60452547 TTCGATTGCCTTAAAAGGAGGGG + Intronic
1069202744 10:65642872-65642894 TTAGATTTCCTTAAAAGGAAAGG + Intergenic
1072852542 10:98911415-98911437 TGGGAAAGCCTCACAAAGAAAGG + Intronic
1072913996 10:99526233-99526255 AGAGATTGCCTTAAAATGCAGGG - Intergenic
1073901341 10:108224846-108224868 TAAGATTCCCTTGAAAAGAAAGG + Intergenic
1074120936 10:110494198-110494220 AAGGATTGCTTTACAAAGAATGG + Intergenic
1074782636 10:116812881-116812903 TGGGATTCCTCTAAAAAGGAAGG + Intergenic
1075816551 10:125269153-125269175 GGGGATTTCTTTTAAAAGAAAGG + Intergenic
1084908603 11:72369167-72369189 TGGGTCTGCACTAAAAAGAAGGG - Intronic
1085716916 11:78880608-78880630 TGGGAATGTGTCAAAAAGAAAGG - Intronic
1086266275 11:85002292-85002314 TGGGATTGCCTTAAAAAGAAAGG + Intronic
1086287692 11:85268223-85268245 AGGGATGGCTTTAAATAGAATGG - Intronic
1086297452 11:85386687-85386709 TGGTATATCCTTTAAAAGAAAGG + Intronic
1088041325 11:105386312-105386334 TTGGATTGGATTAAAAAGCAAGG + Intergenic
1088951696 11:114578142-114578164 TGGGATTGTCTTAGAAGCAAAGG + Intronic
1089823461 11:121249311-121249333 TGGGATTGCCCTAGGACGAAAGG - Intergenic
1089909796 11:122085967-122085989 AGGGATTGAGTTTAAAAGAATGG + Intergenic
1090170697 11:124601328-124601350 TGGGATTGCCTATACAAAAAGGG + Intergenic
1090612256 11:128481921-128481943 TGGAACTGCTTTAAACAGAAAGG + Intronic
1090683653 11:129089904-129089926 TGGGATTATCTGAAAAACAATGG + Intronic
1093630744 12:21406400-21406422 TGGGAATGGCTTCAAAAGTAAGG + Intronic
1095690916 12:45087669-45087691 GGGCTTTGCTTTAAAAAGAAAGG - Intergenic
1097201789 12:57285129-57285151 TGGGATGGTGGTAAAAAGAAGGG - Intronic
1099216183 12:79856321-79856343 TCTGATTGCATTAAACAGAAGGG - Intronic
1099557399 12:84127746-84127768 TGGGATGGCTTTAGAAAGAAAGG + Intergenic
1099773145 12:87089741-87089763 TGGCAATGGTTTAAAAAGAAAGG - Intergenic
1099942383 12:89203889-89203911 AGGGATTGCTTCAAAGAGAAAGG + Intergenic
1100862350 12:98819581-98819603 TGGGGCTGCCTTACAAAGAGCGG + Intronic
1100867381 12:98871192-98871214 TGGGATTGATTTAGAAAAAAAGG - Intronic
1101826336 12:108223442-108223464 TGGAATTCCATTGAAAAGAATGG - Intronic
1107922799 13:45227905-45227927 TGAGTTTGCCATACAAAGAAGGG + Intronic
1112898873 13:104335579-104335601 TGGGATTGCCTCTAAAAGTAAGG - Intergenic
1115630847 14:35243570-35243592 AGGGAATGTTTTAAAAAGAAAGG + Intronic
1116250634 14:42478559-42478581 TGGGATTGCATTAGAATCAAAGG - Intergenic
1117309946 14:54511150-54511172 TGTGATTGCCTTAAAGAACACGG + Intronic
1117515356 14:56495210-56495232 TAGGATTCCATTAACAAGAAGGG + Intronic
1118112748 14:62740505-62740527 TCGGAGTGCCGTGAAAAGAAAGG - Intronic
1118194631 14:63613134-63613156 TGGTATAGCCATAAAATGAAAGG + Intronic
1118231413 14:63953923-63953945 TGAGACTGCCTCAAAAAAAAAGG - Intronic
1119518390 14:75266545-75266567 TGGGAATGTCTTTAAAAGAGAGG - Intronic
1122696892 14:103559134-103559156 TGAGATTGCATTAAAGAGAAGGG - Intronic
1124119021 15:26872609-26872631 TGTGATTGGGTTCAAAAGAAAGG + Intronic
1126003675 15:44235907-44235929 GGGGATAGCCTGAAAGAGAATGG + Intergenic
1126207852 15:46066477-46066499 TGGGATTGCATTAAACTAAAAGG + Intergenic
1129633008 15:77282513-77282535 AGGGAATGCTTTAATAAGAATGG + Intronic
1133641627 16:7722750-7722772 TGGGGCTGCCTTGAAAGGAACGG - Intergenic
1133719489 16:8481554-8481576 TGGGAGTACCTTAAAAGTAATGG - Intergenic
1133870017 16:9677406-9677428 TGGGAATGCATAAAACAGAAAGG - Intergenic
1139456835 16:67086456-67086478 TGGGATTGCCATAAAGTGGAGGG - Intronic
1141834473 16:86529646-86529668 TGAGATTGTCTCAGAAAGAAGGG + Intergenic
1145330515 17:21867983-21868005 TGGAATGGACTCAAAAAGAACGG + Intergenic
1145331653 17:21877430-21877452 TGGAATGGCCTCAAAAGGAAAGG + Intergenic
1145334127 17:21898012-21898034 TGGGATGGCATTAAACAGAATGG + Intergenic
1145335425 17:21908445-21908467 TGGAATGGCCTCGAAAAGAATGG + Intergenic
1145337908 17:21928554-21928576 TGGAATGGACTGAAAAAGAACGG + Intergenic
1145341047 17:21954849-21954871 TGGAATGGACTCAAAAAGAATGG + Intergenic
1145342052 17:21963402-21963424 TGGGATGGACTCAAAAGGAATGG + Intergenic
1145698004 17:26804972-26804994 TGGAATGGCCTTAAATGGAATGG + Intergenic
1145704004 17:26855406-26855428 TGGAATGGACTCAAAAAGAATGG + Intergenic
1145705507 17:26868132-26868154 TGGAATTGACTCAAATAGAATGG + Intergenic
1148484323 17:47981012-47981034 TGGGTTTTCCTTAAAAGGAAAGG + Intronic
1149092314 17:52798478-52798500 TGGGAGTTTCTGAAAAAGAATGG + Intergenic
1149289931 17:55208179-55208201 TGGGCTTGGCTTAAAAAACAAGG + Intergenic
1150328128 17:64273230-64273252 TGTGAGTGCCTCAGAAAGAAGGG - Intergenic
1150869385 17:68888841-68888863 TGGGTTTGCCTAAGACAGAATGG + Intronic
1151085365 17:71374316-71374338 TGGGATTGGCTTCTAAAGTAAGG - Intergenic
1151394987 17:73817161-73817183 GGGAATTGCTTTAAAAAAAAAGG - Intergenic
1152829733 17:82489696-82489718 TGAGCTTGCCTTAAAAAGAAAGG + Exonic
1203194905 17_KI270729v1_random:222701-222723 TGGAATTGCATCAAAGAGAATGG + Intergenic
1203199219 17_KI270729v1_random:260199-260221 TGGAAATGACTCAAAAAGAATGG + Intergenic
1203204260 17_KI270730v1_random:22097-22119 TGGAATTGCATCAAAGAGAATGG + Intergenic
1203208819 17_KI270730v1_random:60939-60961 TGGAAATGACTCAAAAAGAATGG + Intergenic
1153783097 18:8511452-8511474 TAGGTATCCCTTAAAAAGAATGG + Intergenic
1155347966 18:24877396-24877418 GGGCATTGCCTTACAAACAAAGG - Intergenic
1155764429 18:29609811-29609833 TTTGATTGCCTTAAAAACTATGG + Intergenic
1156356185 18:36342986-36343008 TAGGATTGCCATAATAAAAAGGG + Intronic
1156889185 18:42170343-42170365 TGGGAGTGCCTTGAAGACAAGGG - Intergenic
1162287454 19:9749922-9749944 TGGAATTGACATAAAGAGAAAGG - Intergenic
1168034676 19:53709904-53709926 TGGTATAGCCTTAAAATCAAAGG - Intergenic
931762138 2:65427460-65427482 TGTGTTTGCCTTAAAAAGGGAGG - Intronic
932419559 2:71593499-71593521 TGGGTTTGCTTTGAAATGAAAGG + Intronic
934988937 2:98907617-98907639 TGGGAGTGCCTTCAAAACCAAGG - Intronic
937793056 2:125982937-125982959 TGGGATTCATTTAAAATGAAAGG - Intergenic
939212050 2:139188255-139188277 TGGGATTGCATTAAAGCAAAAGG - Intergenic
939335455 2:140821727-140821749 TGGGATTACATTGAAAATAAAGG + Intronic
939403116 2:141720731-141720753 TGTGATTGTCTTGAAAAGAAAGG + Intronic
939625411 2:144471298-144471320 TGGGATTGGTTTTAGAAGAAAGG + Intronic
940599522 2:155840541-155840563 TGCTATTTCCTTAGAAAGAACGG - Intergenic
941962590 2:171268671-171268693 TGGGGTTGCCTTAACAATAGGGG + Intergenic
942701269 2:178713692-178713714 TGGAAATTCCTCAAAAAGAAAGG + Intronic
942751084 2:179288136-179288158 TGTGATTGCCATAAAAATCAGGG - Intergenic
942965578 2:181889425-181889447 TGCTATTGCCTTGAAAAGTAAGG - Intergenic
943505578 2:188752697-188752719 TGGCATTGGATAAAAAAGAAAGG + Intronic
943573565 2:189603211-189603233 TGACATTGGCTTAAAAAGATAGG - Intergenic
946652863 2:221912641-221912663 TGGGATTTGCTTCAAAATAATGG + Intergenic
1169470688 20:5882973-5882995 TGGGATCTGCTGAAAAAGAATGG - Intergenic
1170552911 20:17492263-17492285 GGGTATTGCTTTAGAAAGAAAGG - Intergenic
1171920351 20:31093492-31093514 TGGAATGGACTTGAAAAGAATGG + Intergenic
1171921775 20:31104677-31104699 TGGAATTGACTTGAAATGAATGG + Intergenic
1171926170 20:31190465-31190487 TGGAATGGACTAAAAAAGAACGG + Intergenic
1171928849 20:31211657-31211679 TGGAATGGACTTGAAAAGAATGG + Intergenic
1171930276 20:31222822-31222844 TGGAATTGACTTGAAATGAATGG + Intergenic
1172214619 20:33226393-33226415 TGGGATAGCCCTAGAAAGAAAGG - Exonic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1173261180 20:41437796-41437818 TTGGAATGCCTTCAGAAGAAGGG - Intronic
1173441012 20:43076399-43076421 TTGGCTTGCATTAAAAATAAAGG - Intronic
1173957216 20:47042970-47042992 TTGGATTTTCTTAACAAGAAAGG + Intronic
1176527032 21:7927529-7927551 TGGAATGGGCTGAAAAAGAATGG - Intergenic
1176528800 21:7942185-7942207 TGGGATGGCATTAAATGGAATGG - Intergenic
1176750659 21:10688663-10688685 TGGCATGGACTTGAAAAGAATGG - Intergenic
1177934068 21:27319641-27319663 GGGTATTGACTGAAAAAGAATGG - Intergenic
1177989620 21:28021528-28021550 TGGGCTTTACTTGAAAAGAATGG - Intergenic
1179208981 21:39310024-39310046 TGGAATTTGCTTAAAAACAAGGG + Intronic
1182017081 22:27049771-27049793 TGGTTTTGCCTTAAAAGTAATGG - Intergenic
1184636169 22:45833683-45833705 TGGGATTTCTTTGAAGAGAAAGG + Intronic
949616948 3:5764259-5764281 TGTATTTGCCTTATAAAGAAAGG + Intergenic
951706424 3:25548487-25548509 TGGCACTGCCTTAAAATCAAGGG - Intronic
954889215 3:53908631-53908653 TTCAAATGCCTTAAAAAGAAGGG + Intergenic
954941323 3:54375750-54375772 TGAGATTGCCAGAAAAAGAATGG + Intronic
957416687 3:79914531-79914553 TGCTATTTCCTTAAAAAAAAAGG + Intergenic
957571344 3:81950680-81950702 AGGGATGGCTTTGAAAAGAATGG + Intergenic
957932877 3:86904782-86904804 TGAAATTGCTTTAAAAAGGAAGG + Intergenic
959085967 3:101850517-101850539 TGTGTGTGCCTTAAAAAAAATGG + Intronic
959219559 3:103499325-103499347 TGGGAAAGCCTGAAAAGGAAAGG - Intergenic
959240941 3:103792761-103792783 TTGTTTTGCCTTAAAAAAAATGG + Intergenic
960021609 3:112962079-112962101 TTATATTGCCTTAAAAAGTAGGG - Intronic
961154916 3:124671521-124671543 TCCCATTGCCTTAAAAACAAGGG + Intronic
965136195 3:164772455-164772477 ACTGATTGCTTTAAAAAGAAAGG + Intergenic
965406482 3:168275773-168275795 TGGGATTGCCCCAAAGAGCATGG + Intergenic
966653219 3:182324431-182324453 TAGAATTTCCTTAAATAGAAAGG + Intergenic
970353541 4:15229962-15229984 TGCGAGTGCTTTAACAAGAATGG - Intergenic
971171064 4:24233083-24233105 TGGCCTTTCCTTAAGAAGAAAGG - Intergenic
971641176 4:29135138-29135160 TGGGATTACCATAACAAGATTGG + Intergenic
972581323 4:40398040-40398062 TGGGTTTTCCTTAAAAATGATGG + Intergenic
973038124 4:45433746-45433768 TGGGATTGCATTTAATATAAAGG + Intergenic
973283179 4:48382872-48382894 TGGGATGGCCTTGAAGTGAAAGG - Exonic
974096372 4:57369047-57369069 TGAGCTTGCCTTATGAAGAAGGG + Intergenic
975179281 4:71325232-71325254 TTGGATTCCATTAAAAAAAAAGG + Intronic
976517526 4:85985667-85985689 GGGGATTGGCTGAAAAAGAGAGG + Intronic
977041605 4:92025684-92025706 TGGGATTACTTTGAATAGAATGG + Intergenic
977215839 4:94282574-94282596 AGGGATTGTCTTAATAAGGACGG + Intronic
977424950 4:96856563-96856585 TGAGGTTTCCTGAAAAAGAATGG + Intergenic
977930749 4:102746237-102746259 GGGGATTGACTGGAAAAGAATGG - Intronic
978256447 4:106698062-106698084 TGGCATTGGCTGAATAAGAAAGG - Intergenic
979138296 4:117138974-117138996 TCTGATTGTTTTAAAAAGAAGGG - Intergenic
979738879 4:124125536-124125558 TGGGAATACCAGAAAAAGAAAGG - Intergenic
980033554 4:127857707-127857729 TGGGATTCTGTTAAAAAGGAAGG + Intergenic
980156717 4:129116893-129116915 TGAGATTGCTGTAAAAAGTAAGG - Intergenic
981397132 4:144265259-144265281 TGGCATTTACATAAAAAGAAAGG - Intergenic
981472224 4:145149528-145149550 TTGGCTAGTCTTAAAAAGAAAGG - Intronic
984075695 4:175176143-175176165 TGTGATTGCTTTAAGAAAAATGG + Intergenic
984410106 4:179386884-179386906 TGTGGTTGCCTTAAACACAAAGG - Intergenic
986249074 5:6039493-6039515 TGAGAAAGCCTTGAAAAGAAGGG - Intergenic
987314490 5:16711480-16711502 TGGGATTTTCTTAAACATAAGGG - Intronic
990733416 5:58833950-58833972 TTCGATTTCATTAAAAAGAAAGG - Intronic
990832892 5:59980394-59980416 TGGGTTTGCCTTAAAAAATATGG + Intronic
992103183 5:73426939-73426961 AAGTATTGCCTTAAAAACAAAGG + Intergenic
993544254 5:89191479-89191501 ATAGATTGCCATAAAAAGAAAGG + Intergenic
995752753 5:115471000-115471022 TGGGATTTCCCAGAAAAGAATGG - Intergenic
998573002 5:143281871-143281893 AGTGACTGCCTTAATAAGAATGG - Exonic
999683186 5:154078806-154078828 TGGGATTGAATTCAAAAGATTGG + Intronic
1000836056 5:166155713-166155735 TGGAATTGCCTTCAAAATCAGGG + Intergenic
1003477037 6:6492698-6492720 TGAGATTTCCTCCAAAAGAATGG - Intergenic
1003848522 6:10198482-10198504 TGGGATTGCATAAAAAGGAGAGG - Intronic
1004786665 6:18975347-18975369 TGATAAAGCCTTAAAAAGAAAGG + Intergenic
1006043496 6:31273183-31273205 TGTGACTGCCTTAAAACTAATGG - Intronic
1006278586 6:33027912-33027934 TGGGAGTGGCTGAAAAAGCAGGG + Intergenic
1009914129 6:69971664-69971686 TGGGAATTCCTTAAAAATGATGG - Intronic
1010678445 6:78770976-78770998 TTTGAATGCCTTAAAATGAATGG - Intergenic
1012296901 6:97535187-97535209 TGAGTTTGCTTTAAAAAGTAAGG - Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1013051482 6:106539738-106539760 TGAGAATGCCTTAAAGACAAAGG - Intronic
1014483778 6:121973423-121973445 AGACATTGCCTTAAAAAAAAGGG - Intergenic
1014700259 6:124677878-124677900 TAGACCTGCCTTAAAAAGAAAGG - Intronic
1015102728 6:129500343-129500365 TTGGATGTCCTTAAAAACAAAGG + Intronic
1017651575 6:156588247-156588269 TGGGCATGGATTAAAAAGAAAGG - Intergenic
1017878866 6:158545844-158545866 TGGGGGTGTATTAAAAAGAATGG - Intronic
1019436007 7:1022494-1022516 TGCGATTGCGTTAAAATAAAAGG - Intronic
1020435576 7:8158903-8158925 TGTGAATGCCTTGAGAAGAAAGG - Intronic
1023235670 7:38083483-38083505 TGTGATTGGCTTAAAATGCAAGG + Intergenic
1024417839 7:49128433-49128455 TGGGGATGTCTTAGAAAGAATGG - Intergenic
1028427213 7:90703190-90703212 TGGGATAGCATCAAGAAGAAAGG - Intronic
1028759967 7:94484848-94484870 TGAGATGGCCTTAAAAGGGAGGG + Intergenic
1032558827 7:132866193-132866215 TGGGATTGCATTAGCCAGAAAGG - Intronic
1035161170 7:156950753-156950775 TGGGATTTCCTTCAAAATAACGG + Intronic
1036463255 8:8973031-8973053 TGGGAATGCCAGAAAAAGACTGG - Intergenic
1036617075 8:10396567-10396589 TTAGATTGCCTTAAAATGTAAGG + Intronic
1037532745 8:19793701-19793723 TGAGATTGCCTTAAATTGCATGG - Intergenic
1039084648 8:33767795-33767817 TGGGTTTGGCTCAAAAAGATGGG - Intergenic
1040088421 8:43369542-43369564 GGGGATTGCTTAAAACAGAAAGG + Intergenic
1040088817 8:43374044-43374066 GGGGATTGCTTAAAACAGAAAGG + Intergenic
1041793150 8:61717568-61717590 TTTGATTTCCTTAAAAAGATAGG - Intergenic
1048024163 8:130569209-130569231 TGGCAATGCCTCAATAAGAAAGG - Intergenic
1048548119 8:135405545-135405567 TTATGTTGCCTTAAAAAGAAAGG - Intergenic
1048743627 8:137589246-137589268 TGGGATTTCGTGAAGAAGAATGG - Intergenic
1050991160 9:12154141-12154163 TGGGTGTGCAATAAAAAGAATGG - Intergenic
1052395699 9:27935385-27935407 TGTGATTGCCTTTGAAAGATAGG + Intergenic
1052643054 9:31194063-31194085 TAGGATTTCCATAAAGAGAAAGG - Intergenic
1052658978 9:31403784-31403806 GGGGGTTGTCTTAAAAAGAAGGG + Intergenic
1056729953 9:89156929-89156951 TTGGTTTGACTTAAAAAGACAGG - Intronic
1058248886 9:102667212-102667234 TGGTATCGCCTTAAAATAAAGGG - Intergenic
1058900379 9:109437451-109437473 TGGGAAAGCCATAAAAACAAAGG - Intronic
1059818322 9:117943754-117943776 TGGAATTGCCAAAAAAAGGAGGG + Intergenic
1202800088 9_KI270719v1_random:168352-168374 GTAGATTGCCTTTAAAAGAATGG - Intergenic
1203724276 Un_GL000216v2:37174-37196 TGGGATTGACTCAAAAGGAATGG - Intergenic
1203725598 Un_GL000216v2:47029-47051 TGGAATGGACTTGAAAAGAATGG - Intergenic
1203730404 Un_GL000216v2:84604-84626 TGGTATGGTCTCAAAAAGAATGG - Intergenic
1203390327 Un_KI270438v1:91500-91522 TGGAATGGGCTGAAAAAGAATGG + Intergenic
1203390943 Un_KI270438v1:96610-96632 TGGAATGGACTCAAAAAGAATGG + Intergenic
1203676630 Un_KI270756v1:28169-28191 TGGAATGGCCTTAAATAGAATGG - Intergenic
1186332387 X:8548436-8548458 ATGGATTCCCTTCAAAAGAATGG - Intronic
1186681237 X:11876215-11876237 TGGTATTTCATTAAAAAGAATGG - Intergenic
1186759834 X:12711680-12711702 TGGGGTTTCTTTTAAAAGAAAGG + Intronic
1189086240 X:38027757-38027779 TGGGCTTGGCTTTAAAAAAAAGG - Intronic
1189174111 X:38936979-38937001 TAGAATTGACTTAAAAATAAAGG + Intergenic
1190091958 X:47446455-47446477 TGGGATTTCCTGAAAAAGAATGG - Exonic
1193473256 X:81932842-81932864 TGGGATGGGGTTAGAAAGAAGGG + Intergenic
1193692406 X:84662108-84662130 TAGGATTGCTATAAAAAGAGAGG - Intergenic
1194174719 X:90631583-90631605 GGGCATTGACTGAAAAAGAATGG + Intergenic
1196290593 X:113936241-113936263 TAGAAATGGCTTAAAAAGAAAGG - Intergenic
1196486958 X:116223062-116223084 TGTGACTGCCTTATAGAGAATGG + Intergenic
1196594255 X:117524937-117524959 TGGAATGGCCTCAACAAGAAGGG + Intergenic
1196948456 X:120851667-120851689 TGGCATTGCCATAAGATGAAAGG - Intergenic
1199374818 X:147095572-147095594 TGGGATGGCATTAAAGTGAATGG + Intergenic
1199807526 X:151315155-151315177 TAGGATTTCCCCAAAAAGAAGGG + Intergenic
1200520930 Y:4209304-4209326 GGGCATTGACTGAAAAAGAATGG + Intergenic
1201137919 Y:11004823-11004845 TGGAATTGAATTAAAAGGAATGG - Intergenic
1201197067 Y:11504793-11504815 TGGAATTGACTCAAATAGAATGG + Intergenic
1201198269 Y:11515508-11515530 TGGAATAGACTTAAATAGAATGG + Intergenic
1201198786 Y:11520245-11520267 TGGAATTCACTTAAATAGAACGG + Intergenic
1201212016 Y:11689451-11689473 TGGAATGGCCTCGAAAAGAATGG + Intergenic
1201214549 Y:11710885-11710907 TGGAATTGACTCAAATAGAATGG + Intergenic
1201215015 Y:11714991-11715013 TGGAATGGACTTAAATAGAACGG + Intergenic
1201215563 Y:11719558-11719580 TGGAATGGACTTAAACAGAAAGG + Intergenic
1201470974 Y:14334641-14334663 TGGGCTTTCCTTAAAATGAAGGG - Intergenic
1202621790 Y:56770762-56770784 TGGGATTGCATCAAATGGAATGG + Intergenic