ID: 1086267367

View in Genome Browser
Species Human (GRCh38)
Location 11:85017308-85017330
Sequence CCTGGACAAGTTTTATGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086267367 Original CRISPR CCTGGACAAGTTTTATGAGG AGG (reversed) Intronic
906655735 1:47547195-47547217 TCAGGACAAGTTTTATAGGGAGG - Intergenic
908823945 1:68115667-68115689 CTTGGACATTTGTTATGAGGGGG + Intronic
910240533 1:85081394-85081416 CCTGGACAATTTTTTTGACTGGG - Exonic
910448633 1:87325214-87325236 CCTGGGCCAGTTTTCTGTGGTGG - Intergenic
913590506 1:120320208-120320230 CCTCCAGAAGTATTATGAGGTGG + Intergenic
913617678 1:120578155-120578177 CCTCCAGAAGTATTATGAGGTGG - Intergenic
914600246 1:149197445-149197467 CCTCCAGAAGTATTATGAGGTGG - Intergenic
917631163 1:176892984-176893006 CCTGCACCAGTTTTAAGAGATGG - Intronic
917719278 1:177770721-177770743 CCTGTACAAACTTTATGAGTTGG - Intergenic
918047760 1:180951794-180951816 CCTGGACAAGGTTTATGACCAGG + Intergenic
919164806 1:193878492-193878514 CCTGGTCTAGTTTTGGGAGGGGG + Intergenic
919941263 1:202288080-202288102 CCTGGACTAGATTGAGGAGGGGG - Intronic
921337443 1:214102381-214102403 TCCAGACAAGTTTGATGAGGAGG + Intergenic
923083895 1:230687111-230687133 CCTGGACAAGCTTCAGGAGCAGG + Exonic
1067058389 10:43065306-43065328 CCTGGAGAAGCTTGATGAGAGGG + Intergenic
1077100935 11:822039-822061 CCTGGACACCTTCTATGGGGTGG + Intronic
1077195136 11:1276057-1276079 CCTGTAAAAGCTTTCTGAGGCGG - Exonic
1081041687 11:38221963-38221985 CCTTCACAAGTTTTATGAAAAGG - Intergenic
1081236009 11:40647887-40647909 CTGGTAAAAGTTTTATGAGGTGG + Intronic
1086267367 11:85017308-85017330 CCTGGACAAGTTTTATGAGGAGG - Intronic
1086734087 11:90283928-90283950 CCTTGAGAAGGATTATGAGGAGG + Intergenic
1087994181 11:104782948-104782970 CACGGACAAGTTATATGAAGTGG - Intergenic
1096127098 12:49128011-49128033 CCTTGAGAAGGATTATGAGGAGG - Exonic
1096134048 12:49185063-49185085 CCTTGAGAAGGATTATGAGGAGG - Exonic
1096145090 12:49273158-49273180 CCTTGAGAAGGATTATGAGGAGG + Exonic
1097247519 12:57614730-57614752 GCTGCACAGGTTTGATGAGGAGG - Exonic
1099260418 12:80373874-80373896 CCAGGACAAGTTTTAGGAGAGGG + Intronic
1099864452 12:88261326-88261348 CATTGAGACGTTTTATGAGGTGG - Intergenic
1100622033 12:96286121-96286143 CCTGGCCAAGTTTCCTGAGATGG + Exonic
1101470029 12:104987094-104987116 CCTGTAGAATTTTTGTGAGGAGG + Intronic
1102320430 12:111928805-111928827 CCTGGACAAGTGTCATGGGAGGG + Intergenic
1103785879 12:123432646-123432668 AGTGGACAAGTTTCATCAGGCGG - Intronic
1109257420 13:60100176-60100198 CCTGGACAACTTTGTTAAGGTGG - Intronic
1111914716 13:94348921-94348943 ACTGAACAAGTTTTCTGAGGAGG - Intronic
1116283664 14:42944721-42944743 CCTGGACAAGATTTAAAAGATGG - Intergenic
1117236362 14:53781213-53781235 CATTGACCAGTTTCATGAGGGGG + Intergenic
1118610299 14:67534044-67534066 CTTGGAAGAGTTTTATGAGGTGG - Intronic
1119373650 14:74169697-74169719 CATGAACAAGTTTTAAAAGGGGG - Intronic
1119437052 14:74604462-74604484 TCTGCACAATTTTTATGTGGAGG + Intronic
1120606097 14:86580462-86580484 CCTGAAAAAGTTTTACGTGGTGG + Intergenic
1124553167 15:30700996-30701018 TCTGGACAATGTTTTTGAGGGGG + Intronic
1125008905 15:34849176-34849198 CCTTGAGAAGGTTTATGAGGAGG - Intergenic
1128754639 15:70173209-70173231 CATGGACAAGATTTCTGAAGGGG - Intergenic
1130647351 15:85740892-85740914 CCTGGAGCATTTTTATGAGACGG + Intronic
1130943888 15:88536205-88536227 CCTGGGGAAGATTTCTGAGGAGG - Intronic
1131366621 15:91846958-91846980 CCTGCACAAGTGTTTAGAGGAGG + Intergenic
1131820231 15:96264955-96264977 ACTGGACAAGTTATTGGAGGAGG - Intergenic
1132049769 15:98597456-98597478 CCTGGAGAAGTTTTCAGAGTGGG - Intergenic
1132574250 16:657350-657372 CCTTGACAAGGTTACTGAGGCGG - Intronic
1135258283 16:20959213-20959235 CCTGGAGAAGATTTGTGAGGAGG - Exonic
1137604802 16:49780333-49780355 CTTGGACCAGTTCTCTGAGGAGG - Intronic
1137675311 16:50301115-50301137 CCTGGACAAGGCGTACGAGGTGG + Exonic
1139506625 16:67401280-67401302 CCTGGAGAGGTCTGATGAGGAGG - Intronic
1140201968 16:72902356-72902378 CCCGGACCAGCTTAATGAGGTGG + Intronic
1140448763 16:75053155-75053177 CCTGAACCAGTTTTATTATGTGG - Intronic
1143566421 17:7723970-7723992 CCTGAACAAGTTGAATGAGCTGG + Intronic
1146924346 17:36733750-36733772 CCTGGAACAGTTCTGTGAGGTGG - Intergenic
1148126572 17:45240526-45240548 CCTGGACAATATTTTTGATGTGG + Exonic
1152012336 17:77726241-77726263 CTTGGAGAAGTTTTGTGAGGCGG - Intergenic
1152279734 17:79378336-79378358 CCTGGACTAGCTTCATGAGGGGG + Intronic
1157567821 18:48691669-48691691 CTTGGACAATTTCTTTGAGGAGG - Intronic
1158635900 18:59157397-59157419 CCAGGACAAGTTTTCTAAGTAGG - Intronic
1163442774 19:17329958-17329980 CCAGGACAACTTTGATGATGAGG + Exonic
1164736708 19:30546391-30546413 CCTGGACACTTTTTCAGAGGTGG - Intronic
927432623 2:23040107-23040129 CCTAGAGAGGTTCTATGAGGTGG + Intergenic
928892639 2:36221948-36221970 GGTGGACATGTTTTTTGAGGCGG + Intergenic
928898114 2:36288171-36288193 GTTGGACAAGTTAGATGAGGTGG - Intergenic
930816266 2:55601268-55601290 CCTTGTCAGGTTTTAAGAGGAGG - Intronic
935648548 2:105362581-105362603 ACAGGAGAAGTTTTATGATGTGG - Intronic
942076130 2:172358741-172358763 CCTGGAAAACTAATATGAGGAGG + Intergenic
942672471 2:178390663-178390685 AATGGCCAAATTTTATGAGGAGG - Intronic
942889763 2:180975210-180975232 CCTGGAGGAGTATTATGAGAAGG - Intronic
944668477 2:201975784-201975806 CCAGGAAAGGTTTTCTGAGGAGG + Intergenic
945531263 2:210955993-210956015 CATAGACAAGTTTAATGAAGTGG - Intergenic
946366152 2:219250396-219250418 CCTGGAGAAGGATTATGAGGAGG - Exonic
946935515 2:224716329-224716351 CCTGGATAAGTCTCATGAGCTGG + Intergenic
947385562 2:229587205-229587227 CCTGGGCTAGTTTTAGGAGCAGG - Intronic
947718369 2:232352872-232352894 CCTGGACAAGGTTTCCCAGGAGG - Intergenic
947910923 2:233800213-233800235 CCGGGAGAAGTTTTATCAGAGGG + Exonic
1169259631 20:4126549-4126571 TCTGGAAGAGTTTTATGAGATGG + Intronic
1176332661 21:5563032-5563054 CCTGGACAAGTTTTCCGAATGGG + Intergenic
1176395096 21:6257919-6257941 CCTGGACAAGTTTTCCGAATGGG - Intergenic
1176442061 21:6731185-6731207 CCTGGACAAGTTTTCCGAATGGG + Intergenic
1176466323 21:7058254-7058276 CCTGGACAAGTTTTCCGAATGGG + Intronic
1176489884 21:7440032-7440054 CCTGGACAAGTTTTCCGAATGGG + Intergenic
1176885171 21:14246555-14246577 CCAGGCCAAGTTGTATGAGGAGG - Intergenic
1177012374 21:15744484-15744506 CCTGGCTAATTTTTATGACGGGG + Intronic
1179373814 21:40830940-40830962 CCTGGCCAAGGTTTGTGAGGTGG + Intronic
1183658570 22:39205326-39205348 CCTGTGCATGTTTTGTGAGGGGG - Intergenic
1183718536 22:39548519-39548541 CCTGGAAAGGTTTTATGAAAGGG + Intergenic
1184108227 22:42381016-42381038 CCTGGAAATGTTTGCTGAGGAGG + Exonic
952655777 3:35783635-35783657 CATGGAGAAGTTTTATGAAATGG + Intronic
953315731 3:41924951-41924973 CCTGAACATGGTATATGAGGAGG + Intronic
954579923 3:51697639-51697661 CCTGGACCAGTTTGCTGAGTTGG + Intronic
955354605 3:58220734-58220756 TCTGTTCAAGTTTTATCAGGAGG - Intergenic
956206301 3:66758569-66758591 AATGGCCAAGTGTTATGAGGTGG + Intergenic
960894831 3:122492236-122492258 CCAGTACAACTTTTATCAGGTGG + Intronic
962575336 3:136751506-136751528 CCTGGACACGTTTCACAAGGAGG + Intronic
962857354 3:139359807-139359829 TCTGTGCAAGTTTTATGATGTGG + Intronic
973084031 4:46032050-46032072 CTTGGACAATTTGTAGGAGGGGG - Intergenic
975391758 4:73826672-73826694 CCAGGAAAAGTATTATGACGTGG - Intergenic
975866202 4:78726290-78726312 CCTGGATAATTTTTTTGTGGAGG - Intergenic
978735876 4:112083647-112083669 CCTGAAGAACTTCTATGAGGGGG - Intergenic
981264474 4:142765798-142765820 CTTGCACAAGTTTTATGAGCTGG - Intronic
982484261 4:155948640-155948662 CCTGAACCAGTCTCATGAGGAGG + Intronic
984906135 4:184627557-184627579 CCTAGCCTAGTTTTTTGAGGTGG - Intergenic
988574038 5:32402027-32402049 CCTGGACATCTTTTATATGGCGG - Intronic
990238486 5:53793434-53793456 CCTGTACAAGTGTTATTAAGTGG - Intergenic
996119259 5:119652567-119652589 CCTTGAAAAGGATTATGAGGAGG - Intergenic
998806765 5:145924820-145924842 CCTGTAAAACTTTTAAGAGGGGG - Intergenic
999408555 5:151328855-151328877 CCTGGACCAGTTTCGTGAGCAGG - Intronic
1002631784 5:180586806-180586828 CCTGTTCAAGTTTTATCATGGGG + Intergenic
1002898297 6:1391611-1391633 GCTGGGCAAGTGTTAAGAGGAGG + Intronic
1003168307 6:3700448-3700470 CCTGCAATAGATTTATGAGGTGG + Intergenic
1006445339 6:34076791-34076813 CCTGGGGAAGTTTTCTGGGGTGG - Intronic
1016032842 6:139355978-139356000 CATGCACAAGTTTTATGAAGCGG + Intergenic
1017798798 6:157873027-157873049 CCTGGAGAAATTTTGTGTGGAGG - Intronic
1022317687 7:29260773-29260795 ACCGGACCTGTTTTATGAGGTGG + Intronic
1022471337 7:30683396-30683418 CCTGGGCAAGTTCTCTGGGGAGG - Intronic
1022911352 7:34901993-34902015 CCTGGCCATGTTTTATTAGTGGG + Intergenic
1024512942 7:50217300-50217322 CCTGGACCTGTGATATGAGGAGG + Intergenic
1027488450 7:78791299-78791321 ATTGGAAAAGTTTTTTGAGGAGG + Intronic
1033458353 7:141522672-141522694 CCAGGAAAACTTTTATCAGGTGG - Intergenic
1035357307 7:158283953-158283975 CCTGGAAATGTTTTAGGAGCAGG - Intronic
1041633595 8:60117037-60117059 CCTGAACAACTTTTAGGTGGCGG - Intergenic
1043779873 8:84318893-84318915 CCTGTAAGACTTTTATGAGGAGG - Intronic
1050289850 9:4142470-4142492 CCTGGAACAGTTGAATGAGGAGG - Intronic
1052375984 9:27718048-27718070 CTTGGACACTTTTTATCAGGAGG - Intergenic
1053090052 9:35266963-35266985 TCTGGACAAATATTATGAGAGGG + Intronic
1056548917 9:87635530-87635552 AATGGACCAGTTTTAGGAGGAGG + Intronic
1059599322 9:115759315-115759337 ACTAGACAAGTTTAAGGAGGTGG + Intergenic
1062473071 9:136714685-136714707 CCAGGACAAGTGGTCTGAGGGGG + Intronic
1203429430 Un_GL000195v1:77299-77321 CCTGGACAAGTTTTCCGAATGGG - Intergenic
1192481848 X:71492717-71492739 CCTGGACAAGTGCTATGAGAAGG - Intronic
1194883964 X:99289586-99289608 ACTGGACAAGTTATAGGAGAGGG - Intergenic
1197576494 X:128218579-128218601 CATGGACAAGTTTTGTTTGGAGG - Intergenic